ID: 1136031336

View in Genome Browser
Species Human (GRCh38)
Location 16:27505461-27505483
Sequence TCAGTGCCACACTTAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136031336_1136031342 13 Left 1136031336 16:27505461-27505483 CCCCTCCCTAAGTGTGGCACTGA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1136031342 16:27505497-27505519 ATATTGCGAAATGTCTCCTATGG 0: 1
1: 1
2: 27
3: 134
4: 651
1136031336_1136031343 14 Left 1136031336 16:27505461-27505483 CCCCTCCCTAAGTGTGGCACTGA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1136031343 16:27505498-27505520 TATTGCGAAATGTCTCCTATGGG 0: 1
1: 0
2: 0
3: 44
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136031336 Original CRISPR TCAGTGCCACACTTAGGGAG GGG (reversed) Intronic
900429579 1:2595429-2595451 TGAGTGCCACACTGTGGGAGGGG + Intronic
904202753 1:28832005-28832027 CCAGGGCCACAGTTAGGAAGTGG + Intronic
904938468 1:34148594-34148616 TCTGTGCCCCACTGAAGGAGGGG - Intronic
908460356 1:64342855-64342877 TCTGTGCCAGACTTGTGGAGAGG - Intergenic
914432085 1:147627993-147628015 TCAGTCCCAAACTTCAGGAGAGG - Intergenic
915245180 1:154551427-154551449 TCAGTGCCACACTGGTGAAGGGG - Exonic
919869354 1:201808816-201808838 TGAGTGCCAGGCCTAGGGAGCGG - Exonic
920773461 1:208912489-208912511 TAAGTGAGACTCTTAGGGAGTGG - Intergenic
921674741 1:217965253-217965275 TCAGTGCCAAAAGTACGGAGGGG + Intergenic
923624870 1:235605836-235605858 TGAGTGCCACACTAAGAGTGTGG + Intronic
1065400684 10:25296803-25296825 ACAGTTACACATTTAGGGAGTGG + Intronic
1066164532 10:32772312-32772334 TCAGTGGAACACTGTGGGAGTGG - Intronic
1068698002 10:59989763-59989785 TAAGTGACACACTTAAGGAAAGG - Intergenic
1068722438 10:60261027-60261049 TCAGTGACGCAGTGAGGGAGAGG + Intronic
1071230467 10:83580008-83580030 TCTGTGCCACAGTTGGGAAGGGG + Intergenic
1072606902 10:96991872-96991894 TCAGGGCCACACTGGGGAAGTGG - Intergenic
1073131722 10:101193331-101193353 TCAGCCTCACATTTAGGGAGGGG + Intergenic
1073218926 10:101853464-101853486 TGAGGGCCACACTTAGGGAGAGG + Intronic
1075687827 10:124376481-124376503 GCAGTGTCAGACCTAGGGAGCGG - Intergenic
1075697788 10:124448911-124448933 TCACCGCCAAACTTGGGGAGGGG + Intronic
1077923955 11:6662200-6662222 TAAGTCCCATACTCAGGGAGGGG + Intergenic
1079996908 11:27304863-27304885 TCAGTGCCACCCTGAGCGTGTGG - Intergenic
1081800853 11:45858387-45858409 TCAGTGCCACTCTCTGGGACTGG + Intronic
1087893102 11:103557330-103557352 TCAGTACTATATTTAGGGAGTGG + Intergenic
1088949073 11:114547075-114547097 TCAATTCCACACTTAAGGATTGG - Intronic
1089051628 11:115550699-115550721 TCAGTGCGAGACGTAGAGAGAGG + Intergenic
1090778207 11:129983754-129983776 CTAGTGCCATACTTAGGAAGTGG - Intronic
1091328638 11:134712924-134712946 GCAGTGCCAGACTCAGGGAATGG - Intergenic
1093125205 12:15321062-15321084 TCAGTCACACAGCTAGGGAGTGG - Intronic
1093576143 12:20732275-20732297 TCATAGCCACACTTAGTAAGTGG - Intronic
1097402099 12:59140792-59140814 TCACTACCACATTGAGGGAGGGG + Intergenic
1099038463 12:77620156-77620178 TCAGTGGCAAAGTTAGGGACAGG - Intergenic
1101359557 12:104013687-104013709 TCAGTCAGACACTTAGGGACTGG - Intronic
1102450264 12:113036871-113036893 GCACTGCCACACTTAGCGTGTGG - Intergenic
1105383447 13:19908823-19908845 TCAGTGCCACAGTTACTCAGAGG - Intergenic
1113193341 13:107776355-107776377 TCACTGCCACACTTTGAGATAGG - Intronic
1113314600 13:109165462-109165484 TGAGTGCCACATTTAGAAAGTGG + Intronic
1114265872 14:21072174-21072196 TCATTGACTCACTTAGGGAGGGG + Intronic
1119323459 14:73745062-73745084 TCAGAGCCACACCTGGGCAGAGG + Intronic
1119901522 14:78264472-78264494 TCAGTGGCAGAGTTGGGGAGGGG + Intronic
1121351849 14:93179766-93179788 TCAGTGCCTCACATATGGAGAGG + Intergenic
1122251333 14:100441961-100441983 TCAGGGTCACACATAGAGAGAGG + Intronic
1123438528 15:20273087-20273109 TCAGTGCCACACTGGGGCTGGGG - Intergenic
1127388381 15:58485773-58485795 TCCCAGCCACACTGAGGGAGAGG + Intronic
1129354238 15:74978672-74978694 TCAGTGCCACGGTGGGGGAGGGG - Intronic
1131546323 15:93319038-93319060 TGTGTGACAAACTTAGGGAGGGG + Intergenic
1131668210 15:94592470-94592492 GCAGATCCACACTTAGGGGGAGG - Intergenic
1132867019 16:2098145-2098167 TCAGTGGCACACGTCGCGAGGGG - Intronic
1134548151 16:15125968-15125990 TCAGTGGCACACGTCGCGAGGGG - Intronic
1136031336 16:27505461-27505483 TCAGTGCCACACTTAGGGAGGGG - Intronic
1148019609 17:44544815-44544837 TGAAACCCACACTTAGGGAGGGG - Intergenic
1148557580 17:48587667-48587689 TCCCTGCCACAGTTATGGAGAGG + Intronic
1151205376 17:72502559-72502581 TCAGAGCCACCCTTGGAGAGAGG - Intergenic
1152310378 17:79546386-79546408 TCAGAGCCACACTTCAGCAGTGG - Intergenic
1152539531 17:80967928-80967950 TCAGTGCAGCACTGAGTGAGAGG - Intergenic
1153095028 18:1391057-1391079 TAAGTGACAAATTTAGGGAGAGG + Intergenic
1154300246 18:13185842-13185864 TCAGTGCCAGAGGAAGGGAGGGG - Intergenic
1156741623 18:40337422-40337444 TAATTGCCATACTTGGGGAGGGG - Intergenic
1159101760 18:63966112-63966134 CCAGTGTTCCACTTAGGGAGAGG - Intronic
1160565938 18:79786607-79786629 GCAGTGCCAGACACAGGGAGAGG + Intergenic
1161373069 19:3924401-3924423 TCAGAGCCACACTTAGAAAGTGG + Intronic
924975732 2:172839-172861 ACAATGCCACACTTAGGATGTGG - Intergenic
926238898 2:11069849-11069871 CCAATGACACACTTAGGGACTGG - Intergenic
927250166 2:20989667-20989689 TCAGTGCCGCACACAGGAAGGGG - Intergenic
929026132 2:37604459-37604481 TCTGTGCCACACTGGGGGAGGGG - Intergenic
935370848 2:102345234-102345256 TCAGAGACACACCAAGGGAGTGG - Intronic
937333219 2:121044936-121044958 TCAGTGGCACACTCAGGGCTGGG - Intergenic
938086794 2:128407177-128407199 TCAGTGCCACCCTACGGGACAGG - Intergenic
938575393 2:132598591-132598613 CCAGTGCCACATCTAGGAAGTGG - Intronic
938663378 2:133509694-133509716 TCATTGTCACAATGAGGGAGGGG + Intronic
938967508 2:136401586-136401608 TCAGAAGCACACTTAGGAAGGGG + Intergenic
941771710 2:169352263-169352285 ACAGTGGCATATTTAGGGAGAGG + Intronic
943756225 2:191559988-191560010 TTAGAGCCACAGCTAGGGAGGGG - Intergenic
946127536 2:217576960-217576982 GCACAGCCACACTTAAGGAGTGG - Intronic
947103051 2:226642109-226642131 ACAGTGCCACATTTAGACAGAGG + Intergenic
947582768 2:231331899-231331921 TAAGTGCCACACAAAGGGTGGGG + Intronic
947838762 2:233193993-233194015 TCAGCCCCCCACTTAGGGACGGG + Intronic
948800119 2:240429683-240429705 TCAACGCCACCTTTAGGGAGGGG + Intergenic
1172039679 20:32035058-32035080 TCAGGGCCCCACCTTGGGAGAGG - Intergenic
1172939647 20:38645726-38645748 TCACTGGCACACTCAGGCAGGGG - Intronic
1173328435 20:42054426-42054448 TCATTGGCACAGTTAGGCAGTGG - Intergenic
1173448151 20:43138564-43138586 GCAGTGACTCACTTATGGAGGGG - Intronic
1174503563 20:51002763-51002785 TCAGTGCCAGGCGTGGGGAGGGG - Intergenic
1175179340 20:57134457-57134479 TCAGAGCCAGACTGAGGGTGTGG + Intergenic
1179307392 21:40167378-40167400 TCTGTGCCAAACATAGGGATGGG - Intronic
1179779667 21:43691301-43691323 TGAGTGGCACATATAGGGAGAGG - Intronic
1182368131 22:29792340-29792362 TCAGGGCCAGACATAGGGAGGGG + Intronic
1183962178 22:41418165-41418187 TCAGCGCCACAGTTGGGGATGGG - Intergenic
1184652780 22:45926695-45926717 TCAGGGCCACACTTACTTAGGGG - Intronic
1184903021 22:47459155-47459177 TCAGTGCCAAAATCATGGAGAGG + Intergenic
1185129712 22:49032116-49032138 TCCATGCCACACATAGGCAGTGG + Intergenic
949941780 3:9160261-9160283 TATGTCCCACACTTAGGGGGAGG - Intronic
953057306 3:39398387-39398409 TCAGTGCCATGCCTAGGTAGTGG - Intergenic
953674401 3:44989357-44989379 TCCGAGCCAAACTCAGGGAGGGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
959525851 3:107375689-107375711 TCATTGTCACACTTACAGAGTGG - Intergenic
962802936 3:138905693-138905715 TAACTCCCACACTTAAGGAGTGG - Intergenic
963317181 3:143772093-143772115 TCTGTGCCACTCTCAGGCAGTGG - Intronic
963346223 3:144099146-144099168 TCAGTGCCAAAGTTTTGGAGGGG - Intergenic
965493093 3:169363922-169363944 TCAGTGACAAACTTATGAAGTGG + Intronic
966531603 3:180987961-180987983 CTAGAGCCACACTTAGGGAAGGG - Intronic
967951814 3:194847225-194847247 AGAGTGCCACACTGAGGGTGAGG + Intergenic
970163813 4:13215293-13215315 TCAGTGCCCCACTTAGGCATAGG - Intergenic
974343275 4:60641820-60641842 ACAGTTCCACACATATGGAGAGG + Intergenic
974490458 4:62557704-62557726 CCAGTGGAACACTGAGGGAGTGG - Intergenic
976047844 4:80973764-80973786 TCAGGGCCACATCTAGGGTGAGG - Intergenic
977022809 4:91777006-91777028 ACTGTGCCACACATAGGGATTGG + Intergenic
980519191 4:133909250-133909272 TCAATGACACACTTAGAGAAAGG - Intergenic
983090005 4:163492371-163492393 ACAGGGCCAGACTTAGGGAATGG + Intergenic
984310126 4:178047278-178047300 TCATTGTAACACTTACGGAGAGG - Intergenic
984349183 4:178569435-178569457 ACTGTGCCACACATAGGGAAGGG - Intergenic
984583819 4:181540421-181540443 TCACAGCCGCACTTAAGGAGTGG - Intergenic
986658840 5:10041136-10041158 TCAATGTCACAGTTAGGGATGGG + Intergenic
989741692 5:44781060-44781082 CCAGTGCAAAACTTAAGGAGGGG - Intergenic
997732985 5:136194010-136194032 TCAGGGCCAGAATTAGGGGGAGG + Intergenic
1000594697 5:163201562-163201584 TCTGTGCAACACTTAGTGAAAGG - Intergenic
1003072046 6:2952667-2952689 TCCGTGCCACACTGCAGGAGCGG - Intronic
1004512761 6:16296135-16296157 TCACTGGCACACTGAGGGAATGG - Intergenic
1007274598 6:40663946-40663968 TCAGTCCCACACCCAGGCAGGGG - Intergenic
1013417898 6:109940797-109940819 TCAGTGCCACTCTTGGGGCATGG + Intergenic
1015749838 6:136549547-136549569 CCAGGGGCACACTTAGGGACAGG - Intronic
1015844425 6:137504737-137504759 TCAGTGATAGACTTAGTGAGTGG - Intergenic
1020751873 7:12151123-12151145 ACAATGCCACACATATGGAGAGG - Intergenic
1024548387 7:50540734-50540756 TCTGTGCCTCACCCAGGGAGTGG - Intronic
1032390650 7:131553349-131553371 CCAGTGCCACTCTGTGGGAGAGG - Intronic
1032669056 7:134066829-134066851 GCAATAGCACACTTAGGGAGAGG - Intergenic
1037680711 8:21095288-21095310 TCAATGCCGCACTTATGGACCGG - Intergenic
1040623461 8:49116589-49116611 ACATTGCCAGACTTGGGGAGGGG - Intergenic
1041407798 8:57519407-57519429 ACAGTGTCAAACTTTGGGAGAGG + Intergenic
1042568227 8:70134190-70134212 CTACTGCTACACTTAGGGAGCGG + Intronic
1042819000 8:72909669-72909691 GCAGTCCCACACTCAGGTAGTGG + Intronic
1045199029 8:99960287-99960309 TGAATGCGACACTCAGGGAGGGG + Intergenic
1051140910 9:13978202-13978224 CTAGTGCCACATTTAGAGAGAGG - Intergenic
1051910287 9:22147497-22147519 TCAGTGCCACACCTGGGAATGGG + Intergenic
1058199065 9:102016031-102016053 TGACTGCCACAGATAGGGAGTGG + Intergenic
1058671848 9:107366781-107366803 GCAGTGCCACCCTGGGGGAGTGG + Intergenic
1062171157 9:135135608-135135630 TCTTTGCCACACATATGGAGAGG + Intergenic
1197035595 X:121870240-121870262 TCAGTGTCCCAATTACGGAGTGG - Intergenic
1197845099 X:130793026-130793048 TAAGTGGCACACTTAGTAAGTGG - Intronic
1199332004 X:146573082-146573104 TCACTGCCAAACTTAGAGTGTGG - Intergenic
1199978113 X:152906047-152906069 TCATTGCCACCCTTATCGAGTGG + Intergenic