ID: 1136041671

View in Genome Browser
Species Human (GRCh38)
Location 16:27584302-27584324
Sequence CTAGGGTTGTGCACTTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136041666_1136041671 1 Left 1136041666 16:27584278-27584300 CCAGATAGAGACTCGCTGGCCCA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136041662_1136041671 9 Left 1136041662 16:27584270-27584292 CCACGGCCCCAGATAGAGACTCG 0: 1
1: 0
2: 0
3: 6
4: 294
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136041665_1136041671 2 Left 1136041665 16:27584277-27584299 CCCAGATAGAGACTCGCTGGCCC 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136041664_1136041671 3 Left 1136041664 16:27584276-27584298 CCCCAGATAGAGACTCGCTGGCC 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136041660_1136041671 27 Left 1136041660 16:27584252-27584274 CCAAGGCTAACTCTTCAGCCACG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1136041671 16:27584302-27584324 CTAGGGTTGTGCACTTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136041671 Original CRISPR CTAGGGTTGTGCACTTGTCC TGG Intronic