ID: 1136030770

View in Genome Browser
Species Human (GRCh38)
Location 16:27501243-27501265
Sequence GTGCGGAACCTGTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136030770_1136030776 9 Left 1136030770 16:27501243-27501265 CCTTCCTCAGACAGGTTCCGCAC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1136030776 16:27501275-27501297 AATGGACTTCTTGCAGCACTTGG 0: 1
1: 0
2: 2
3: 13
4: 138
1136030770_1136030777 12 Left 1136030770 16:27501243-27501265 CCTTCCTCAGACAGGTTCCGCAC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1136030777 16:27501278-27501300 GGACTTCTTGCAGCACTTGGTGG 0: 1
1: 0
2: 3
3: 11
4: 163
1136030770_1136030773 -9 Left 1136030770 16:27501243-27501265 CCTTCCTCAGACAGGTTCCGCAC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1136030773 16:27501257-27501279 GTTCCGCACCAAGCGGACAATGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136030770 Original CRISPR GTGCGGAACCTGTCTGAGGA AGG (reversed) Exonic
900310999 1:2033072-2033094 GAGAGGAACCTGTTTGGGGAGGG + Intergenic
905178615 1:36153386-36153408 GTGCGGAGGATGGCTGAGGAGGG - Intronic
906792456 1:48670716-48670738 GTAGGGAGCCTGCCTGAGGAAGG - Intronic
908649673 1:66317997-66318019 TTGCCAAACCTGGCTGAGGATGG + Intronic
913207809 1:116557241-116557263 CTGTGGAACCTGGCTGAAGAAGG + Intronic
914942730 1:152037039-152037061 GCGCGGAAGCTGTCTGAGTAAGG - Intronic
919469211 1:197957998-197958020 GTGGGGAAGCTGTGGGAGGAAGG + Intergenic
919741594 1:200984410-200984432 GACCTGAACCTGCCTGAGGAAGG + Intronic
920712711 1:208310345-208310367 TAGACGAACCTGTCTGAGGAAGG - Intergenic
923205809 1:231757979-231758001 TCTCGGAACCTGTGTGAGGAGGG + Intronic
924275457 1:242381759-242381781 GTGGGGAAGCTGTTTGAGGGAGG - Intronic
1062901535 10:1150362-1150384 GGGGGCCACCTGTCTGAGGATGG - Intergenic
1064872816 10:19958686-19958708 GTTCGGAATTTGTCTGGGGAAGG + Intronic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1068268392 10:54685236-54685258 TTGAAGAACCTGTCTGAGGGTGG + Intronic
1068615765 10:59114267-59114289 GTGCAGAAACTATCTGAGGCTGG - Intergenic
1070151956 10:73811001-73811023 GTGCGGGAGATCTCTGAGGACGG + Intronic
1076164164 10:128268564-128268586 GTGCGGCCCCGGTCTGAGGGAGG + Intergenic
1076882124 10:133244801-133244823 GAACGGAACCTTTCTGAGGTGGG - Intergenic
1081627082 11:44662570-44662592 GTGTGGCTCCTGTCTGGGGAGGG - Intergenic
1082784242 11:57308315-57308337 AATCGGAACCTTTCTGAGGAGGG - Intronic
1084503074 11:69546336-69546358 GTGCCGACCCTGGCTGAGGGAGG + Intergenic
1086257152 11:84890860-84890882 GTGCAGAGTATGTCTGAGGATGG - Intronic
1091272995 11:134331406-134331428 GTGTGGTTCATGTCTGAGGAGGG - Intergenic
1094359366 12:29613384-29613406 GCTGGGAACCTGTCTGAGGAGGG + Intronic
1095638566 12:44459915-44459937 GTGGCATACCTGTCTGAGGAAGG + Intergenic
1100829382 12:98503899-98503921 GCGCGGAACCTGTTGGGGGAGGG + Intergenic
1104580406 12:130007286-130007308 GGGCGGAACCTCCCTGAGAAGGG + Intergenic
1106727053 13:32496782-32496804 GTGGGGAACATGTCAGAGGTGGG - Intronic
1111522165 13:89419531-89419553 GTGCTGATCCTGTCTGAGACAGG - Intergenic
1111532471 13:89556855-89556877 GTGCTGAGCCTGCCTGATGAAGG - Intergenic
1112060430 13:95734228-95734250 GTGATGAACCTGTCTGGGAAAGG + Intronic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1115464370 14:33698673-33698695 TTGTGAAACCTGTCTGAGGAAGG - Intronic
1122754779 14:103969863-103969885 GTGAGGTCTCTGTCTGAGGAGGG + Intronic
1122896765 14:104761570-104761592 GTGAGGAAACTGCCTGAGGCTGG + Intronic
1127347581 15:58115877-58115899 GAAGGGAACCTGTCTGTGGATGG + Intronic
1129886111 15:79038241-79038263 GTGCTGAAGCTGTCTGGGAATGG - Intronic
1131419263 15:92290553-92290575 GTGCAGGGCGTGTCTGAGGATGG + Intergenic
1132311552 15:100861439-100861461 GAGCAGAAGCTGTCTGTGGAGGG - Intergenic
1135091194 16:19519232-19519254 GTGGGGTCCCTCTCTGAGGAGGG + Intronic
1136030770 16:27501243-27501265 GTGCGGAACCTGTCTGAGGAAGG - Exonic
1142125113 16:88406318-88406340 GTGTGGAATGTGTCTCAGGATGG + Intergenic
1142699729 17:1651585-1651607 GTGCGATTCCTGTCTGTGGATGG - Intronic
1143861612 17:9895392-9895414 GGGAAGAACCTGTCTGAGAATGG + Intergenic
1145817149 17:27803820-27803842 GACGGGGACCTGTCTGAGGAAGG - Intronic
1155270097 18:24132598-24132620 GTGCGGACCCTGGGTGGGGAGGG - Exonic
1156415058 18:36879382-36879404 GTGAGGAAGCTTTCAGAGGAAGG - Intronic
1156764565 18:40636263-40636285 GTGAGGAAACTGTAAGAGGAAGG - Intergenic
1160950349 19:1663973-1663995 GTGCGGATCCTGCAGGAGGAGGG - Intergenic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1168407540 19:56118779-56118801 CTGTGAAACATGTCTGAGGATGG + Intronic
1168717742 19:58539074-58539096 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717757 19:58539152-58539174 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717766 19:58539191-58539213 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717774 19:58539230-58539252 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717783 19:58539269-58539291 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717791 19:58539308-58539330 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717811 19:58539422-58539444 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717819 19:58539461-58539483 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717828 19:58539500-58539522 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717837 19:58539539-58539561 GGGAGCATCCTGTCTGAGGAGGG - Intergenic
1168717852 19:58539617-58539639 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717861 19:58539656-58539678 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717888 19:58539770-58539792 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717943 19:58540002-58540024 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717952 19:58540041-58540063 GTGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717961 19:58540080-58540102 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168717970 19:58540119-58540141 GGGAGAATCCTGTCTGAGGAAGG - Intergenic
1168717980 19:58540158-58540180 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718006 19:58540275-58540297 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718015 19:58540314-58540336 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718026 19:58540351-58540373 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718037 19:58540390-58540412 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718058 19:58540466-58540488 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718067 19:58540505-58540527 GGGAGCATCCTGTCTGAGGAGGG - Intergenic
1168718078 19:58540544-58540566 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718109 19:58540661-58540683 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718152 19:58540853-58540875 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718161 19:58540892-58540914 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718170 19:58540931-58540953 GTGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718179 19:58540970-58540992 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718188 19:58541009-58541031 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718199 19:58541048-58541070 GGGAGCATCCTGTCTGAGGAGGG - Intergenic
1168718208 19:58541087-58541109 GGGAGAATCCTGTCTGAGGAAGG - Intergenic
1168718218 19:58541126-58541148 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718249 19:58541243-58541265 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718258 19:58541282-58541304 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718269 19:58541319-58541341 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718280 19:58541358-58541380 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718301 19:58541434-58541456 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718312 19:58541473-58541495 GAGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718319 19:58541512-58541534 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718328 19:58541551-58541573 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718344 19:58541629-58541651 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718353 19:58541668-58541690 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718362 19:58541707-58541729 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718389 19:58541821-58541843 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718445 19:58542052-58542074 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718454 19:58542091-58542113 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718463 19:58542130-58542152 GTGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718472 19:58542169-58542191 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718481 19:58542208-58542230 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718513 19:58542326-58542348 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718522 19:58542365-58542387 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718531 19:58542404-58542426 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718586 19:58542635-58542657 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718595 19:58542674-58542696 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718604 19:58542713-58542735 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718611 19:58542752-58542774 GGGAGAATCCTGTCTGAGGAGGG - Intergenic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
930565884 2:53020076-53020098 TTGCTCAACCTGTTTGAGGAGGG - Intergenic
937083449 2:119156477-119156499 GGGAGGAGGCTGTCTGAGGAGGG + Exonic
937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG + Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
942433301 2:175940410-175940432 GTGAGAAAACTATCTGAGGATGG + Intronic
944920352 2:204406242-204406264 CTGAGGAACCTGTTTGAGAATGG - Intergenic
946064014 2:216970665-216970687 GTGGGGAAGCTCTATGAGGATGG - Intergenic
946347711 2:219124556-219124578 GTGAGGACCATGTGTGAGGAGGG - Intronic
947724668 2:232389233-232389255 GCGTGGCACCAGTCTGAGGATGG - Intergenic
1169207484 20:3748529-3748551 TGGTGGAGCCTGTCTGAGGAAGG + Intronic
1171018379 20:21562071-21562093 GAGAGGAACCTGCCTGAGGATGG - Intergenic
1171384787 20:24763019-24763041 GTGTGCAACCTGGCAGAGGAGGG + Intergenic
1180245251 21:46542918-46542940 GTGCAGACCCTGTCTGTGGGTGG + Intronic
1182332163 22:29558820-29558842 CTGAGAACCCTGTCTGAGGATGG - Intronic
1183563943 22:38599349-38599371 GGGAGGAATGTGTCTGAGGAGGG + Intronic
1184738010 22:46410448-46410470 ATGCGGAACCTGTCAGTCGACGG - Exonic
1184839455 22:47043981-47044003 GGGAGGAGCCTGTCTGAGCAGGG + Intronic
950423647 3:12913111-12913133 GGACAGAGCCTGTCTGAGGAAGG + Intronic
950946453 3:16953688-16953710 GGGCGTTACCTGTCTGAGAAAGG + Intronic
950998200 3:17527600-17527622 GTTCTTAACCTTTCTGAGGAAGG - Intronic
954692573 3:52403442-52403464 CTGCTGCACCTGGCTGAGGATGG - Exonic
959970966 3:112409366-112409388 GTGCGGAATCTCTCTTGGGAAGG + Intergenic
963486294 3:145938087-145938109 GAACGGAACTAGTCTGAGGAAGG - Intergenic
963948374 3:151170888-151170910 GGGCAGACCCTGTCTGAAGAGGG + Intronic
967148511 3:186626900-186626922 GAGGGGATCCTGCCTGAGGATGG - Intergenic
967813320 3:193778944-193778966 GTGCGGATCCTGTCTGGAGTGGG + Intergenic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
985947702 5:3199828-3199850 GTGTGGGGCCTTTCTGAGGATGG - Intergenic
986061061 5:4191805-4191827 GTGCAGGGCCTTTCTGAGGAGGG + Intergenic
990165613 5:52989920-52989942 GCGCGGCACCTGTCTGAGCCAGG - Intronic
996871803 5:128200768-128200790 CTGCGGACCCTGGCTCAGGAAGG + Intergenic
999709449 5:154303464-154303486 GTGAGGAAGCTATCTGAGGCTGG + Intronic
1002407457 5:179046978-179047000 GTGAGGAAACTGCCTGAGGCTGG - Intergenic
1004255354 6:14058330-14058352 GTGAGGGTCCTGTCTGAAGATGG + Intergenic
1007936531 6:45737469-45737491 GAGCAGAGCCAGTCTGAGGAGGG - Intergenic
1015036043 6:128655873-128655895 GTGAGGAAACTCTCTGAGGATGG - Intergenic
1015562135 6:134527314-134527336 GTGAGGAAACTCTCTGATGAAGG - Intergenic
1025002426 7:55327810-55327832 GTCCGTGTCCTGTCTGAGGAAGG - Intergenic
1028752186 7:94394227-94394249 GGGCGGGTCCTGTCTGTGGAGGG - Intergenic
1032686420 7:134239003-134239025 GTGCGGAGCCTGTCTTAGCAAGG + Intronic
1033301769 7:140192517-140192539 GTGGGTAACGTGTCTGAGGGGGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034930207 7:155155466-155155488 GTGAGAAACATGTCTGGGGATGG - Intergenic
1035590400 8:808605-808627 GGGCGGAGCCTGTGTGAGGAGGG + Intergenic
1036824372 8:11964914-11964936 GGGTGGCACCTGTCTGAGGCTGG + Intergenic
1038493731 8:27987503-27987525 AAGCTGAACCTGTGTGAGGATGG - Exonic
1041383864 8:57279112-57279134 GTGCCGCAGCTGTCGGAGGATGG + Intergenic
1043413970 8:80029942-80029964 GGGCGGAGCCTGGCTTAGGAAGG - Intronic
1044739521 8:95311948-95311970 GTGCAAAACGTGTCAGAGGAGGG - Intergenic
1045253711 8:100502180-100502202 GGGCAGAGCCTGTCTGAGGATGG - Intergenic
1049606870 8:143533633-143533655 GAGAGGGTCCTGTCTGAGGAAGG - Intronic
1049749890 8:144278076-144278098 GTGCGTGGCCTGACTGAGGAGGG + Intronic
1049974932 9:852591-852613 GTGCAGAAGCTGTCAGATGAAGG + Intronic
1056770815 9:89476804-89476826 GAGCAGAACCTGACTGCGGAAGG + Intronic
1058866565 9:109166900-109166922 CTGCGCTACCTGTCGGAGGAGGG - Exonic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1060485160 9:124041948-124041970 GAGCTGAGCCTGCCTGAGGAGGG + Intergenic
1061060120 9:128246072-128246094 GTGCGGTCCCTGCCTGAGGCTGG + Intronic
1192436057 X:71144708-71144730 GAGCGGAACGTGCCTGAGCATGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1198607399 X:138356553-138356575 GAACTGAACCTGTCTGGGGAAGG + Intergenic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199742083 X:150745245-150745267 CTGCGCAACCTGGCTGAGGGTGG + Intronic
1200180969 X:154150500-154150522 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200186612 X:154187614-154187636 GAGGGGAGACTGTCTGAGGATGG + Intergenic
1200192264 X:154224752-154224774 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200198019 X:154262556-154262578 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200411773 Y:2868347-2868369 GTCGGGAACCTGTCAGAGGCGGG - Intronic