ID: 1136031293

View in Genome Browser
Species Human (GRCh38)
Location 16:27504998-27505020
Sequence CCTAGCACGGAGTAGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136031293_1136031299 15 Left 1136031293 16:27504998-27505020 CCATGCATCTACTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136031299 16:27505036-27505058 TCAGTGTTTCCAAAATACAGGGG 0: 1
1: 0
2: 2
3: 59
4: 353
1136031293_1136031298 14 Left 1136031293 16:27504998-27505020 CCATGCATCTACTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136031298 16:27505035-27505057 CTCAGTGTTTCCAAAATACAGGG 0: 1
1: 0
2: 1
3: 25
4: 244
1136031293_1136031297 13 Left 1136031293 16:27504998-27505020 CCATGCATCTACTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136031297 16:27505034-27505056 ACTCAGTGTTTCCAAAATACAGG 0: 1
1: 0
2: 0
3: 29
4: 229
1136031293_1136031300 16 Left 1136031293 16:27504998-27505020 CCATGCATCTACTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136031300 16:27505037-27505059 CAGTGTTTCCAAAATACAGGGGG 0: 1
1: 1
2: 2
3: 26
4: 236
1136031293_1136031301 19 Left 1136031293 16:27504998-27505020 CCATGCATCTACTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136031301 16:27505040-27505062 TGTTTCCAAAATACAGGGGGTGG 0: 1
1: 0
2: 5
3: 50
4: 375
1136031293_1136031303 25 Left 1136031293 16:27504998-27505020 CCATGCATCTACTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136031303 16:27505046-27505068 CAAAATACAGGGGGTGGCACTGG 0: 1
1: 0
2: 2
3: 17
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136031293 Original CRISPR CCTAGCACGGAGTAGATGCA TGG (reversed) Intronic
900257753 1:1705813-1705835 CCCAGCACGGGGCAGGTGCAGGG + Intronic
900571258 1:3359559-3359581 CCGAGCCTGGAGTAGCTGCAGGG - Intronic
902139098 1:14337138-14337160 CTTAGCACAGAGTAAATGCCTGG + Intergenic
903325188 1:22565285-22565307 CCCAGCATGGAGGAGAGGCACGG + Intronic
913481994 1:119297422-119297444 CCTAGCACATAGTAAATTCAAGG - Intergenic
917655010 1:177117438-177117460 CCTGGCACGCAGTAGATTCTCGG - Intronic
917916105 1:179703656-179703678 CCTGGCACGTGGTAGATGCTCGG + Intergenic
920279731 1:204833829-204833851 GCTAGCAAGTAGTAGAAGCAGGG - Intronic
1073286538 10:102393124-102393146 CCAAGCACGGAGTACATGACTGG - Intergenic
1073522790 10:104150286-104150308 CCTGGCAGGGAGTGGATGTATGG - Intronic
1075497602 10:122939150-122939172 ACTAGCACAGAGTAGATTCCTGG - Intronic
1076708125 10:132313409-132313431 CCTAGCATGGAGCAGGTGCTTGG - Intronic
1080274344 11:30487031-30487053 CCTGGCACATAGTAGATGCTTGG - Intronic
1086103421 11:83125436-83125458 TCTAACACAGAGTAGATGTAGGG + Intergenic
1087868123 11:103258634-103258656 CACAGCACTGAGTAGATGGATGG + Intronic
1089927866 11:122277963-122277985 CCTAGCACTGAGTTGCTGCTGGG + Intergenic
1092405816 12:8221651-8221673 CCAGGCAGGGAGCAGATGCAGGG - Exonic
1093749161 12:22779027-22779049 CCTTACAAGGAGTAGGTGCAAGG - Intergenic
1095249084 12:39957831-39957853 CCTAGCATGGAGTAGGCTCATGG - Intronic
1096516318 12:52157501-52157523 CCTGGCACTTAGTAGATGCTTGG - Intergenic
1100568698 12:95825197-95825219 CCTAGCACAGAGTAGGTCCTGGG - Intergenic
1112400118 13:99069416-99069438 ACAAGCACGGAGGAGATCCATGG + Intronic
1114726740 14:24945740-24945762 CCTAGCACATAGTTGATGCTTGG - Intronic
1118751576 14:68811502-68811524 CCTAGCACCCAGTATGTGCAAGG + Intergenic
1125802445 15:42462194-42462216 CATAGCACAGTGTAGTTGCATGG + Intronic
1126456225 15:48865057-48865079 CCTAAAACGCAGTAGATGCTTGG - Intronic
1129685630 15:77684780-77684802 CCTGGCACACAGTAGGTGCATGG - Intronic
1134669073 16:16041301-16041323 CCTAGCCCTGAGTACATGCTGGG + Intronic
1135085891 16:19474200-19474222 CTGAACATGGAGTAGATGCATGG - Exonic
1135415820 16:22267247-22267269 CCTGGCACTGAGTAGATGCTTGG + Intronic
1136031293 16:27504998-27505020 CCTAGCACGGAGTAGATGCATGG - Intronic
1139851504 16:69953380-69953402 ACAAGCACTGAGTGGATGCAGGG - Intronic
1139880480 16:70176292-70176314 ACAAGCACTGAGTGGATGCAGGG - Intronic
1140372030 16:74419225-74419247 ACAAGCACAGAGTGGATGCAGGG + Intronic
1146548995 17:33763937-33763959 CCCAGGATGGAGTTGATGCAGGG - Intronic
1149252147 17:54782899-54782921 GCTAGCAGGGAGCAGATGCCAGG - Intergenic
1157411779 18:47469207-47469229 CATAGCACTTAGTAGATGCCCGG + Intergenic
1158131666 18:54158989-54159011 CCTAGCACAGATTTGATGCAGGG - Intronic
1164421345 19:28095942-28095964 CCTAGAATGGAGCAGATGCAAGG + Intergenic
925666425 2:6261769-6261791 GCTAGCATGGAGTATATGGAAGG - Intergenic
929055963 2:37876006-37876028 CCTAGCACAGAGTAGGTGCTTGG - Intergenic
930250584 2:49030045-49030067 CCTATCAGGGAGTAGCAGCAGGG + Intronic
932343296 2:70979817-70979839 TCCAGCAGGTAGTAGATGCAGGG - Exonic
941629922 2:167872582-167872604 CTGAGCATGGGGTAGATGCAAGG - Exonic
942966730 2:181903208-181903230 CCCAGCACAGGGTAGATGCTTGG - Intronic
1170534382 20:17325529-17325551 CCTACCATTGAGTAGATGGAAGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172609285 20:36237521-36237543 CCTAGCACAGAGGAGATGCTAGG - Intronic
1175845378 20:62055647-62055669 CCAAGGAAAGAGTAGATGCAGGG - Intronic
1184104144 22:42357755-42357777 CCTGGCACAGAGTAGGTGCCTGG + Intergenic
1184368265 22:44066575-44066597 CCTGGCACACAGTAGGTGCACGG + Intronic
949781177 3:7690337-7690359 CCTAGAACTCGGTAGATGCACGG + Intronic
954416738 3:50396987-50397009 CCCAGCCAGGAGTAGAGGCAGGG - Intronic
955586811 3:60487615-60487637 CCAAGCACGGAGTAATTGAAAGG - Intronic
961486499 3:127221065-127221087 CTTAACACAGAGCAGATGCAGGG - Intergenic
961585106 3:127915633-127915655 CCTGGCCCGGAGTTGAGGCAGGG - Intronic
969336776 4:6515356-6515378 CCTGGCACAGAGTAGGTGCTTGG - Intronic
969760310 4:9176316-9176338 CCAGGCAGGGAGCAGATGCAGGG + Exonic
972353827 4:38261803-38261825 CCTAGCACATAGTAGAAGCTCGG + Intergenic
976108702 4:81647036-81647058 CCTAGCCTGCAGTAGATGCTTGG - Intronic
976275315 4:83270831-83270853 CCTAGCACGAAGTAAATGTAGGG + Intronic
977352511 4:95906416-95906438 CATGGCCCGTAGTAGATGCAAGG + Intergenic
985588819 5:754500-754522 CTGAGCACGGTGGAGATGCAAGG - Intronic
985603501 5:847017-847039 CTGAGCACGGTGGAGATGCAAGG - Intronic
989476904 5:41884368-41884390 CCTAGCAGGGAGTTGAGCCAAGG + Intergenic
990208044 5:53451236-53451258 CCTAGCACATAGTAGGAGCATGG + Intergenic
990479333 5:56193267-56193289 CTTAGCACTGGGGAGATGCATGG + Intronic
995218006 5:109617166-109617188 CCTGGCACTGAGTGAATGCAGGG - Intergenic
998799362 5:145853546-145853568 CCAAGCACAGTGTAGATGCTGGG + Intergenic
1001550721 5:172600663-172600685 CCAAGCAAGGACCAGATGCAGGG - Intergenic
1007600368 6:43077198-43077220 CCTGGCACGGAGTGGGCGCAGGG - Intronic
1008039045 6:46776573-46776595 CCTAGCACGTGGTAGCTGCTTGG - Intergenic
1013085518 6:106853677-106853699 CCTAGCACTGAGCACAGGCAGGG + Intergenic
1020352673 7:7238754-7238776 CTTAGCACTGGGGAGATGCATGG + Exonic
1021922485 7:25499943-25499965 CCTAGCACTGAAGTGATGCAGGG + Intergenic
1026286153 7:68964717-68964739 CCTAGAACCTAGTAGATGCTTGG + Intergenic
1032090130 7:128907381-128907403 CCCAGCACTGGGGAGATGCAGGG + Exonic
1036263934 8:7260063-7260085 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036265230 8:7267685-7267707 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036266531 8:7275307-7275329 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036267837 8:7282929-7282951 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036269141 8:7290551-7290573 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036297451 8:7548882-7548904 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036298755 8:7556529-7556551 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036300060 8:7564179-7564201 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036301364 8:7571824-7571846 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036302661 8:7579473-7579495 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036315974 8:7718602-7718624 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036317281 8:7726250-7726272 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036318589 8:7733898-7733920 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036319898 8:7741545-7741567 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036321205 8:7749193-7749215 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036322514 8:7756841-7756863 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036323822 8:7764489-7764511 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036325124 8:7772137-7772159 CCAGGCAGGGAGCAGATGCAGGG + Intergenic
1036352218 8:8019817-8019839 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036353517 8:8027465-8027487 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036846205 8:12172590-12172612 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1036867571 8:12414909-12414931 CCAGGCAGGGAGCAGATGCAGGG - Intergenic
1038159697 8:25024801-25024823 ACCAGCACTGAGTAGAAGCAAGG + Intergenic
1039099908 8:33929790-33929812 CCTAGCATATAGTAGATGCCTGG - Intergenic
1041005850 8:53496438-53496460 ACTAGCCTGGAGCAGATGCATGG + Intergenic
1045632401 8:104140727-104140749 CCTAACACCAAGTAGATGCAAGG + Intronic
1049708607 8:144053863-144053885 CCTGGCACTGAGCAGCTGCAGGG - Intronic
1060016116 9:120087913-120087935 CCTGGCACAGAGTAGGTGCTTGG - Intergenic
1061490657 9:130942138-130942160 CTTAGCAGGGAGTGGGTGCAGGG + Intergenic
1061729844 9:132605246-132605268 CCTGGCACGCAGTAGGTGCTCGG - Intronic
1061945221 9:133904947-133904969 CCTGGCAGGGAGGGGATGCAGGG + Intronic
1186661661 X:11674015-11674037 CTTAGCACAGAATAGATGCTTGG - Intergenic
1187018701 X:15357388-15357410 CCTGGCAGGGAGTAGGGGCAGGG - Intronic
1188688037 X:33094427-33094449 AATAGCAAGGAGTAGATACAGGG + Intronic
1199664118 X:150082989-150083011 CCTAGCATGGAGTAGCTAGATGG + Intergenic