ID: 1136041660

View in Genome Browser
Species Human (GRCh38)
Location 16:27584252-27584274
Sequence CGTGGCTGAAGAGTTAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136041660_1136041671 27 Left 1136041660 16:27584252-27584274 CCAAGGCTAACTCTTCAGCCACG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136041660_1136041667 9 Left 1136041660 16:27584252-27584274 CCAAGGCTAACTCTTCAGCCACG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1136041667 16:27584284-27584306 AGAGACTCGCTGGCCCATCTAGG 0: 1
1: 0
2: 1
3: 14
4: 99
1136041660_1136041668 10 Left 1136041660 16:27584252-27584274 CCAAGGCTAACTCTTCAGCCACG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1136041668 16:27584285-27584307 GAGACTCGCTGGCCCATCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1136041660_1136041663 -1 Left 1136041660 16:27584252-27584274 CCAAGGCTAACTCTTCAGCCACG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1136041663 16:27584274-27584296 GGCCCCAGATAGAGACTCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136041660 Original CRISPR CGTGGCTGAAGAGTTAGCCT TGG (reversed) Intronic