ID: 1136032598

View in Genome Browser
Species Human (GRCh38)
Location 16:27514450-27514472
Sequence CTGCTTGTAGAAAGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136032598_1136032602 -4 Left 1136032598 16:27514450-27514472 CCAGGCTCCCTTTCTACAAGCAG 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1136032602 16:27514469-27514491 GCAGCACCTCTAGCAGCTGGTGG 0: 1
1: 0
2: 3
3: 38
4: 289
1136032598_1136032601 -7 Left 1136032598 16:27514450-27514472 CCAGGCTCCCTTTCTACAAGCAG 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1136032601 16:27514466-27514488 CAAGCAGCACCTCTAGCAGCTGG 0: 1
1: 0
2: 4
3: 31
4: 228
1136032598_1136032604 17 Left 1136032598 16:27514450-27514472 CCAGGCTCCCTTTCTACAAGCAG 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1136032604 16:27514490-27514512 GGTCAACACACCCAGCACACAGG 0: 1
1: 0
2: 0
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136032598 Original CRISPR CTGCTTGTAGAAAGGGAGCC TGG (reversed) Intronic
901208318 1:7510045-7510067 GAGCTTGTACAAAGGGGGCCTGG - Intronic
902294077 1:15454351-15454373 CTGTTTGTAGATAGGCACCCCGG + Intergenic
902627472 1:17684876-17684898 CTGCGAGTAGCAAGGGAGGCAGG - Intronic
903565694 1:24263817-24263839 CTGCTTCTAGAAATGTAGGCAGG - Intergenic
904280178 1:29413463-29413485 CAGCAAGTAGAAAGGGAGCCAGG + Intergenic
905284149 1:36868370-36868392 ATGCTGGGAGAAAGGGATCCTGG - Intronic
908826377 1:68136457-68136479 CTGCCTAAAGAAAGGGTGCCAGG + Intronic
912567649 1:110599783-110599805 GTGCTGGGAGAAGGGGAGCCTGG + Intronic
912716665 1:111988564-111988586 CTGTCTGTAGAAAGGGCTCCTGG - Intronic
914951388 1:152117992-152118014 ATTCTTGTAGAAATGGAGCAGGG - Intergenic
915615817 1:157037387-157037409 GTGGTAGTAGAAAGGGAGCCGGG - Intronic
917457174 1:175194847-175194869 CTGATCGTAGAAAGGAAACCAGG + Intergenic
918473924 1:184903548-184903570 CTGGTTGTTTGAAGGGAGCCTGG + Intronic
920243174 1:204568634-204568656 CTGGTTGATGAAAGGGAGACAGG + Intergenic
921328574 1:214012807-214012829 CTTCTTGTAGATAGGTATCCAGG + Intronic
921995320 1:221411670-221411692 CTGCTTGTAGAAAGAGCTGCAGG - Intergenic
1063576289 10:7264991-7265013 CTGCTTGTTGAAAGTGATCACGG - Intronic
1063963475 10:11326549-11326571 CTGCTTGAGGAAAGGGGGCATGG - Intronic
1065104808 10:22372369-22372391 TTGCTTTTGGAAAGGGTGCCTGG + Intronic
1068224258 10:54086272-54086294 ATGGTTGTAAAAAAGGAGCCTGG - Intronic
1072087290 10:92093193-92093215 CTGGGTGCAGAAAGGGAACCTGG + Intronic
1075005950 10:118830265-118830287 CTGCTTGGAGAGAGGGAGACTGG - Intergenic
1075926106 10:126252909-126252931 CTCCTTGTAGAAAGGGACAAAGG + Intronic
1076527774 10:131123204-131123226 CTGCCTCTAGAATGTGAGCCTGG - Intronic
1078013849 11:7595225-7595247 CTGCCTTTAGAAAGGTAGCAAGG + Intronic
1081216334 11:40403787-40403809 CTGCTTGTAGAGAATGAGCCTGG - Intronic
1081522168 11:43892958-43892980 CTGCATTTAGAATGTGAGCCAGG + Intronic
1081645274 11:44785944-44785966 CACCTTGTAGAAAGGGAAACAGG - Intronic
1083260890 11:61522483-61522505 CTTCTTGTAGAAAGTTGGCCGGG - Intronic
1084138972 11:67210688-67210710 CTGCTTTTAGAATGTGAGCTTGG - Intronic
1084686110 11:70696463-70696485 CTGCCTGTAGAAGTGGACCCTGG - Intronic
1086986503 11:93255814-93255836 CTGCCTGCTAAAAGGGAGCCAGG - Intergenic
1090039444 11:123277209-123277231 CTGCTTGCAGAAAGGAAGACAGG + Intergenic
1090644828 11:128758869-128758891 TTGCTTGTAGAAATGGAGACAGG + Intronic
1090783793 11:130030520-130030542 CTGCTAGTTGCAAGGGAGGCTGG - Intergenic
1091896899 12:4112486-4112508 CTGCTTTGACAGAGGGAGCCAGG - Intergenic
1092087208 12:5772989-5773011 CTGCTATTAGCCAGGGAGCCTGG - Intronic
1095505032 12:42887228-42887250 CTGATTTGAGAAAAGGAGCCTGG + Intergenic
1095508371 12:42922659-42922681 CTGCTTTTACAAAAGGAGTCAGG - Intergenic
1095969372 12:47891227-47891249 CTGTTTGTAGATAAGGAGACAGG - Intronic
1103779511 12:123389414-123389436 CTGCCTGGAGAAGGGGACCCGGG - Exonic
1104173476 12:126305052-126305074 CTGGTTGTTAAAAAGGAGCCCGG - Intergenic
1104684482 12:130775908-130775930 CTGCATGAAAAAAGGGAGCCCGG + Intergenic
1107407380 13:40127410-40127432 CAGGTTGAAGGAAGGGAGCCAGG + Intergenic
1109248733 13:59991464-59991486 CTGATTGTAGAAGGGAAGTCAGG - Intronic
1110710470 13:78645610-78645632 GTGCTTGTTTAAATGGAGCCTGG - Intronic
1113378606 13:109784699-109784721 CTGCTGGACGACAGGGAGCCGGG + Exonic
1114213923 14:20641173-20641195 CTGCTTACAGAAAGGAAGCAAGG + Exonic
1118828762 14:69409013-69409035 CTGCTTGTAGATAAGGAAACTGG + Intronic
1121321778 14:92995737-92995759 CTGCCTGTAGACAGTGAACCAGG + Intronic
1122579174 14:102761036-102761058 CGCCTTGAAGAAAGGGGGCCCGG - Intergenic
1202928580 14_KI270725v1_random:17742-17764 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1123995795 15:25716922-25716944 CTCCTGGGAGAAAGGGAGGCTGG + Exonic
1126391010 15:48152092-48152114 CTGCTAGCAGAAATTGAGCCTGG - Intronic
1128108490 15:65061443-65061465 CTTCTTCTATAAAGGGAGGCTGG - Intronic
1129966013 15:79736293-79736315 CTTCTTGAAGACAGGGTGCCTGG + Intergenic
1130038013 15:80379107-80379129 CTGATTGTTAAAAGGGAGCCTGG + Exonic
1130384706 15:83400997-83401019 GTGCATGTGGAAAGGGAGCAAGG + Intergenic
1131148940 15:90034960-90034982 CTGCTGGTAGAAGGGGTGTCTGG + Intronic
1131292402 15:91118182-91118204 ATGCTTGCAAAAAGGGAGACAGG + Intronic
1132402519 15:101522104-101522126 CTTCCTGTAGAACTGGAGCCTGG - Intronic
1132518464 16:376742-376764 CTGCGTGTCCAATGGGAGCCTGG - Exonic
1132769316 16:1552153-1552175 CCGCAAGTAGAAAGGAAGCCTGG + Intronic
1133599495 16:7325411-7325433 GTGCTTGCAACAAGGGAGCCAGG + Intronic
1135651874 16:24213336-24213358 GTACTTGTAAAAATGGAGCCAGG + Intronic
1136032598 16:27514450-27514472 CTGCTTGTAGAAAGGGAGCCTGG - Intronic
1136656618 16:31713124-31713146 CTGCTTTTTGAATGGGAGACAGG - Intergenic
1137255382 16:46770745-46770767 CTGCTTGCACCAAGGAAGCCAGG + Intronic
1137405399 16:48185013-48185035 CTGCTACTAGGAGGGGAGCCTGG + Intronic
1139510843 16:67427798-67427820 ATGCTTGTGGAAAGGGATACGGG + Intergenic
1140774190 16:78235195-78235217 CTGTTTGAAGAAAGGAAGCATGG - Intronic
1141699924 16:85637740-85637762 CTCCCTGCAGAAAGGGAGACCGG + Intronic
1142825929 17:2510839-2510861 TTTTTTGTAGAAAGGGAGTCTGG + Intronic
1143273691 17:5694313-5694335 CTGCTTGTAGAAAAGGATCCTGG + Intergenic
1143807908 17:9444799-9444821 CTGGTTGTGCAAAGGGAGACAGG + Intronic
1145908887 17:28531459-28531481 CTGCCTCTAGAGAGGGAGCTGGG - Intronic
1146530501 17:33604089-33604111 CTGCAGGCTGAAAGGGAGCCTGG + Intronic
1146535521 17:33647377-33647399 ATGGTTGTTGAAAGGGATCCTGG + Intronic
1146815648 17:35939938-35939960 GTGCTTTTAGAAAGAGGGCCAGG + Intronic
1147301461 17:39531452-39531474 CTGCTAGTAGCAAGTGAGCAAGG - Exonic
1148713713 17:49700442-49700464 CTGCCTGTTGAAAGGGATGCTGG - Intergenic
1149586490 17:57791281-57791303 CAGCTGATAGAAAGGGAGTCGGG - Intergenic
1152358301 17:79817189-79817211 CTGCTTCTAGTAAGGGATCTCGG - Intergenic
1153216437 18:2825185-2825207 CTGGTTGTTAAAAAGGAGCCTGG - Intergenic
1153445333 18:5165774-5165796 TTGCTTGTTGAAAGTGAGCTTGG + Intronic
1157282218 18:46353667-46353689 CTGCTGGTAGGCAGGGGGCCAGG + Intronic
1157695874 18:49723198-49723220 CTGGTTGTGTACAGGGAGCCAGG - Intergenic
1158890314 18:61866237-61866259 CTGCTTCTAGACAGCGAGTCGGG + Intronic
1160588886 18:79928784-79928806 CTGAGTGGAGGAAGGGAGCCTGG - Intronic
1161235004 19:3193360-3193382 CTGCTTGTAGATAGACAGCAGGG - Exonic
1162283435 19:9718949-9718971 CCCCTTGGAGGAAGGGAGCCAGG + Intergenic
1162357348 19:10194502-10194524 CTGCTTGAAGAAGGGGACCCCGG + Intronic
1163455050 19:17401644-17401666 CTGTTTGTGGTAATGGAGCCAGG - Intergenic
1166411031 19:42555526-42555548 CTGCCTGGAGGAAGGGAGCGGGG - Intronic
1167779243 19:51586617-51586639 CTCCTTTTAGAAAGGGAGTTTGG + Exonic
926180902 2:10642319-10642341 CAACTACTAGAAAGGGAGCCTGG + Intronic
926683045 2:15678412-15678434 TTGCTGGCAGAAAGGGAGTCAGG - Intergenic
926988697 2:18652864-18652886 TTGCTTGAAGAAAGGGACCTTGG + Intergenic
927408396 2:22797828-22797850 CTGCTTGGGGAAAGAGAGACTGG - Intergenic
929031335 2:37652320-37652342 CTGCTTGGAGGAAGGGATGCTGG + Intronic
930029106 2:47047596-47047618 CCCCTTGCAGGAAGGGAGCCAGG - Intronic
931653608 2:64490248-64490270 CTGGTTTGGGAAAGGGAGCCTGG + Intergenic
932273018 2:70427660-70427682 CTGATAGTTGCAAGGGAGCCTGG - Intergenic
932337938 2:70941696-70941718 ATGCTTGAAGAAAGGAAGCAGGG + Exonic
938805879 2:134806951-134806973 CATCTAGTAGAATGGGAGCCAGG - Intergenic
938881538 2:135594586-135594608 TTGCTAGAAGAGAGGGAGCCGGG - Intronic
939350905 2:141036539-141036561 CTGCCTCTAGAAAAGGAGCAGGG + Intronic
944366523 2:198927420-198927442 CTGCTTAGAGATAGGGAGACGGG + Intergenic
944565596 2:200987289-200987311 CTGCTTGGGGATAGAGAGCCAGG + Intronic
946418634 2:219552760-219552782 GTGCTTCTAGAAAGGGGGCGTGG - Intronic
948057362 2:235018637-235018659 CTTCTGGGAGAAAGGGAGGCAGG + Intronic
1169401962 20:5289671-5289693 CTGCTTGGAGCAAAGGAGTCAGG + Intergenic
1169807353 20:9573291-9573313 CTCATTGTAGAAAGGTAGTCCGG - Intronic
1172435934 20:34928948-34928970 CTGCCTATAGAAATGGAGGCAGG + Exonic
1173646594 20:44637104-44637126 CTGCTTTTGAAAATGGAGCCTGG - Intronic
1173869541 20:46332732-46332754 CTGCTGGGAGATAGGGCGCCAGG + Intergenic
1173878263 20:46390544-46390566 CAGCTTGCAGAAAAGGAGGCAGG - Intronic
1174684124 20:52437369-52437391 CTGCTTTCAGATAGGGAACCAGG + Intergenic
1174922123 20:54715012-54715034 CTGCTTGAATAAAGGGAGTTGGG - Intergenic
1176590602 21:8646325-8646347 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1180273431 22:10623359-10623381 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1180881169 22:19204411-19204433 CTGGTTTTAGAAAGGGCCCCTGG - Intronic
1181348162 22:22235611-22235633 CTGCTTGTTGAAAGTGTGCTGGG + Intergenic
1182314021 22:29431325-29431347 CTGCTTTTAGAAGGTGACCCAGG - Intergenic
1182892213 22:33828482-33828504 CAGCTTGTGGGAAGGAAGCCAGG + Intronic
1184164022 22:42716945-42716967 CAGCTGGCAGACAGGGAGCCAGG - Intronic
1185065565 22:48630138-48630160 CTGCTTGCAGAACGGGGGCGGGG + Intronic
949136670 3:575353-575375 CAGCTTGGAGAGAGGAAGCCAGG - Intergenic
949205958 3:1439535-1439557 CTGCGTCCAGGAAGGGAGCCTGG + Intergenic
951519969 3:23602252-23602274 CAGTTTGTAGAAAGGAACCCAGG - Intergenic
954837494 3:53482553-53482575 CTGCTTGAATGATGGGAGCCTGG + Intergenic
955195620 3:56802242-56802264 CTGCTGGTAGAAAGGAGGCTGGG + Intronic
957436631 3:80186009-80186031 CTACTTTGAGAATGGGAGCCTGG + Intergenic
962616778 3:137134585-137134607 CTGATTAAACAAAGGGAGCCGGG - Intergenic
963490114 3:145989093-145989115 CTGGTTGTATAAAAGAAGCCTGG + Intergenic
964210598 3:154222804-154222826 TAGTTTGCAGAAAGGGAGCCAGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
968903087 4:3440263-3440285 CTGATTACAGAAAGGGAACCAGG + Intergenic
970492903 4:16593694-16593716 CTGCTTGGGGCAAGGGAGCTCGG + Intronic
971147810 4:23997790-23997812 CTGCTTATAGAAAGGGATTTTGG - Intergenic
971387517 4:26154829-26154851 CTGGTTGTTTAAAAGGAGCCTGG - Intergenic
971472603 4:27042868-27042890 CAGATTGTAGCAAGGGAGTCAGG - Intergenic
973635345 4:52857241-52857263 TGGCTGGTAGAAAGTGAGCCTGG - Intergenic
973725750 4:53773997-53774019 CTGCTTGTTTAAAAGGAGCTTGG - Intronic
975031758 4:69629202-69629224 CTCCAGGTAGAAAGGGAGCCAGG + Intronic
975378300 4:73670343-73670365 CGGTTTGTAGAAAAGGAACCAGG + Intergenic
976619605 4:87114715-87114737 CTGCAGGGGGAAAGGGAGCCAGG + Exonic
976729883 4:88251069-88251091 GTTCTTGGAGAATGGGAGCCAGG - Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
981865255 4:149409739-149409761 CTGCTTTTAGAGAGGGAGTGTGG - Intergenic
986150925 5:5129826-5129848 CTCCTTCCAGCAAGGGAGCCTGG + Intergenic
987792009 5:22580488-22580510 TGGCTTGTAGAGAGTGAGCCGGG + Intronic
988987679 5:36636797-36636819 GAGCTTGCAGGAAGGGAGCCAGG + Intronic
991950760 5:71944981-71945003 CTGCTTCTAGACAGGTTGCCTGG + Intergenic
993185556 5:84614255-84614277 ATATTTGTATAAAGGGAGCCAGG + Intergenic
995470789 5:112499950-112499972 CTCATTCTAGAAAGGGAGACTGG - Intergenic
995948848 5:117684896-117684918 ATGCTTGTAGAAATGGGGCTGGG + Intergenic
997582713 5:135027656-135027678 CTGTGGGTAGAAAGGGAACCGGG - Intergenic
1001876575 5:175206746-175206768 CTGCTTGTTGAAGGGGAACTGGG + Intergenic
1004354631 6:14920392-14920414 CTGCTTTTAGAAAGAGAGGTGGG - Intergenic
1005984408 6:30861999-30862021 CAGCTGGTAGCAGGGGAGCCAGG + Intergenic
1010006880 6:71005220-71005242 CTGTTGGTGGAAAGGGAGACTGG - Intergenic
1010913570 6:81588278-81588300 GTGCTTTTGGAAAGGGAGCTGGG + Intronic
1010930808 6:81800803-81800825 CTGCTTCTAGCAAGGGACTCAGG + Intergenic
1013295565 6:108755587-108755609 CTGCTTCTAGGGAGGGAGCCTGG - Intergenic
1015902891 6:138085604-138085626 CTGCTTGAAGACAGGGAGACTGG - Intergenic
1017533820 6:155325995-155326017 CTGCTTGTATACAGGGAGAAAGG + Intergenic
1017841631 6:158227103-158227125 CTGCTTGGTGACAGGGAGGCAGG + Intergenic
1019425188 7:971980-972002 CAGCTGGGAGGAAGGGAGCCAGG - Intronic
1019468597 7:1204820-1204842 CTGCTTGCAGTCAGGGAGCGGGG + Intergenic
1022480513 7:30740446-30740468 CTGCCTGTCGAAAGGGTTCCAGG + Intronic
1022887443 7:34661230-34661252 ATGCTTGCAGAAAGGGACCTGGG - Intronic
1029845905 7:103412037-103412059 CTGCATGGAGAAAGGAAGGCAGG + Intronic
1030084476 7:105804919-105804941 CAGCTGGGAGAAAGGGAGACAGG + Intronic
1030827617 7:114179955-114179977 CACCTTGTAGAAAAGGAGACTGG - Intronic
1034139133 7:148800204-148800226 TTGGTGGTAGAAAGGGAGACTGG + Intronic
1034336131 7:150324703-150324725 CTTCCTGGAGAAAGGGATCCAGG - Intronic
1034418024 7:150975295-150975317 CTGGGCCTAGAAAGGGAGCCTGG + Intronic
1035545723 8:480873-480895 CTGCTTGCAGAAGAGGTGCCAGG + Intergenic
1036789082 8:11705635-11705657 CTGGTTGTTGAAATTGAGCCTGG - Intronic
1037812424 8:22094988-22095010 CAGCTTGGAGAGAGGGACCCAGG - Intronic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1041813035 8:61933220-61933242 CTGCATGTAGAAAAAGAGTCTGG + Intergenic
1044046293 8:87438317-87438339 CTGCATTTAGAAAGAGAGTCAGG - Intronic
1044824545 8:96183768-96183790 CTTCATGGAGGAAGGGAGCCTGG - Intergenic
1046947447 8:119987724-119987746 CTGCCTCTAGAGAGGCAGCCTGG + Intronic
1047041372 8:121000101-121000123 TTCCTTGTAGAAAGTGAGTCTGG + Intergenic
1048195593 8:132329443-132329465 CTGCTAGTAGAAAAGGATACTGG + Intronic
1048310505 8:133318922-133318944 CTGCTTGTAAAAAGGCGGCCAGG - Intergenic
1049545341 8:143228276-143228298 CTCCTTGTGGAAGGGGAGGCAGG - Intergenic
1052983647 9:34468523-34468545 TTTCTTGTAAAAAGAGAGCCTGG + Intronic
1054361395 9:64123988-64124010 CTGCATTTAGAAAGGAAGCGGGG + Intergenic
1056392501 9:86152812-86152834 CATCTAGTAGAATGGGAGCCAGG - Intergenic
1060060365 9:120454256-120454278 CTGGATGTAGAAATGGGGCCAGG - Intronic
1203620615 Un_KI270749v1:125050-125072 CAGCTTGGAGAGAGGAAGCCAGG + Intergenic
1188693925 X:33164504-33164526 CTGCTTTTAGAAAGTAAGCCCGG - Intronic
1189989656 X:46581936-46581958 CTGCTTCTAGGAAGTGAGACTGG - Intronic
1197513679 X:127399486-127399508 CATCTAGTAGAAAGGGAACCAGG + Intergenic
1197921366 X:131598041-131598063 CTGCCTGCAGAAAGGGAAACTGG + Intergenic
1198541213 X:137641903-137641925 CTGCTTTTAGAAAGAGAGAGAGG + Intergenic
1198612049 X:138412058-138412080 CTGCCTGTGGAAAGGAAGACTGG + Intergenic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1200828228 Y:7665197-7665219 CTGCCTGCAGCAAGAGAGCCTGG + Intergenic