ID: 1136034654

View in Genome Browser
Species Human (GRCh38)
Location 16:27530044-27530066
Sequence CCAGCAAGGGAGCGAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136034646_1136034654 -1 Left 1136034646 16:27530022-27530044 CCCTGGCAGGTTACCATGGCTCC 0: 1
1: 0
2: 1
3: 6
4: 159
Right 1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 171
1136034640_1136034654 30 Left 1136034640 16:27529991-27530013 CCTGGGCACTGCTGCCATGTGAT 0: 1
1: 0
2: 5
3: 23
4: 265
Right 1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 171
1136034645_1136034654 0 Left 1136034645 16:27530021-27530043 CCCCTGGCAGGTTACCATGGCTC 0: 1
1: 1
2: 0
3: 9
4: 177
Right 1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 171
1136034647_1136034654 -2 Left 1136034647 16:27530023-27530045 CCTGGCAGGTTACCATGGCTCCC 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 171
1136034641_1136034654 16 Left 1136034641 16:27530005-27530027 CCATGTGATTTTGCAGCCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 288
Right 1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136034654 Original CRISPR CCAGCAAGGGAGCGAATGGC AGG Intronic
902692769 1:18120375-18120397 CCATCAAGGGACCCAAAGGCAGG - Intronic
903685810 1:25131086-25131108 ACAGCCAGGGAGCGTAAGGCTGG + Intergenic
904786159 1:32984606-32984628 CTGGCAAGAGAGTGAATGGCTGG - Intergenic
905217347 1:36418231-36418253 CCAGCAACGGAGCGAGGAGCTGG - Exonic
905792728 1:40798932-40798954 CCAACAAGGGAGGGGCTGGCAGG - Intronic
906199112 1:43947800-43947822 CCAGAAAGAGAGCAAATGCCAGG - Intronic
907070724 1:51532353-51532375 CAAGCAAGAGAGGGAATTGCTGG + Intergenic
910492372 1:87786681-87786703 GCAGCCAGGGTGGGAATGGCTGG + Intergenic
913045909 1:115073351-115073373 CCAGCAAGGGACAAAAAGGCAGG - Intronic
915601211 1:156924270-156924292 CCAGCAGAGGCGCGAGTGGCCGG + Intronic
917469453 1:175314096-175314118 CCAGCATGGGAGAGCATGTCTGG + Intergenic
917531745 1:175842056-175842078 GCAGGAAGGCAGCGAGTGGCTGG + Intergenic
917582242 1:176391075-176391097 CCAGCAAGGGTGCTGATGGACGG - Intergenic
919855929 1:201706022-201706044 CCAGCCAGGGAGAGCATTGCAGG - Intronic
922763220 1:228145054-228145076 CATGCATGGGAGCAAATGGCTGG + Intronic
1063708090 10:8450746-8450768 TGAACAAGGGAGAGAATGGCAGG - Intergenic
1064517794 10:16169331-16169353 CCAGCCAGGGAGCCAATGTGAGG + Intergenic
1065854954 10:29822585-29822607 CCAGCAGGTGAGTGAATGACAGG - Intergenic
1067067880 10:43113747-43113769 CCAACAAGGGAGGAAATTGCTGG + Intronic
1067248771 10:44569990-44570012 CCAGCCTGGGAGTGAAGGGCGGG - Intergenic
1067254692 10:44625279-44625301 CCTGCAAGGGAAGGATTGGCCGG - Intergenic
1069913459 10:71773370-71773392 CCAGGAAGAGAGCGAAGAGCAGG + Exonic
1071486634 10:86106748-86106770 GAAGCAAGGGAACGAAGGGCAGG + Intronic
1072322496 10:94264361-94264383 CAAGCCAGGCAGAGAATGGCAGG + Intronic
1074461212 10:113638629-113638651 CCTGCAAGGCAGCAATTGGCTGG - Intronic
1075445364 10:122509329-122509351 CCGTCAAGGGAGCGACTGGAGGG + Intronic
1075606639 10:123816311-123816333 CCAGCCAGGGAGCCAATGTGGGG - Intronic
1076029914 10:127148544-127148566 TCAGCGAAGGAGAGAATGGCTGG + Intronic
1076383073 10:130038376-130038398 CCTGCAAGGGAGCCACAGGCTGG - Intergenic
1080178356 11:29393918-29393940 CCAGGTAGGGACTGAATGGCAGG - Intergenic
1081968417 11:47183203-47183225 CCAGCCAGGGATTAAATGGCAGG + Intronic
1083622336 11:64055422-64055444 CCAGGACGGGAGCTAGTGGCAGG + Intronic
1084453094 11:69251686-69251708 CCAGAAAGATAGCGAATGGTAGG - Intergenic
1084992295 11:72938482-72938504 CCAGCAAGGAAGAGAATAGAAGG - Intronic
1088191816 11:107235611-107235633 CCAGTTAGGGAGCCAATGTCGGG + Intergenic
1091980164 12:4858243-4858265 CCAGCAAGGGAGGGCTGGGCTGG + Intergenic
1092084139 12:5741888-5741910 CCAGCTAGGGATCCCATGGCAGG - Intronic
1092243574 12:6850547-6850569 CCAGCAGGGGAGCAACTGGAGGG - Exonic
1095225544 12:39672913-39672935 CCAGTAAGGGAGTTAATGCCAGG - Intronic
1098805301 12:75014969-75014991 CCAGTCAGGGAGCGAATGTGGGG - Intergenic
1100265789 12:92974642-92974664 CAAGCTAGGGAACAAATGGCTGG + Intergenic
1101806669 12:108069979-108070001 CCAGCAGGGGAGGGCATGGGAGG + Intergenic
1103074245 12:117969244-117969266 CGAGCAAGCGAGCGATCGGCGGG + Intergenic
1106707623 13:32298795-32298817 ACAGCAAGGAAGCCAATGACCGG + Exonic
1106844612 13:33724965-33724987 CCAGCAAGGCCCCGAATGCCTGG - Intergenic
1107229164 13:38087014-38087036 CAAGCAAGGGAGCGAGTTTCAGG - Intergenic
1111423090 13:88043286-88043308 GCAGCATGGGAAGGAATGGCAGG + Intergenic
1112721797 13:102254075-102254097 CCAGCAAGAGAGGGAAAGACTGG + Intronic
1114701689 14:24685144-24685166 CCAGAAAGAGAGCAAATAGCTGG + Intergenic
1115642233 14:35342043-35342065 CCAGCAAGGCAGCTGCTGGCTGG - Intergenic
1116158531 14:41237784-41237806 CCAGTCAGGGAGCTAATGGGAGG + Intergenic
1121995835 14:98602224-98602246 CCAGCAAGGCAGCAGAAGGCAGG - Intergenic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1124153914 15:27208669-27208691 CCAGCAAGGGGGAGTCTGGCAGG + Intronic
1126087611 15:45024088-45024110 CAAGCCAGGGAGCAAAAGGCAGG - Intronic
1130967495 15:88708216-88708238 CCAGCAAGGGACAGAATGCGTGG - Intergenic
1131515978 15:93077036-93077058 CGGGCAAGGGAGGGGATGGCAGG + Intronic
1132023118 15:98381983-98382005 CCACCAAAGGAGGGAATGCCTGG + Intergenic
1132198242 15:99929896-99929918 GCAGAAAGGGAGCGAATTGGAGG - Intergenic
1132580794 16:683816-683838 CCAGCACGGGCGAGAGTGGCCGG + Intronic
1134862600 16:17574043-17574065 CTGGCAAGGGAGAGGATGGCCGG + Intergenic
1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG + Intronic
1136683137 16:31979332-31979354 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1136783771 16:32922888-32922910 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1136886013 16:33930918-33930940 CCAGCAAGGGAGTGGAGGCCTGG + Intergenic
1138607098 16:58096560-58096582 CCTGCAAGGGAGGGATTGGGTGG - Intergenic
1203086428 16_KI270728v1_random:1186890-1186912 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1143407244 17:6685691-6685713 CCAGCCAGGGACGGAATGCCTGG - Exonic
1147144046 17:38475041-38475063 CCAGCAAGGGAGTGGAGGCCTGG - Intronic
1149649404 17:58267599-58267621 TCAGCCAGGGAGGGAAGGGCAGG + Intronic
1151426765 17:74035743-74035765 CCAGCAAGGGATGGAATTGAGGG + Intergenic
1151870664 17:76834318-76834340 TCAGCAGAGGAGGGAATGGCAGG + Intergenic
1158333891 18:56393854-56393876 CCAGGAAGGCAGAGCATGGCAGG + Intergenic
1159556406 18:69950465-69950487 CAGGCATGGGAGAGAATGGCTGG + Intronic
1162328510 19:10012428-10012450 CCAGCAAGGCAGGGCAGGGCAGG - Intergenic
1162871746 19:13591637-13591659 CCAGCTAGGGATCGGATGGGTGG - Intronic
1164911483 19:32015825-32015847 CAAGTAAGGGAGGAAATGGCTGG - Intergenic
1165578020 19:36838337-36838359 CCATCAAGGGACCGCAGGGCCGG - Exonic
1166851718 19:45764535-45764557 CCAGCAAGAGAGACAAGGGCAGG + Intergenic
1167209479 19:48124338-48124360 CCAGCTAGGAAGCGTGTGGCTGG - Intronic
1168099093 19:54131529-54131551 CCAGCAATGGGGCCAGTGGCAGG - Exonic
926810536 2:16751788-16751810 CCAGTCAGGGAGCCAATGTCGGG + Intergenic
929531467 2:42755709-42755731 CCAGAAAGGGAGCGGGTGGCTGG - Exonic
930019834 2:46994869-46994891 CCAGCACTGCAGGGAATGGCTGG - Intronic
930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG + Intronic
935549259 2:104434622-104434644 GCAGCACGGGAGCAAATGGAAGG - Intergenic
938593858 2:132766770-132766792 CCAGCAGAGGAGAGAATGCCTGG - Intronic
943212185 2:184981120-184981142 TCAGCAAGGGAGAACATGGCAGG + Intergenic
945276932 2:207997528-207997550 CCAGCAAGTAAGAGAATGACAGG + Intronic
946703936 2:222438915-222438937 CCAGTCAGGGAGCCAATGGGGGG + Intronic
947533819 2:230928654-230928676 CCAGCAGGGGAGACAAAGGCAGG - Intronic
947759531 2:232593646-232593668 CAAGCACGGGAGAGGATGGCTGG + Intergenic
947827951 2:233118857-233118879 CCAGGAAGGGAGAGAATGCAGGG - Intronic
948524213 2:238560310-238560332 CCAGCATGGGAGGGACTGGGAGG + Intergenic
1169025678 20:2369175-2369197 CCAGCAAGGGAGGGATGGGGTGG - Intergenic
1169512336 20:6277783-6277805 TCAGCAGGGCAGCAAATGGCAGG + Intergenic
1172274663 20:33673212-33673234 CCAGCAAAGGGGAGACTGGCAGG + Intronic
1173614532 20:44394248-44394270 CCAGCATGGGAATGAATGGTGGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175321473 20:58091205-58091227 CCAGGAAGGGAGGGAAAGCCAGG - Intergenic
1176291351 21:5046633-5046655 CTAGCAAGGGGGAGATTGGCCGG - Intergenic
1176717920 21:10368811-10368833 CCAGGAAGGGAGGGAAAAGCAGG + Intergenic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1179865904 21:44217008-44217030 CTAGCAAGGGGGAGATTGGCCGG + Intergenic
1180038904 21:45265778-45265800 CCAGCAAGGGGGCGGCCGGCTGG - Intronic
1180299147 22:11021717-11021739 CCAGGAAGGGAGGGAAAAGCAGG + Intergenic
1180939106 22:19645253-19645275 CCAGCCAGGGAGCGAGAGGCAGG - Intergenic
1182522564 22:30892595-30892617 CCAGCAAGGCAGGGGAGGGCCGG + Intronic
1183252205 22:36738079-36738101 CCAGCAGGGCAGGGCATGGCAGG - Intergenic
1184234630 22:43176431-43176453 CAAGGAAGGGAGGGAAAGGCCGG + Intronic
949936609 3:9120945-9120967 CCAGGTGGGGAGGGAATGGCTGG + Intronic
952353894 3:32567128-32567150 CCTGCAAGGGAGAGAGTGCCAGG - Intronic
953686283 3:45080875-45080897 AGAGGAAGGGAGAGAATGGCAGG - Intergenic
954193936 3:48984928-48984950 CCAGCAAGGGAGAGACTGTGGGG + Exonic
955442661 3:58974058-58974080 AGAGCAAGTGAGAGAATGGCAGG + Intronic
956553399 3:70488451-70488473 CAGGCAGGGGAGAGAATGGCAGG - Intergenic
959006175 3:101022449-101022471 CCAGAAAGGGGGAGAATGGAGGG - Intergenic
960349379 3:116574551-116574573 CCAGTCAGGGAGCCAATGGGGGG - Intronic
963810642 3:149773214-149773236 CCAATAAGGGAGGGACTGGCAGG - Intronic
968905639 4:3449443-3449465 TCAGCAAGGCAGGGAATGGTGGG - Exonic
974397648 4:61359466-61359488 GCAGCAAGGGGGCTAATGGGCGG - Intronic
981982812 4:150815459-150815481 CCAGCGAGGGAGAGAATGACAGG + Intronic
982750114 4:159150955-159150977 CCAGCAAGCGAGAGAATAGAGGG + Intronic
986830668 5:11573710-11573732 CCAGCAAGGCAGCAGATGACAGG + Intronic
987145149 5:14984423-14984445 ACAGAAAGGGAGAGAATGACAGG - Intergenic
988107612 5:26771406-26771428 CCAGCTAGGGAGCCAATGTGGGG - Intergenic
989090027 5:37720865-37720887 CCAGAAAGGGAGATAATGTCAGG + Intronic
990402789 5:55456296-55456318 CGTGCAAGAGAGAGAATGGCGGG + Intronic
997303017 5:132820120-132820142 CCAGCCAGGCAGGGAAAGGCTGG - Intergenic
1001889354 5:175326385-175326407 CCAGGAAGAGAGCTAATGACAGG - Intergenic
1003164023 6:3660719-3660741 CCAGCAAGGGTGTGAGTGGCGGG + Intergenic
1004434468 6:15577223-15577245 CCAGAGAGGGAGCAAAGGGCTGG + Intronic
1004481406 6:16023129-16023151 TCAGCAAGGGAGAGACTGGGTGG - Intergenic
1004806754 6:19211216-19211238 CCAGCAAGGGAGGGAATGCTAGG + Intergenic
1005456730 6:26027134-26027156 CTAGCAAGGCGCCGAATGGCCGG + Exonic
1005570355 6:27139405-27139427 CGAGCAAGGCGCCGAATGGCTGG - Exonic
1006553250 6:34842884-34842906 CTAGCAAAGCAGCCAATGGCAGG - Intronic
1006983312 6:38162445-38162467 CCAGCTAGGGAACGAGAGGCCGG - Intergenic
1013835349 6:114328426-114328448 CCAGAATGGGAACCAATGGCTGG + Intronic
1015475610 6:133656369-133656391 CCAGTCAGGGAGCCAATGTCAGG - Intergenic
1016920629 6:149289602-149289624 CCAGCAAGGGGCCCAGTGGCTGG - Intronic
1017052552 6:150407354-150407376 CCAGCAGGGTGGGGAATGGCAGG + Intergenic
1018107482 6:160502918-160502940 CCAGTAAGGGAGCCAATGTGGGG + Intergenic
1018153137 6:160959310-160959332 CCAACAAGACAGCAAATGGCAGG - Intergenic
1018410364 6:163539160-163539182 CCAGCAAGGGAGAGCAAAGCGGG + Intronic
1019335197 7:479403-479425 ACAGCACGGGAGCGAATGGAAGG - Intergenic
1019472171 7:1226946-1226968 CCAGCCTGGGGGCGAATGGCTGG + Intergenic
1019848227 7:3527915-3527937 CCAGCTAGGGGGTGAATGGTAGG + Intronic
1019848312 7:3528289-3528311 CCAGCTAGGGGGTGAATGGTAGG + Intronic
1020119751 7:5496354-5496376 TCAGCAAGGGAGGCACTGGCCGG - Intronic
1023103348 7:36740589-36740611 CCAGCAAAGCAGTGAATGCCAGG - Intergenic
1023488096 7:40708636-40708658 TCAGCAAGGGAGTCAGTGGCAGG - Intronic
1023535431 7:41203665-41203687 CCAGCAGGGGTGGGAATGGAAGG - Intergenic
1023829221 7:44029309-44029331 TCAGCAAGGGAGCGTAGGGCGGG + Intergenic
1024216648 7:47254358-47254380 CCAGCAAGGGACCCAGGGGCGGG - Intergenic
1032097515 7:128946986-128947008 CCAGCAAGGGAGGGAAGAGATGG - Intronic
1032237235 7:130135941-130135963 TCAGCAAGGGAGCAACTGTCGGG + Intergenic
1034081178 7:148279011-148279033 CCATCAAGGGACAGAGTGGCAGG + Intronic
1034441040 7:151086314-151086336 CCAGCGAGCGAGCGAGGGGCGGG + Intronic
1037523087 8:19699119-19699141 CCAGCATGGGAGGCAAAGGCAGG - Intronic
1038895117 8:31774116-31774138 CCAGCAAAGGGGAGAGTGGCAGG - Intronic
1039983663 8:42429752-42429774 CCAGCACGGGGGCCAAAGGCAGG - Intronic
1044286108 8:90413570-90413592 CCAGTCAGGGAGCCAATGGGGGG + Intergenic
1044304549 8:90622812-90622834 GCATCAAGGGAGAGAATGGCTGG + Exonic
1046436753 8:114199485-114199507 CCGGCAAGGCAGCAATTGGCAGG + Intergenic
1048708713 8:137183916-137183938 CCATCAAGGGAGCGTGTGGAAGG + Intergenic
1048824753 8:138413233-138413255 AGAGCAAGGGAGGGAATGGGTGG - Intronic
1053387715 9:37707812-37707834 CCAGCCAGGGAGCCAAGGGTGGG - Intronic
1054567513 9:66774753-66774775 CCAGCCAGGGAGCCTCTGGCAGG - Intergenic
1054919445 9:70527086-70527108 CCAGAAAGGCAGCGTATGGATGG - Intergenic
1056259528 9:84833915-84833937 GCAGCAAGGGTGAGAATTGCAGG + Intronic
1057705844 9:97394433-97394455 CCAGCAAAGGGGCGAATGCCTGG + Intergenic
1059667794 9:116465349-116465371 CCAGAATGGGAGCAACTGGCTGG + Intronic
1060868821 9:127022629-127022651 ACAGCAAGGTAGCCCATGGCTGG - Intronic
1061227097 9:129286809-129286831 CCAGGAGGGGAGGGAATGGAGGG - Intergenic
1061580514 9:131533035-131533057 CCAGCCACGTAGCGAAAGGCAGG + Intergenic
1185542585 X:915503-915525 CCAGGAAGGGAGGGAAAAGCAGG - Intergenic
1189281292 X:39821491-39821513 CGAGCCAGCGAGGGAATGGCGGG - Intergenic
1192197011 X:69035118-69035140 GCATCAAGGGAGCCAACGGCAGG + Intergenic
1197404937 X:126038075-126038097 CCAGTCAGGGAGCCAATGGGGGG - Intergenic
1198064039 X:133078109-133078131 CAAGCAAGGGAGGAAGTGGCTGG - Intronic
1201676571 Y:16592303-16592325 CCATCAAGGTAGCTAATGCCAGG + Intergenic