ID: 1136034719

View in Genome Browser
Species Human (GRCh38)
Location 16:27530498-27530520
Sequence TGCTGCCTTTTGGGGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136034719_1136034727 9 Left 1136034719 16:27530498-27530520 CCAAATCCCCCCAAAAGGCAGCA 0: 1
1: 0
2: 0
3: 26
4: 230
Right 1136034727 16:27530530-27530552 ATGGCCTCAGCTTCATCTATAGG 0: 1
1: 0
2: 1
3: 6
4: 144
1136034719_1136034725 -10 Left 1136034719 16:27530498-27530520 CCAAATCCCCCCAAAAGGCAGCA 0: 1
1: 0
2: 0
3: 26
4: 230
Right 1136034725 16:27530511-27530533 AAAGGCAGCATCCATATTCATGG 0: 1
1: 0
2: 2
3: 121
4: 1087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136034719 Original CRISPR TGCTGCCTTTTGGGGGGATT TGG (reversed) Intronic
902192418 1:14773081-14773103 TGCTACCTTTGTGGGGGACTAGG - Intronic
904418480 1:30376826-30376848 GGCTTCCTTTTGGGGTGACTGGG - Intergenic
904458587 1:30662207-30662229 TGCTGGATTTAGGGTGGATTTGG - Intergenic
905785951 1:40757692-40757714 TGCTGCCTATTTGGGAGATTGGG + Intronic
906480806 1:46197920-46197942 TGATGCCTTCTGGGGAGATGAGG + Intronic
906630606 1:47364074-47364096 TGCAGCATTTTGGGGTGTTTGGG + Intronic
906723313 1:48024971-48024993 TGCTTGCTTTAGGGGGGATGGGG - Intergenic
908357527 1:63337232-63337254 TGGGGCCTTTGGGGGTGATTAGG + Intergenic
910035694 1:82784828-82784850 TGCTGCATTTTGTGGGAGTTAGG + Intergenic
911042836 1:93605161-93605183 GCCTGCCTCTTGGGGTGATTTGG - Intronic
913555526 1:119962896-119962918 TGCTCCTTTCTGGGGGGATGTGG - Intronic
917179227 1:172276297-172276319 TCCTGCCTGATGGGGGAATTTGG + Intronic
921294641 1:213690413-213690435 TGATGCAGTTTGGAGGGATTTGG - Intergenic
922912588 1:229230164-229230186 TTCTGGCTTTTGGAGGGATTTGG - Intergenic
924221975 1:241886805-241886827 TCTTACCTTTTGGGGGGATTTGG - Intronic
924502150 1:244647780-244647802 TGCTACGTTTTGGGGTAATTTGG + Intergenic
1064147355 10:12836032-12836054 TGCTGTCTTTTGTGGGGGTTTGG + Intergenic
1067050187 10:43011496-43011518 TGGGGTCTTTTGGGGTGATTAGG + Intergenic
1068126115 10:52844026-52844048 TGCTTTCTCTTGGGGGCATTTGG + Intergenic
1069073193 10:64011282-64011304 TCCTGCCTTTTGGGTGTATTAGG + Intergenic
1070609205 10:77922093-77922115 TGCCGCCTTGTTGGGGGAATGGG - Intronic
1071715024 10:88086976-88086998 TGTTTCCTTTTGTGGGGATATGG - Intergenic
1073083221 10:100872828-100872850 TCCTGCCTTTTTGGGGTAGTAGG + Intergenic
1075031080 10:119025269-119025291 TCCTGCCCTTTGGGGGGCTTGGG - Intergenic
1077316883 11:1923346-1923368 TGGTGGCTTTTGGGGGGCTCGGG - Intronic
1078238499 11:9508483-9508505 TGCTGCCTCATGGTGGGATGAGG + Intronic
1078504787 11:11927629-11927651 TGCTACATTTTGGAGGAATTTGG + Intronic
1079977975 11:27116309-27116331 TGGGGCCTGTTGGGGGGGTTGGG + Intronic
1080634088 11:34108129-34108151 GGCTGCCTTTTGTGGGGCCTGGG - Intronic
1080656572 11:34263167-34263189 TGCTGCTTTTGGTGGGGGTTGGG + Intronic
1081498706 11:43644281-43644303 TTCTGCCTTTCGGAGGGTTTGGG + Intronic
1083247013 11:61436537-61436559 TTCGGACTTTTGGGGGGATCAGG - Intronic
1086113963 11:83227769-83227791 GGCTGCCTTTAAGGGTGATTTGG + Exonic
1088252051 11:107869519-107869541 TCATGCCTTTTTGGGGGTTTTGG - Intronic
1088704633 11:112450853-112450875 TGCTGCCTTTTAGGTGTGTTTGG + Intergenic
1088840688 11:113625092-113625114 TGGGGCCTTTGGGGGTGATTAGG - Intergenic
1089233086 11:116997044-116997066 TGCTTTCATTTGGGTGGATTTGG - Intronic
1090212938 11:124935700-124935722 TGCAGCCTTTTGGGGGAAGGGGG + Intronic
1091355062 11:134931077-134931099 TGCTGCCTTTTGGATAGCTTCGG + Intergenic
1091522029 12:1255098-1255120 TGGGGCCTGTTGGGGGGGTTTGG - Intronic
1092497281 12:9009296-9009318 TTCTGCTGTTTGGGGGAATTAGG + Intronic
1092883552 12:12906559-12906581 TACTCCTTTTTGGGGGGATGGGG - Intronic
1093599847 12:21008661-21008683 TGGTGCCTGTTGGGGGGGTGGGG + Intergenic
1095809874 12:46361546-46361568 TGCTGCATTTTAGGATGATTTGG - Intronic
1095952913 12:47791259-47791281 TGCTGCCCTGTGGTGGGGTTGGG - Exonic
1096214057 12:49789661-49789683 TGATGCCATTTTGGGGGATGGGG + Intergenic
1100565762 12:95791361-95791383 TGCTGCCTTTTGCGGGGGTAGGG + Intergenic
1101390760 12:104297881-104297903 TGCTGCCTTTTGAGGTGTTGTGG + Intronic
1101690175 12:107071234-107071256 TGCTGACTTTTGAGCTGATTTGG + Intronic
1102514309 12:113436134-113436156 TATTGGCTTTTGGGGGGTTTGGG - Intronic
1103201101 12:119088655-119088677 TGATTCCTTTTGGGGGGCGTGGG + Intronic
1104085312 12:125469503-125469525 TGCTGCCTTGGGAGGGGAGTAGG + Intronic
1104384838 12:128341717-128341739 TGCAGCCATTTTGGGGGATGAGG + Intronic
1107877360 13:44802572-44802594 TGAGGCCTGTTGGGGGGAATGGG - Intergenic
1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG + Intronic
1117153839 14:52917610-52917632 TGCTGTCATTTCAGGGGATTCGG - Intronic
1117609611 14:57468578-57468600 TGGTTCCTTTTGGGAGGAGTGGG - Intergenic
1119630488 14:76227779-76227801 TTCTGCCTGTTGGGGGAATTGGG - Intronic
1120081392 14:80220643-80220665 TGCTGCTTGTTGGGGGGAATGGG + Intronic
1120483132 14:85077505-85077527 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1120568325 14:86086484-86086506 TGCTGCCTTTGAGGGGGATGAGG + Intergenic
1121006235 14:90492231-90492253 TGGGGCCTTTGGGGGTGATTAGG + Intergenic
1121507526 14:94487948-94487970 TGATGCCTTTGGAGTGGATTTGG - Intronic
1124557668 15:30742229-30742251 TGCGGCCTGTCGGGGGGATGTGG + Intronic
1125555553 15:40581837-40581859 TGCTGGCTTTTGGAGGGGGTGGG + Intergenic
1126569788 15:50138530-50138552 TGGTGCCTTTTAGGGTGTTTAGG - Intronic
1127571572 15:60248468-60248490 TATTGCTTTTTGGGGGGAGTGGG + Intergenic
1127868807 15:63053281-63053303 TGAGGCCTTTTGTGGGGAGTTGG + Intronic
1129232514 15:74204583-74204605 TGCTGCCTTGTAGAGGGAGTGGG - Intronic
1130554636 15:84914293-84914315 TGGAGCCTTTGGGGGTGATTAGG - Intronic
1132224942 15:100133177-100133199 AGCTGCCTGTTGGGGGCAGTGGG + Intronic
1132935533 16:2478694-2478716 CGTTGCCTTTTGGGGGAATGGGG + Intronic
1133161074 16:3912214-3912236 TGCTGCCTTTTGATTTGATTTGG - Intergenic
1133278205 16:4650576-4650598 TGCCCCCTTTAGGGGTGATTTGG - Intronic
1134344743 16:13379365-13379387 TACTGACTTTTGGAGGGAGTGGG + Intergenic
1134347808 16:13407440-13407462 TGAGGCCTTTTGGGGTTATTAGG - Intergenic
1134400761 16:13907712-13907734 TGGTGCCTTTGGTGGGGATGAGG - Intergenic
1134653386 16:15928289-15928311 TGCTGCCTTGGGAGGGGAGTTGG - Intergenic
1135168820 16:20165189-20165211 TGGTGCCTCTTGGGGTGATGTGG + Intergenic
1136034719 16:27530498-27530520 TGCTGCCTTTTGGGGGGATTTGG - Intronic
1137388935 16:48065518-48065540 TGCTGGCTTCAGGGGAGATTAGG - Intergenic
1139961343 16:70719313-70719335 TGATGCTTTTTCGGGGAATTAGG - Intronic
1140139640 16:72243335-72243357 TGCAGCACTTTGGGAGGATTTGG + Intergenic
1141768105 16:86071972-86071994 TGCAGCCTTTTGGGGAGCTAGGG - Intergenic
1144384998 17:14741224-14741246 TGGGGCCTTTGGGGGTGATTAGG - Intergenic
1145986659 17:29051597-29051619 AGCTCCCTTTTGGGGGGAAACGG - Intronic
1146088211 17:29850071-29850093 TGGTGCCTGTTGGGGGACTTGGG - Intronic
1147737350 17:42648442-42648464 GGTGGCCTTTTGGGGGCATTAGG - Intergenic
1147946596 17:44083805-44083827 TGCTGCCTTGTGGGGGCATCGGG - Exonic
1148920343 17:51026146-51026168 ACCTGCCTTTTGTGGGGAGTGGG - Intronic
1150876337 17:68975006-68975028 TGGGGCCTGTTGGGGGGATGGGG - Exonic
1151036323 17:70804683-70804705 TGTTTCCTTTTTGGGGGAGTGGG - Intergenic
1151043341 17:70890227-70890249 TGGTTCCTTTTTTGGGGATTTGG - Intergenic
1151415142 17:73957188-73957210 TGCTGCAGTGTGGGGTGATTTGG + Intergenic
1153420110 18:4895594-4895616 TGCTTTCTTTTGTGGGCATTTGG - Intergenic
1153951647 18:10062678-10062700 TGCTCCCTTTTGGGGGTGGTTGG + Intergenic
1156049978 18:32920984-32921006 TCCTGTCTTGTGCGGGGATTAGG - Intergenic
1158022855 18:52864686-52864708 TGGGGCCTGTTGGGGGGATTGGG - Intronic
1159889857 18:73943274-73943296 TGCTGTCTTTTGGGGGAGTGGGG + Intergenic
1160027849 18:75233296-75233318 TTCTCACTTTTGGGGGAATTTGG + Intronic
1161281352 19:3447471-3447493 TGCTGCTATTTGGGGTGAGTGGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163713688 19:18861943-18861965 TCCTGCATTTTGGGGGGACTGGG + Intronic
1164033957 19:21436886-21436908 TACAGCCTTTTGGGGGAACTGGG + Intronic
1165166650 19:33861799-33861821 TGCAGTCTTTTGGGGGAATCAGG + Intergenic
1166641554 19:44498766-44498788 TGCTGGCATTTGGGCAGATTGGG - Intronic
1166999820 19:46739170-46739192 GGCTGCCTTTGGGGGGAAGTCGG + Intronic
1167016969 19:46847466-46847488 TGCAGCACTTTGGGGGGATGAGG - Intronic
925138217 2:1534153-1534175 TGCTCGCATTGGGGGGGATTTGG - Intronic
925138905 2:1536921-1536943 TGCTCACATTGGGGGGGATTTGG - Intronic
926312628 2:11685656-11685678 TGCTACCCTCTGGGGGGACTCGG - Intronic
927554258 2:24021487-24021509 TGCTGTCCTGTGGGGTGATTGGG + Intronic
927813480 2:26193814-26193836 GGGAGCCCTTTGGGGGGATTTGG - Intronic
927840996 2:26443973-26443995 GGCTGCCTCTTGGTGGGAATGGG + Intronic
929292800 2:40212642-40212664 TGCTGCCTTCTGAAGGCATTAGG + Intronic
932834952 2:75027593-75027615 TGCTGCATTGTGAGGGGTTTTGG + Intergenic
934603806 2:95679318-95679340 TGGTGCCCTTTGGGAGGATCTGG + Intergenic
934968387 2:98743050-98743072 TGCTGCCCTTTGGCAGGAGTGGG + Intergenic
935135782 2:100300401-100300423 TCCTGCCGTTTGGGGTGATTTGG + Intronic
936537184 2:113321545-113321567 TGGTGCCCTTTGGGAGGATTTGG + Intergenic
937490823 2:122365552-122365574 TGAAGCCTTTGGGGGTGATTAGG - Intergenic
939159753 2:138574007-138574029 TGCTGCTTTTGGGGGGGTGTTGG + Intergenic
941531866 2:166680260-166680282 TGGAGCCTTTGGAGGGGATTAGG + Intergenic
942060912 2:172227973-172227995 TGTTGCCTTTTGTGGGTATGTGG + Intergenic
942236857 2:173918824-173918846 TGCTGTCTTTTTGGGCCATTTGG - Intronic
942497225 2:176552413-176552435 TGCTTCTTTTTGGGGGGAGGGGG + Intergenic
943096180 2:183431976-183431998 TGGGGCCTGTTGGGGGGATAGGG + Intergenic
943962429 2:194282698-194282720 TGCTATCTTTTGGGGTAATTAGG + Intergenic
946155332 2:217803314-217803336 TGATGCCTTTTTGGGGGCTGGGG - Exonic
946382004 2:219355146-219355168 TGCTGCCTTTTGAAGGCTTTTGG - Intergenic
947023218 2:225707244-225707266 TGCTGCCTTCTGGAGGTATTTGG + Intergenic
947074788 2:226330746-226330768 TGTTTCTTTTTGGGGGGATGGGG + Intergenic
948626988 2:239275533-239275555 TGCTGCCTGTTGGTGGGGTTAGG - Intronic
1168907204 20:1416024-1416046 TGCTGGCTTTTGAGGGCAGTGGG - Intergenic
1172266083 20:33615576-33615598 TGCTACTTATTGGGGGGAATAGG - Intronic
1172423025 20:34833870-34833892 AGTGGCCTTTTGGGGGCATTAGG + Intergenic
1173428024 20:42959589-42959611 TGCTGGATTTTGAGGGGATTTGG - Intronic
1174760313 20:53200621-53200643 TGCTGCGTTTTTGGGGATTTGGG + Intronic
1175988426 20:62775912-62775934 GGTTGCCTTTTGGGGGCCTTGGG - Intergenic
1178435344 21:32553243-32553265 TGAGGCCTTTGGGGGTGATTAGG + Intergenic
1178505852 21:33162528-33162550 TGATGGCTTCTGGTGGGATTCGG - Intergenic
1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG + Intronic
1181025572 22:20125516-20125538 TGTTGCCTTTTGGGGAGAGGGGG + Intronic
1181486663 22:23235904-23235926 TGGGGCCTTTGGGGGTGATTAGG - Intronic
1181495051 22:23282994-23283016 TACAGCCTGTTGTGGGGATTGGG + Intronic
1181636642 22:24177766-24177788 TGCTGCCTTTGGGGGAGAGCAGG - Exonic
1182155551 22:28069079-28069101 TGCTGTCTTTTTGGAGGTTTTGG - Intronic
1182792083 22:32961217-32961239 TGTCTCCTGTTGGGGGGATTGGG + Intronic
1183017317 22:34999760-34999782 TCTTGCCTTTTCTGGGGATTGGG - Intergenic
1183310581 22:37107459-37107481 GGCTGGCTTTGGGGGGCATTTGG - Intronic
1183690193 22:39383889-39383911 TGCTGTCCTTTGGGAGGACTTGG - Exonic
1184420237 22:44377532-44377554 TGCTGCTGTTTTGGGGGTTTTGG - Intergenic
1184437028 22:44485296-44485318 TGGTGTTTTTTGGGGGGTTTTGG + Intergenic
1185173987 22:49308763-49308785 TGCTGCCTTTTGTGCTGATGTGG - Intergenic
1185289459 22:50016292-50016314 TGCAGCCTCTTGTGGGGACTCGG - Intronic
949723256 3:7015131-7015153 TGCTGGCTTATGGGGGGGTGGGG - Intronic
950168670 3:10820811-10820833 TGCTGCCTTTTGACTGGAATTGG + Intronic
950825962 3:15821723-15821745 TGCTGCCATGTAGGGGGAGTTGG - Intronic
952943076 3:38457991-38458013 GGCTGCCTTTTGGGAGGAATGGG + Intronic
953064464 3:39456326-39456348 TGCTGCCTGGTGCGGGGATGGGG - Intergenic
954280778 3:49576112-49576134 TGGTGCCTTTTGGGGCTGTTGGG + Intronic
955053202 3:55432056-55432078 TGCTGAAGTTTGTGGGGATTGGG - Intergenic
955641060 3:61084824-61084846 TGCTGCCTGGTGTGGGGAGTGGG - Intronic
959037816 3:101386579-101386601 TGCAGCCTTCTAGGTGGATTTGG - Intronic
959548089 3:107621195-107621217 AGCTGACTTTTGGGGGGAGCTGG + Intronic
960050518 3:113234811-113234833 TGTTGCCTTTTTGGATGATTCGG + Intronic
961414189 3:126745491-126745513 TAGTGCATTTTGGGGGAATTTGG - Intronic
961832267 3:129629328-129629350 TGGTGCCTTTTGGGGAGTCTTGG - Intergenic
964044082 3:152300126-152300148 TGCTCTTTTTTGGGGGGGTTGGG + Exonic
964549947 3:157874822-157874844 TTTTGCCTTTTGGGGGGTTTTGG - Intergenic
964618919 3:158700900-158700922 TGCTCCCTTTTGGGGGAAGCAGG - Intronic
965051226 3:163650821-163650843 TGCTTTCTCTTGGGGGCATTTGG + Intergenic
969935406 4:10674963-10674985 TGGGGCCTGTTGGGGGGTTTGGG + Intronic
971442935 4:26709607-26709629 TCCTGCCTGTTGAGGGGATTGGG + Intronic
973845145 4:54904163-54904185 GGCTGTTTTTTGGTGGGATTTGG + Intergenic
974288620 4:59902295-59902317 TGCGGCCTTTTGGTGGGGCTTGG + Intergenic
974616806 4:64296744-64296766 TGTTGGCTTTTGGGTGGAATTGG + Intronic
975926618 4:79463030-79463052 TGCTAAGTTTTGGGGTGATTTGG - Intergenic
977209022 4:94196236-94196258 TGGTGGCCTTTGGGGGCATTAGG + Intergenic
981555027 4:145983848-145983870 TGCTGCATTTTGGGAGGCTGAGG + Intergenic
984373177 4:178892775-178892797 TTCTGCCTTTTTTGGGGAATTGG + Intergenic
984841810 4:184075685-184075707 AGCTGCCTTTTGCTGGGATAAGG + Intergenic
986621338 5:9678769-9678791 TGGAGCCTGTTGGGGGGTTTGGG + Intronic
990201550 5:53381799-53381821 TTCAGCCTTTTGGGAGGATGAGG + Intergenic
991769365 5:70026110-70026132 TTCTGGCTTTTGAGGGGAGTGGG - Intronic
991848660 5:70901528-70901550 TTCTGGCTTTTGAGGGGAGTGGG - Intronic
992731462 5:79674062-79674084 TACTGACTTTTGAGGAGATTAGG - Intronic
994972760 5:106762342-106762364 TGCTGCTTTTTGGAGTGACTGGG - Intergenic
995493408 5:112716130-112716152 TGCTGCTTTTTGGGGTTCTTCGG + Intronic
995885570 5:116890567-116890589 TGCAGCCTTTCTGGAGGATTGGG + Intergenic
996016071 5:118535211-118535233 TGCTGTTTTGTGGGGAGATTTGG + Intergenic
996297029 5:121931278-121931300 TTCTGCCTTTTGGGGGGTGGAGG + Intergenic
996685510 5:126276029-126276051 TGGGGCCTTTTGGGGGGTGTGGG - Intergenic
997949534 5:138231200-138231222 TCCTCCCTTTTGGGGTGATGGGG - Intergenic
999271676 5:150300296-150300318 TGCTGCACTTTCGGGGGACTTGG - Intronic
1000245657 5:159446736-159446758 AGCTGCCTTGTGGGGCCATTAGG - Intergenic
1000668516 5:164029208-164029230 AGCTTCCTTTTGAGGAGATTAGG - Intergenic
1001912550 5:175533080-175533102 TGGAGCCTGTTGGGTGGATTTGG + Intergenic
1004579165 6:16931465-16931487 TGGTGCCTTTTGGAGGGAGGAGG + Intergenic
1005633181 6:27728248-27728270 TGGTGCCATTTGATGGGATTTGG - Intergenic
1007184577 6:39958099-39958121 TGTTGGCTTTTTGGGGGACTGGG + Intergenic
1007188019 6:39988992-39989014 TGCTGCCTGTAGGGAGGAGTTGG + Intergenic
1007315608 6:40986222-40986244 TGGTGTCTTTTGGGGACATTTGG - Intergenic
1007416697 6:41695180-41695202 ACCTGCCTTTTGGGGCCATTGGG + Intronic
1012412017 6:98969445-98969467 TGGGGCCTTTTGAGGTGATTTGG - Intergenic
1014302650 6:119701740-119701762 TGGGGCCTTTGGGAGGGATTAGG + Intergenic
1017282698 6:152640645-152640667 TGTGGCCTTTGGGGGTGATTAGG + Intergenic
1017617128 6:156257576-156257598 TGAGGCCTTTGGGGGCGATTAGG + Intergenic
1017997227 6:159542545-159542567 TACTCCCTTTTGAGTGGATTAGG - Intergenic
1021104267 7:16618564-16618586 TCTTTCTTTTTGGGGGGATTCGG + Intronic
1021311095 7:19097771-19097793 TCCTGGCTTTTTGAGGGATTCGG + Intronic
1023283463 7:38594770-38594792 TGCTTCCTTTAGGGGAAATTTGG - Intronic
1023891314 7:44393885-44393907 TGCTCCCTCTTGGGGGGACGTGG - Intronic
1024157435 7:46639337-46639359 TGCTGCCTTTTGAAGGTATGCGG - Intergenic
1024269937 7:47634759-47634781 TGGAGCCTTTGGGGGTGATTGGG - Intergenic
1025016320 7:55441516-55441538 TACTGCCTTATGGGGTTATTGGG + Intronic
1025215378 7:57051622-57051644 TCCTGCCCTTTGGGGGGCTAAGG - Intergenic
1025655995 7:63519081-63519103 TCCTGCCCTTTGGGGGGCTAAGG + Intergenic
1026332070 7:69360820-69360842 TGGCGACTGTTGGGGGGATTTGG + Intergenic
1032006548 7:128306368-128306390 TGCTGTCTTTTGGGGTCCTTAGG + Exonic
1032826799 7:135578212-135578234 TTCTGTTTTTTGGGGGGATTTGG + Intronic
1034713524 7:153218509-153218531 TGCTGCCTTTTGGTTCTATTTGG + Intergenic
1035399437 7:158555262-158555284 AGCTGCCTTTTGGGGGAGGTTGG + Intronic
1035925336 8:3721978-3722000 TACTGGCTTGTGGGGGGCTTGGG - Intronic
1035958064 8:4105041-4105063 TGCTGCCTTTAGTTGGAATTAGG - Intronic
1036442440 8:8793475-8793497 TGCTGGCTTTTGTGGGGCTTAGG - Intronic
1042718396 8:71801247-71801269 ATCTGACTTTGGGGGGGATTGGG - Intergenic
1042865698 8:73355293-73355315 TGGTGCCTTTGGTGGTGATTAGG - Intergenic
1044536394 8:93361124-93361146 TTCTGCCTTCAGGTGGGATTGGG - Intergenic
1044656243 8:94551551-94551573 TGCTTTCTTCTGGGGTGATTGGG - Intronic
1045831916 8:106472015-106472037 TACTGTCTTTTGTGTGGATTAGG + Intronic
1045838998 8:106558265-106558287 TGCTGGCTTTTGGGCTGCTTTGG - Intronic
1047538515 8:125741809-125741831 TGCTTTCTTTTGTGGGCATTTGG + Intergenic
1048410242 8:134164823-134164845 TGATGCCTTTGGGGGTGATTAGG - Intergenic
1048884401 8:138898088-138898110 TGGGGCCTTTTGGAGGGCTTAGG - Intronic
1049610808 8:143553911-143553933 CGCTGCCTTGTTGGGGGAATGGG - Intronic
1053219912 9:36303837-36303859 GGTGGCCTTTTGGGGGCATTAGG + Intronic
1055445356 9:76376913-76376935 TGCTTGGTTTTGGAGGGATTAGG - Intergenic
1057544561 9:96007846-96007868 TGCTGGCTTCTGGGGGCAGTGGG + Intronic
1059160145 9:112026378-112026400 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1060179795 9:121525991-121526013 TGCAGCCCTTTGGGGGGCTGAGG - Intergenic
1060547943 9:124471589-124471611 TGCTGCCTCCTGGGGGGCCTTGG - Intronic
1060983122 9:127804702-127804724 TACTGGCTTGTGGGGGGATGTGG + Intronic
1061360701 9:130140447-130140469 TGCTGCCATTTGAGGGGAGATGG + Intergenic
1061478335 9:130884123-130884145 TGCTGCGTTTGGGAGGGGTTGGG - Exonic
1061587000 9:131575906-131575928 TGCTGCCTTTGCGGGGCATGAGG + Intergenic
1190109993 X:47583302-47583324 GGCAGCCTATGGGGGGGATTAGG - Intronic
1190118989 X:47645094-47645116 TGCTGTCTTTGTGGGTGATTAGG - Intronic
1192032479 X:67528895-67528917 TGGTGCCTGTTGTGGGGGTTGGG + Intergenic
1193266461 X:79476936-79476958 TGATGCCTGTTGGGGGAAATGGG - Intergenic
1193440296 X:81532639-81532661 TGCTGCCTTTTGGAGGGAGGAGG + Intergenic
1195774257 X:108385871-108385893 TGGGGCCTTTTGGGGGGGTAGGG - Intronic
1196838996 X:119840331-119840353 GGCTGCCTTGTGGGAGGACTAGG - Intronic
1197522504 X:127517183-127517205 GGCTGGCTTTGGGGGGGATTAGG - Intergenic
1197883050 X:131189542-131189564 TGGTGCCTTTGGCGGTGATTAGG + Intergenic
1200139556 X:153892519-153892541 TACTGCATTTGGGGGTGATTTGG + Intronic
1200374821 X:155768448-155768470 GGCTGCGTTTTGAGGGGTTTAGG - Intronic