ID: 1136041666

View in Genome Browser
Species Human (GRCh38)
Location 16:27584278-27584300
Sequence TGGGCCAGCGAGTCTCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136041666_1136041675 18 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041675 16:27584319-27584341 TCCTGGAGACAAAGGTTGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 278
1136041666_1136041673 14 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041673 16:27584315-27584337 CTTGTCCTGGAGACAAAGGTTGG 0: 1
1: 0
2: 0
3: 22
4: 166
1136041666_1136041678 20 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041678 16:27584321-27584343 CTGGAGACAAAGGTTGGGTGGGG 0: 1
1: 0
2: 8
3: 37
4: 402
1136041666_1136041672 10 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041672 16:27584311-27584333 TGCACTTGTCCTGGAGACAAAGG 0: 1
1: 0
2: 2
3: 18
4: 163
1136041666_1136041677 19 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041677 16:27584320-27584342 CCTGGAGACAAAGGTTGGGTGGG 0: 1
1: 0
2: 3
3: 34
4: 264
1136041666_1136041671 1 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136041666_1136041674 15 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041674 16:27584316-27584338 TTGTCCTGGAGACAAAGGTTGGG 0: 1
1: 0
2: 0
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136041666 Original CRISPR TGGGCCAGCGAGTCTCTATC TGG (reversed) Intronic