ID: 1136030778

View in Genome Browser
Species Human (GRCh38)
Location 16:27501306-27501328
Sequence ATGGATCAGGAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 546}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136030778_1136030782 -3 Left 1136030778 16:27501306-27501328 CCTTCCTGCTTCTCCTGATCCAT 0: 1
1: 0
2: 1
3: 58
4: 546
Right 1136030782 16:27501326-27501348 CATGATCATCTTCTGAATCCTGG 0: 1
1: 0
2: 2
3: 19
4: 336
1136030778_1136030783 -2 Left 1136030778 16:27501306-27501328 CCTTCCTGCTTCTCCTGATCCAT 0: 1
1: 0
2: 1
3: 58
4: 546
Right 1136030783 16:27501327-27501349 ATGATCATCTTCTGAATCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136030778 Original CRISPR ATGGATCAGGAGAAGCAGGA AGG (reversed) Exonic
900089285 1:912717-912739 ATAGTTCAGGAGGGGCAGGAGGG - Intergenic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901174427 1:7288536-7288558 ATGGAAGAGGAGAGGCAGGCAGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901680364 1:10909555-10909577 ATGGGTCAGGAAATGAAGGAAGG - Intergenic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
902982350 1:20134086-20134108 AGGGATCAGGGGAGGAAGGAAGG - Intergenic
903134230 1:21298803-21298825 ATGGAGCAGGTGAGGCAGGGTGG - Intronic
903314150 1:22487877-22487899 ATGAATCTGGAGAGGCAGGCAGG - Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903713969 1:25349105-25349127 ATGGGGCAGGAGAAGCAGTGTGG + Intronic
906008404 1:42500215-42500237 ATTGAACAGGAGAAGCAAGCAGG - Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909590463 1:77342852-77342874 ATGAATCAGGAGGGGCAGGTGGG - Intronic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
910238733 1:85063317-85063339 GTGGACCAGGAGCAGCAGGAGGG + Intronic
910534401 1:88279931-88279953 ATGGAGCATGAATAGCAGGAAGG - Intergenic
911168283 1:94744633-94744655 CTGGCTCAGGAGAACCAGGGAGG + Intergenic
911319046 1:96389906-96389928 ATGAATCAGGAGAATCATGATGG - Intergenic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
911828766 1:102523540-102523562 ATGGTCCAGGAGTGGCAGGATGG - Intergenic
912379926 1:109241849-109241871 AGGACTCAGGGGAAGCAGGATGG - Intergenic
912412396 1:109487977-109487999 CTTGATCAGGAGACACAGGATGG - Intronic
912520964 1:110244412-110244434 ATGGATCAGGACTAGCCTGAGGG + Intronic
914196204 1:145449295-145449317 ATAGACCAGCAGATGCAGGAAGG - Intergenic
914202499 1:145498513-145498535 ATTGATCAGGATTAGCAGTAAGG + Intergenic
914236429 1:145816435-145816457 ATTGATCAGGATTAGCAGTAAGG + Intronic
914481622 1:148071663-148071685 ATTGATCAGGATTAGCAGTAAGG + Intergenic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915034503 1:152910767-152910789 AAGCATCTGGAGCAGCAGGAGGG + Exonic
915360516 1:155283913-155283935 ATGGAGGAGGACAAGCAGGGAGG + Intronic
915368028 1:155326206-155326228 ATAGTTCAGAGGAAGCAGGAGGG - Intronic
915536582 1:156539908-156539930 ATGGTTCTGGACAAGCAGAAGGG - Exonic
916308047 1:163361766-163361788 ATCAATGACGAGAAGCAGGAAGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917508446 1:175649860-175649882 ATGGATCAGGAGAATACAGAGGG - Intronic
917638120 1:176956649-176956671 ATGGGTCAGGGGAGGCAGGGAGG - Intronic
917845239 1:179014981-179015003 AGGGATCAGGAAAAGCAGCAAGG - Intergenic
918149149 1:181783083-181783105 AAGGATGAGGTGGAGCAGGATGG - Intronic
918212714 1:182365812-182365834 ATGAAGCTGGAGAAGCAGGGAGG + Intergenic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919348388 1:196416647-196416669 ATGAATCAGGAGAAGAAATAAGG - Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920203831 1:204277195-204277217 CTGGCTCTGGAGAACCAGGAGGG + Intronic
920750016 1:208665227-208665249 ATTGAACAGGAGAGGCAGGTGGG - Intergenic
921032699 1:211347603-211347625 ATGGATGGGGAGAGGAAGGATGG + Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921977486 1:221218442-221218464 ATTGATCAGGAGTAGCAGCCAGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
923380432 1:233411917-233411939 AGGGAACTGCAGAAGCAGGAAGG + Intergenic
923538547 1:234871522-234871544 AGGGCTGGGGAGAAGCAGGATGG - Intergenic
923791547 1:237115352-237115374 ATGGATCCGGAGAGGGAAGAGGG - Intronic
924860875 1:247921139-247921161 GTGAATCAGGAGAATCATGAGGG - Exonic
924874325 1:248084453-248084475 GTGAATCAGGAGAATCATGAGGG + Intronic
924890552 1:248273671-248273693 GTGAATCAGGAGAATCATGAGGG + Exonic
924892205 1:248295435-248295457 GTGAATCAGGAGAATCATGAGGG + Exonic
1063035635 10:2284224-2284246 ATGGATGAGGAGAATCACTAGGG + Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063603613 10:7504763-7504785 TTGGATTAGGAGTAGCAGGGGGG + Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064414495 10:15136614-15136636 GAGGATCAGGAGGATCAGGAGGG - Intronic
1064541280 10:16407418-16407440 AGTGGTCAGGAGAAGCAGGCAGG + Intergenic
1064807129 10:19147973-19147995 ATGAAACAGGAGAGGAAGGAAGG + Intronic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067450017 10:46376364-46376386 ATGGACCTGGGGAAGCAGGCAGG + Intronic
1067576410 10:47411326-47411348 ATGGATCACCAGGAGCAGGGAGG + Intergenic
1067587228 10:47483399-47483421 ATGGACCTGGGGAAGCAGGCAGG - Intronic
1067634285 10:47991166-47991188 ATGGACCTGGGGAAGCAGGCAGG - Intergenic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069362608 10:67660321-67660343 ATTGTTGGGGAGAAGCAGGAGGG - Intronic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071176347 10:82930915-82930937 ATGGATTGAGAGAAGCAGGGAGG + Intronic
1071482939 10:86078724-86078746 AGGGCTCGGGAGAGGCAGGAAGG + Intronic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074093822 10:110289682-110289704 ATTGTTCAGAAGTAGCAGGAAGG - Intergenic
1074412841 10:113243042-113243064 ATGGATACGTGGAAGCAGGAGGG + Intergenic
1075005974 10:118830406-118830428 GTGGATTAGGAGGAGCTGGAGGG - Intergenic
1075166101 10:120069664-120069686 ATGAATTAGGAGAAGCACGGTGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076604303 10:131679241-131679263 ATAGATTAGGAGAGGCAGGCTGG + Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1079129877 11:17741155-17741177 AAGGATCATGGGAAGCAGGGGGG - Intronic
1081189738 11:40088703-40088725 ATGGAACAGGAGGAGAAGAAAGG + Intergenic
1081503214 11:43687676-43687698 ATGGAACTGGAGAGGCAAGAAGG + Intronic
1081567761 11:44270387-44270409 AAGGAACAGGAGAAGAAGGAGGG - Intronic
1081784036 11:45733755-45733777 ATGGAGCTGGAGATGCAGGCAGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083541357 11:63513743-63513765 AGGGATGAGGTGAAGAAGGAGGG - Intronic
1083542312 11:63520851-63520873 ATTGAACAGGAGAAGCAAGCTGG - Intergenic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085258085 11:75188308-75188330 ATGAATCAAGAAAAGCAGGAAGG - Intronic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1088707373 11:112475929-112475951 ATCGATTAGAAGCAGCAGGAAGG - Intergenic
1089205952 11:116762988-116763010 AAGGATCTGGAGAATCATGACGG + Exonic
1089255657 11:117192654-117192676 ATGGAGCAGGGGAACCAGGCAGG - Intronic
1089354502 11:117840923-117840945 ATAGATCAGAAGAGACAGGATGG + Intronic
1089360211 11:117880593-117880615 ATGAAGCAGGAGAGGCAGGTGGG - Intergenic
1089393232 11:118116239-118116261 ATGGTTCAGGCCAAGCACGATGG - Intronic
1089686225 11:120148342-120148364 ATGAAACAGGAGTGGCAGGAAGG + Intronic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090330132 11:125924859-125924881 TAGGATAAGGAGAACCAGGATGG - Intergenic
1090332264 11:125941522-125941544 ACAGATCAGGAGAGGAAGGAAGG - Intergenic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1091525813 12:1299747-1299769 ATGGATCAAGGGAAACAGGAAGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093781615 12:23143612-23143634 ATGGATGTGGAGAAATAGGAAGG - Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1095218465 12:39578583-39578605 ATGAATCAGGAGAATCAGAAGGG + Intronic
1096051876 12:48616803-48616825 GTAGATCAGGAAAAGCAAGATGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096575806 12:52552219-52552241 GCGGATCAGGAGCAGCAGGAAGG - Intronic
1100454857 12:94742061-94742083 AAGGACCAGGAGTGGCAGGAAGG + Intergenic
1100708343 12:97226775-97226797 ATAGATCAAGAGAAGAAGGCTGG + Intergenic
1101269607 12:103129805-103129827 TTGGACCAGGATAAGCTGGAAGG - Intergenic
1102406834 12:112680741-112680763 ATTGATCAAGAGAAAAAGGAGGG - Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104903221 12:132200156-132200178 GTGGACCAGGAGCTGCAGGAGGG + Intronic
1105009056 12:132742957-132742979 ATGCATCTGTAGAACCAGGAGGG - Intronic
1105341429 13:19529631-19529653 AGGGATCAGGAGAAGAAAGTAGG - Intronic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106338138 13:28803371-28803393 AAGGATGAGGAGAAGCTGGGCGG + Intergenic
1106982730 13:35308182-35308204 AGGGATCAGGAGTAGAATGAAGG + Intronic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1107430510 13:40336196-40336218 ATGGCTCAGCTGGAGCAGGATGG - Intergenic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109102943 13:58209474-58209496 ATGGATCTGGAAAGGAAGGAAGG + Intergenic
1110513937 13:76386356-76386378 ATGTATCAAGAGAAACAGCAAGG + Intergenic
1110611931 13:77498408-77498430 AAGTATCAGGAGAACCATGATGG - Intergenic
1111316762 13:86572332-86572354 ACGGTTCAGCAGAAACAGGAAGG - Intergenic
1112009316 13:95280667-95280689 AAGGATGAGGTGCAGCAGGAAGG - Intronic
1112872793 13:103995385-103995407 ATGGGGTAGGAGAAGCAGGGAGG - Intergenic
1112982914 13:105408895-105408917 ATGGATCAGAAGAAAAAAGAGGG + Intergenic
1113987034 13:114325456-114325478 GTGCTTCTGGAGAAGCAGGAGGG - Exonic
1114306892 14:21431486-21431508 TTGGATCAGATGAACCAGGATGG - Exonic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116097229 14:40386268-40386290 ATGGAAGAGGAGGAGCTGGAAGG + Intergenic
1116131206 14:40856909-40856931 AGGGATCAAGGGAAGGAGGATGG + Intergenic
1116944712 14:50825856-50825878 ATGGATCAAGGGAGGTAGGAAGG - Intronic
1117209278 14:53478689-53478711 ATGTTTCAGGAGCATCAGGAGGG - Intergenic
1118021518 14:61720906-61720928 ATGGAACAGGAGAAAAAGGGGGG - Intronic
1118515677 14:66526092-66526114 ATGGATAGGGAGAATCAGTATGG - Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119395187 14:74321061-74321083 TGGGTTCAGGAGAAACAGGAAGG + Intronic
1119409978 14:74424578-74424600 ATGGAAGAGGAGAAGAAGGGAGG + Intronic
1119536771 14:75409213-75409235 AGGTTTCAGGAGAAGCAGAAAGG - Intergenic
1119625388 14:76170016-76170038 ATGCATCTGAAGCAGCAGGAGGG - Intronic
1119907171 14:78316431-78316453 AGGGAGCTGGAGATGCAGGAAGG + Intronic
1121431442 14:93891145-93891167 AGGAATCCGGAGCAGCAGGAAGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122325914 14:100880591-100880613 TTGGGTCAGGAGTGGCAGGAAGG + Intergenic
1122387547 14:101359330-101359352 AGGGATCAGGAGGAGCAGCAGGG + Intergenic
1122540565 14:102495725-102495747 GTGGATCAGGACATGGAGGATGG - Intronic
1122710577 14:103654090-103654112 ATGGAACAGGAAGAGCAGCAGGG - Intronic
1124446086 15:29734273-29734295 TTGGCTCAGAAGAAGAAGGATGG - Exonic
1124601950 15:31140589-31140611 ATGGAAGAGAAGAAGCAAGAAGG - Intronic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1125353764 15:38794763-38794785 ATTGATCTGGATAAGCAAGAAGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1126726258 15:51635525-51635547 ATAGTTCAGAAGAAACAGGAGGG - Intergenic
1126852281 15:52804696-52804718 ATGGAGCCGAAGAAGCTGGAGGG - Intergenic
1126875905 15:53041006-53041028 ATTGGTCAGGAGGAGCAAGAAGG + Intergenic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129849019 15:78781243-78781265 ATGGGACAGGAGAGACAGGATGG - Intronic
1129929622 15:79399506-79399528 TTGGGTCTGGAGAAGTAGGATGG + Intronic
1130090272 15:80815019-80815041 AGGGATCAGGAAAAGCAGTAGGG - Intronic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1134093494 16:11403956-11403978 AGGGATGAGGCGAGGCAGGAGGG - Intronic
1134366243 16:13581889-13581911 ATGGATCAGGAGCTGGAAGATGG - Intergenic
1134690959 16:16190870-16190892 ATGGAGCTGGAGAAGAGGGAGGG + Intronic
1134880785 16:17743798-17743820 AAGGATGAGGAGAAGCAGACAGG + Intergenic
1135040655 16:19114622-19114644 ATAGCTGAGGAGGAGCAGGACGG - Exonic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1137486417 16:48895177-48895199 ATGAATCTGGAGAGGCAGGCAGG + Intergenic
1137767725 16:50991059-50991081 AAGGAACAGGAGAAGAAGGAAGG + Intergenic
1137782283 16:51107786-51107808 AAGGATCAAGAGAGGCAGGTTGG + Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138245168 16:55462133-55462155 TTGGAACAGGAGACGCAGAAAGG + Intronic
1138596447 16:58031658-58031680 GTCCAGCAGGAGAAGCAGGAAGG - Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1140326231 16:74005775-74005797 ATGGATTAGGAGCAGCAGCCAGG + Intergenic
1140972284 16:80024935-80024957 ATGGAACAGGAGTATCAGTAAGG + Intergenic
1141412312 16:83843919-83843941 ATGCACCAGTAGCAGCAGGAAGG + Intergenic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142745012 17:1951993-1952015 ATGGCTCAGGGACAGCAGGACGG + Intronic
1143043856 17:4060631-4060653 TGGCATCAGGAGAAGCAGGAAGG - Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144418028 17:15070061-15070083 ATGGTGCAAGACAAGCAGGATGG + Intergenic
1146006679 17:29164913-29164935 ATGGACCTGGAAAAGCAAGAGGG - Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1148403964 17:47395031-47395053 ATGGATTAGGAGAAAGCGGAGGG - Intronic
1151376144 17:73690363-73690385 ATGCATTCTGAGAAGCAGGATGG + Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153971995 18:10235504-10235526 ATGGAAGTGGAGAGGCAGGAGGG - Intergenic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155356488 18:24958617-24958639 AGGGATCAGGAGAGGAAGGCAGG + Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156635188 18:39019554-39019576 AAGGATCAAGAAAGGCAGGAAGG - Intergenic
1157604455 18:48917152-48917174 ATTGATCGGGTGAAACAGGATGG + Intergenic
1157718720 18:49907132-49907154 GAGGATCAGGAGAGCCAGGATGG + Intronic
1158220633 18:55146798-55146820 GGGGTACAGGAGAAGCAGGAGGG + Intergenic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158615131 18:58980116-58980138 ATGGATCAGGAGACTTATGAAGG + Intronic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1159744220 18:72211211-72211233 AGGCAAGAGGAGAAGCAGGAAGG + Intergenic
1159889113 18:73938094-73938116 AGGGAACAGGAGAAGGATGAAGG + Intergenic
1160361873 18:78290202-78290224 ATGGAACACCAGCAGCAGGAGGG + Intergenic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1161552901 19:4923930-4923952 CTGGGTCAGGAAAAGCAGCATGG - Intronic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1163623547 19:18374725-18374747 ATGGCTGGGGAGAAGCAGGCAGG + Intronic
1163646083 19:18489873-18489895 AGGGGTCAGCAGAAACAGGAGGG - Intronic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167299546 19:48670948-48670970 CTGGCCCAGGAGGAGCAGGAGGG + Exonic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167713638 19:51126973-51126995 ATAGATCTGGAGAAAAAGGAAGG - Intronic
1167762107 19:51456262-51456284 ATGGATCCAGAGAAAGAGGAAGG + Intronic
1167777916 19:51573369-51573391 CTGGGTCCAGAGAAGCAGGATGG + Exonic
1168368786 19:55813695-55813717 GATGATCAAGAGAAGCAGGAAGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
924982301 2:235341-235363 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982328 2:235420-235442 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982362 2:235521-235543 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982442 2:235770-235792 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982482 2:235893-235915 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982508 2:235978-236000 ATGGGTCAGGGGAGGCAGCATGG + Intronic
925063889 2:914498-914520 TGTGATCAGGAGAAGAAGGAAGG - Intergenic
925247994 2:2401884-2401906 ATAGAACAGGAGAATCAGAAAGG - Intergenic
925285284 2:2711794-2711816 GTGGCCCAGGAGATGCAGGAAGG + Intergenic
926056590 2:9777385-9777407 AGGGATCAGGAGAGTCAGCAGGG + Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928157849 2:28893275-28893297 ATAAATCTGGAGAAACAGGAGGG + Intergenic
930635046 2:53795198-53795220 ATGAAACAGGAGAGGCAGCATGG + Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932282450 2:70505748-70505770 ATGGATTAGATGAAGCAGAATGG - Intronic
932877040 2:75463619-75463641 ATGCATAAGGAGATGCAGGTTGG - Intergenic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
934140833 2:89045905-89045927 AGGCATCAGGAGAAGCAGCTGGG + Intergenic
934222791 2:90100801-90100823 AGGCATCAGGAGAAGCAGCTGGG - Intergenic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938156954 2:128949850-128949872 AAAGATCAGGAAAGGCAGGAGGG - Intergenic
938514898 2:131993450-131993472 ATGGATAAAGGGAGGCAGGAGGG + Intergenic
940032096 2:149274391-149274413 AGGGATGAGGAGGAGAAGGAAGG - Intergenic
940285953 2:152033181-152033203 ATGAATGAGGAGAAGCGGGGTGG + Intronic
940568417 2:155399242-155399264 AATGATCAGGAGTAGAAGGAGGG - Intergenic
940712967 2:157184540-157184562 ATGGATAAGGAGAAACAGCAAGG - Intergenic
941010843 2:160297817-160297839 TTGGAGGAGGATAAGCAGGAAGG + Intronic
941509553 2:166388775-166388797 ATTGTGCAGGAGAAGCAGAACGG - Intergenic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944277523 2:197855771-197855793 AGGATTCAGGTGAAGCAGGATGG - Intronic
944739111 2:202594399-202594421 AGGGATCGGGAGAAGGAGAAGGG - Intergenic
945029495 2:205650235-205650257 ATGGATAATGAGAAGCACCAAGG + Intergenic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
945650621 2:212554398-212554420 ATGAATCTGGAGAGGTAGGATGG + Intergenic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
947014524 2:225603631-225603653 ATGGGCCAGGAGAACCAGAATGG - Intronic
947239768 2:227981757-227981779 ATGCATGAGGAGCAGAAGGATGG - Exonic
948087873 2:235266283-235266305 AGGAGTCAGGAGAAGCAGGTGGG + Intergenic
948230003 2:236342529-236342551 ATGGCTCTGGAGACGCAGGAAGG + Intronic
948428310 2:237902285-237902307 AGGGATCGGGAGGAGGAGGAGGG + Intronic
948428345 2:237902380-237902402 AGGGATCAGGAGGAAGAGGAGGG + Intronic
948648295 2:239422835-239422857 GTGAAGCAGGAGGAGCAGGAAGG + Intergenic
948707182 2:239802209-239802231 TTGGCTGAGGAGTAGCAGGAAGG + Exonic
948789322 2:240369302-240369324 GTGGGGCAGGTGAAGCAGGAAGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169224664 20:3848473-3848495 ACAGGTCAGGAGAATCAGGAAGG - Intronic
1169329917 20:4708279-4708301 ATGCATCAGCTGAAGCAGGCAGG - Intergenic
1169501254 20:6162939-6162961 ATAGATCAGGAGAATGAAGAAGG - Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169684984 20:8261113-8261135 AAAGATCAAGAGAAGCAGAAGGG - Intronic
1170129644 20:13005342-13005364 ATGGATAAGTAAAACCAGGAAGG + Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170392815 20:15893872-15893894 ATGGAGCAGGAGCAGCTGAAAGG + Intronic
1170396037 20:15926553-15926575 GTTGATCAGGATAAGAAGGATGG + Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171406758 20:24916974-24916996 CAGGCTCAGGAGAAGCTGGAAGG - Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172027111 20:31956077-31956099 GTTGATCAGGAGTAGCAGGAGGG - Intergenic
1173537535 20:43827593-43827615 ATGGATCAGGCATAGCAGGGAGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173861629 20:46287622-46287644 ATGAGACAGGAGAAGCAGGCAGG + Intronic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174100409 20:48122616-48122638 ATGGATCTGGAGACCCAGGGTGG + Intergenic
1174149221 20:48474383-48474405 ATGGATCATGAGACCCAGGAAGG - Intergenic
1174149387 20:48475476-48475498 ATGGAGCTGGAGACTCAGGAAGG - Intergenic
1174153603 20:48502876-48502898 ATGGAACTGGAGAACCAGAAAGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174454346 20:50638814-50638836 AAGGATGAGGACAGGCAGGAGGG + Intronic
1174482363 20:50840625-50840647 ATTGAACAGGAGAAGCAAGCAGG - Intronic
1174511920 20:51059946-51059968 ATGGAATGAGAGAAGCAGGATGG + Intergenic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1175687272 20:61040767-61040789 AAGGGTCAGGAGATGCAGGTCGG + Intergenic
1175766726 20:61597584-61597606 ATGGACCGGGCGAAGCAGGCAGG + Intronic
1177823911 21:26061782-26061804 ATGGATCAAGATAAGCAAAAAGG + Intronic
1177976530 21:27858616-27858638 ATGGATAAAGGGAGGCAGGAGGG - Intergenic
1178433629 21:32537737-32537759 TAGGATCAGGAGAAGAAGGGAGG + Intergenic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1178964745 21:37105647-37105669 ATGGATCATGACTAGGAGGAGGG - Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182890198 22:33811808-33811830 ATGGATTAGGAGACACAGGAAGG + Intronic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183925046 22:41199835-41199857 GTGGATCAAGAGAAGAAGCAAGG + Intergenic
1184430150 22:44437799-44437821 ATGAGTCAGGAGAATCTGGAAGG + Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185287495 22:50009092-50009114 AGGGGTCAGGAGGAGCAAGAGGG + Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
949748236 3:7320599-7320621 AGGAAACAGAAGAAGCAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950808855 3:15632379-15632401 AGGGAACAGCAGAACCAGGAAGG - Intronic
951001330 3:17563438-17563460 ATGAATCAGGAAAATCAGGAAGG + Intronic
952044129 3:29297487-29297509 ATGGATGTGGAGAAGCATAATGG - Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955579965 3:60408340-60408362 GTGGATTAGGAGTTGCAGGAGGG - Intronic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
956675863 3:71731271-71731293 ATGGATTTGGAAAGGCAGGAAGG - Intronic
957381948 3:79442817-79442839 ATACATCCTGAGAAGCAGGATGG - Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959543124 3:107563244-107563266 ATGGATCCTGAGAAGAAGGCAGG - Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
960810971 3:121627319-121627341 ATGGGACAGGAAATGCAGGATGG + Exonic
960820717 3:121728044-121728066 ATAGCTGAGGAGAAGCTGGAGGG + Intronic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
963130004 3:141849214-141849236 GCTGATAAGGAGAAGCAGGACGG + Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965356567 3:167681499-167681521 ATGGATCAGGGGAGAAAGGAGGG + Intergenic
966126655 3:176585226-176585248 TTGGATGAGGACAGGCAGGAAGG - Intergenic
966880518 3:184347407-184347429 AAGCATTAGGAGAAGCAGCATGG + Intronic
967275776 3:187773245-187773267 ATGGATCAGGAAAAGAAGATGGG + Intergenic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
969107882 4:4821609-4821631 AGGGCTCAGAAGAAGAAGGAAGG + Intergenic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969884084 4:10199947-10199969 CTGGATCCAGAAAAGCAGGAAGG - Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970537750 4:17046612-17046634 ATGAATCATGAGAAGAAGGGTGG + Intergenic
971425638 4:26512452-26512474 AGGGAACAGGAGGAGCAGGAGGG + Intergenic
971495015 4:27254971-27254993 AGGGATCAAGAGAAACAGGTAGG - Intergenic
971850770 4:31983911-31983933 ATGGTGCAGGAAAAGCAGAAAGG + Intergenic
972274676 4:37546038-37546060 ATAGATGATGAGAAGGAGGATGG + Intronic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974735543 4:65927088-65927110 TGGGATGAGGGGAAGCAGGAGGG - Intergenic
975838694 4:78451790-78451812 ATGGAACAGGAGAACCTGGAGGG + Intronic
976951585 4:90838913-90838935 ATTGAACAGGAGAAGCAAGCAGG - Intronic
977320706 4:95512070-95512092 ATGGGTCTGGAGAAGGAGGCAGG + Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982215658 4:153080723-153080745 TTGGATGAGGAGGTGCAGGAGGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
984220397 4:176967562-176967584 TAGGATCAGGGGAAGCATGAGGG + Intergenic
984944113 4:184957872-184957894 GAGGATCTGGAGAAGCAAGAAGG + Intergenic
985992732 5:3576697-3576719 TTGGGTCAGGATAAGCAGGAGGG + Intergenic
986228203 5:5836764-5836786 ATGACACAGGAGAATCAGGAGGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988920196 5:35934417-35934439 ATGGATCAGGAGAAGCACACAGG - Intronic
989761208 5:45018892-45018914 AGGGATTAAGTGAAGCAGGAAGG - Intergenic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992079120 5:73217349-73217371 ATGGCCCAGGAAAAGGAGGAGGG + Intergenic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
993693456 5:91031700-91031722 ATTGATCATAAGAAGAAGGAAGG - Intronic
994164290 5:96592675-96592697 TTGGAACAATAGAAGCAGGAAGG - Intronic
994719575 5:103365438-103365460 ATGAATCAGGAAAACCTGGAGGG - Intergenic
995030736 5:107478169-107478191 CTGGATCAGGAGGAGAAGCAGGG - Intronic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
996706567 5:126504180-126504202 GTGGACCAGGAGAGGCAGGTAGG - Intergenic
996904531 5:128583157-128583179 ATGGGTTTGGGGAAGCAGGAAGG - Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998988626 5:147790238-147790260 ATGGATGATGAGAAACAAGAAGG - Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1001115120 5:168933054-168933076 ATGGATCAAGAGAAGCTTGTGGG + Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001825203 5:174739289-174739311 CAGGATCAGGAACAGCAGGATGG + Intergenic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003812927 6:9804752-9804774 ATGTTTCAGGAGAAGAATGACGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1005092946 6:22078398-22078420 TTGTATTAGGAGAAGCATGATGG - Intergenic
1005857727 6:29875620-29875642 ATGTATCAGAAGACTCAGGATGG + Intergenic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1006321374 6:33321572-33321594 AAGGTTCAGGGGAAGAAGGAAGG + Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007009139 6:38397983-38398005 ATGGAGCAGGAGAAACTGCATGG + Intronic
1007700276 6:43762338-43762360 ATGGGTCTGGATAAGCAGGCTGG + Intergenic
1007761480 6:44135941-44135963 ATGGACCAGGAGAACCTGGAAGG - Intronic
1008014003 6:46497457-46497479 ATGGAAAAGGAGAAGAAGTATGG - Intergenic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1011342633 6:86334240-86334262 ATGGCTCAGGAGAAACAAGAGGG + Intergenic
1011441689 6:87393802-87393824 ATCGATAAGGAGTAACAGGATGG - Intronic
1012154309 6:95797547-95797569 ATTGATCATGACAAGCAGTAGGG + Intergenic
1012800320 6:103819399-103819421 AAAGATCTGGAGAAGCAAGATGG + Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1015121368 6:129704897-129704919 AGGGGTCAGGATAAGGAGGAGGG - Intronic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015824834 6:137300625-137300647 AGAGAACAGCAGAAGCAGGAAGG - Intergenic
1016508456 6:144812404-144812426 ATGTATCACAAGAAGCAGCAAGG - Intronic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017858417 6:158372309-158372331 GAGGATCTGGAGAAGAAGGAAGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019666092 7:2252926-2252948 AGGGATGAGGGGGAGCAGGAGGG - Exonic
1019912946 7:4112448-4112470 TTGGTTCAGGAGAAGAATGAGGG - Intronic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1023814835 7:43941653-43941675 ATGAATCAGGAGAAGAACCAAGG + Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1025233635 7:57219245-57219267 ATGGAGCTGGAGACCCAGGAAGG - Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1027591042 7:80119669-80119691 TTGAATCAGAAGTAGCAGGAGGG - Intergenic
1028820151 7:95200076-95200098 ATGGAACATTAGAAGCTGGAAGG - Intronic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029441383 7:100588654-100588676 ATTTATCAGGAGAAACAGCAGGG - Intronic
1030128315 7:106176302-106176324 ATGGAGCTGGAGAAGCAAGGAGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030697793 7:112604364-112604386 ATGGACCAGGATAAGAAGCAGGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1033265649 7:139884456-139884478 AGGGAGCTGGAGCAGCAGGAAGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1034132738 7:148735458-148735480 AGTGAGCAGGCGAAGCAGGAAGG - Intronic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1035214931 7:157358461-157358483 ATGGGTCTGGAGAGGGAGGAAGG - Intronic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037352880 8:17981149-17981171 ATGAGTCTGGAGAGGCAGGAAGG - Intronic
1037513728 8:19609677-19609699 AAGGACCCAGAGAAGCAGGAGGG + Intronic
1037817684 8:22120609-22120631 GTGGCTCAGGGGGAGCAGGAGGG - Intronic
1038397527 8:27258105-27258127 AGAGCTCAGGAGAGGCAGGATGG - Intronic
1039054344 8:33523268-33523290 ATCGAACAGGAGAAGCAAGCAGG + Intergenic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1041482003 8:58332168-58332190 AGGGATCTGGAGAAGCAGTCTGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043267043 8:78279425-78279447 ATGGATCAGCTGTAGCAGTAAGG + Intergenic
1044949654 8:97423296-97423318 ATGGATCAGGGCAGGGAGGAGGG - Intergenic
1045418912 8:101994593-101994615 AGGGCTGAGGAGAAGCAGCAGGG + Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046065098 8:109186883-109186905 ATGGCTCAGGAGAGGCAGAATGG - Intergenic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1047336245 8:123939483-123939505 AAGGAGCAGGACAAGCAAGAAGG + Intronic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1047991390 8:130290316-130290338 ATGGTTCAGGTGAAACAGCAAGG + Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1050432961 9:5580667-5580689 AAGGTGCAGGAGAAGCAGGCAGG + Intergenic
1051012694 9:12438073-12438095 ATGGATCAGAAGAACCAAAATGG - Intergenic
1051111644 9:13645150-13645172 ATGCAACAGGAGAAGCAGAAAGG - Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052857114 9:33414372-33414394 ACGCATCATGAGAAGGAGGAAGG + Intergenic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1054792043 9:69265536-69265558 AGGGAAAAGGACAAGCAGGAGGG + Intergenic
1055955844 9:81772942-81772964 ATGGCTTAGGAAAAGCAAGAAGG + Intergenic
1056383726 9:86078517-86078539 AAGGATCAGGGGTAGAAGGATGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1060044256 9:120327437-120327459 ATGGATCAGGAGCACCAGGGAGG + Intergenic
1060830262 9:126709340-126709362 GCAGGTCAGGAGAAGCAGGAAGG + Intergenic
1061133923 9:128722811-128722833 ATGGATCAGGGGAAGCCTGGGGG + Intronic
1061242443 9:129382496-129382518 AGGCACCAGGAGAAGCAGGGAGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062097767 9:134711776-134711798 TTGGATCAGGAGATGCAAGAAGG - Intronic
1062138179 9:134940684-134940706 ACGGCTCAGGAGGAGCAGGAGGG - Intergenic
1062195472 9:135271144-135271166 AAGGTTTAGGAGAATCAGGAGGG + Intergenic
1062486274 9:136777941-136777963 ATGGAACTGGAGAATCAGGGAGG - Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062698528 9:137887540-137887562 ATAGACCAGCAGATGCAGGAAGG + Intronic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1186389305 X:9142832-9142854 TTAACTCAGGAGAAGCAGGATGG + Intronic
1186788805 X:12976779-12976801 ATTGAACAGGAGAAGCAAGCAGG + Exonic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1188357596 X:29211830-29211852 AGAGATCAGGAAAACCAGGATGG - Intronic
1188439893 X:30205883-30205905 TTGGATGAAGAAAAGCAGGAAGG + Intergenic
1189081614 X:37978873-37978895 GAGGTTCAGGAGAAGAAGGAAGG + Intronic
1189533242 X:41908694-41908716 ATGGATCTGTAGAAATAGGAGGG + Intronic
1191184765 X:57597828-57597850 ATGCCTGAGGAGAAGCAGAAAGG - Intergenic
1192743503 X:73915727-73915749 ATGATTCAGGTGAAGCAGGGAGG + Intergenic
1193014023 X:76712122-76712144 ATGGATCTGGGGGTGCAGGAGGG + Intergenic
1194280707 X:91949926-91949948 AGTGATCAGGAGAAGTGGGATGG + Intronic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1195797615 X:108668428-108668450 CTGGACCCGGAGAACCAGGAGGG - Exonic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1198084733 X:133271245-133271267 TTTGATAATGAGAAGCAGGAAGG + Intergenic
1198233146 X:134712711-134712733 ATGAACCGGGAGAGGCAGGATGG - Intronic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198728378 X:139700995-139701017 GTGGATCTGGGGAGGCAGGAGGG - Intronic
1200051421 X:153433817-153433839 ATGGATGAGGACATGCAGCAGGG + Intergenic
1200139007 X:153888332-153888354 AAGTCCCAGGAGAAGCAGGAGGG + Intronic
1200598192 Y:5173482-5173504 AGTGATCAGGAGAAGTGGGATGG + Intronic