ID: 1136046620

View in Genome Browser
Species Human (GRCh38)
Location 16:27620294-27620316
Sequence GAATCCCCCTGAGCCATCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136046617_1136046620 1 Left 1136046617 16:27620270-27620292 CCAGTGGAGACTTGTGAAGAATG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1136046620 16:27620294-27620316 GAATCCCCCTGAGCCATCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 42
1136046616_1136046620 5 Left 1136046616 16:27620266-27620288 CCTTCCAGTGGAGACTTGTGAAG 0: 1
1: 0
2: 1
3: 12
4: 120
Right 1136046620 16:27620294-27620316 GAATCCCCCTGAGCCATCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136046620 Original CRISPR GAATCCCCCTGAGCCATCGT CGG Intronic
900505675 1:3028882-3028904 AAGTCCCCCTGAGCCAGCGCAGG + Intergenic
901195835 1:7439290-7439312 GGACCACACTGAGCCATCGTTGG + Intronic
910661839 1:89681737-89681759 TAATCCCCCTGTGTCATCGGAGG - Intronic
917567595 1:176229341-176229363 TGATCCCCCAGAGCCATTGTGGG - Intergenic
922316848 1:224450056-224450078 GAAGCCCCCTGAGCCAGAATAGG + Intronic
923162355 1:231326097-231326119 GAAGCCTCCTGAGCCAAAGTAGG - Intergenic
1070281327 10:75050991-75051013 GAATCCCCTTGAGCTAACCTGGG + Intronic
1070558946 10:77551354-77551376 CAGACCCCCTGAGCCATGGTGGG + Intronic
1070677519 10:78422349-78422371 GACTCCCCCAGAGCCATTGCAGG - Intergenic
1073291623 10:102416112-102416134 GTATCCCCCTGAGCCAACGAGGG + Exonic
1074100010 10:110347488-110347510 GAAGCCCCCTGAACCAGAGTAGG - Intergenic
1075418096 10:122280384-122280406 ACAACCCCCTGAGCCTTCGTGGG - Intronic
1091760925 12:3086848-3086870 CAACCCCCTTGAGCCCTCGTGGG + Intronic
1102399101 12:112613274-112613296 GAATCCCCCTGTGTAATGGTTGG + Intronic
1102444112 12:112988297-112988319 GAAGCCTCCTGAGCCAGAGTAGG + Intronic
1112225657 13:97537416-97537438 GAAGCCCCCTGAACCAGAGTAGG - Intergenic
1114573930 14:23695424-23695446 TAGTCCCCCTGGGCCATCATTGG - Intergenic
1116309989 14:43312636-43312658 GAAACCCCCTGAGCCAGAGTAGG - Intergenic
1122069748 14:99198023-99198045 GTATCCCCCTGATCCATCGAAGG + Intronic
1122984800 14:105207126-105207148 GAATCCCCTTGAGCCAGAGTTGG - Intergenic
1124442892 15:29701425-29701447 GCATGCCCCTGAACCATGGTCGG - Exonic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126663094 15:51051665-51051687 GAATCCTCCTGACCCATGGCTGG + Intergenic
1127784963 15:62347747-62347769 GTGTCCCCTTGAGCCTTCGTAGG - Intergenic
1129605004 15:77020578-77020600 GAATCCTCCTGACCCATCCAGGG - Intronic
1136046620 16:27620294-27620316 GAATCCCCCTGAGCCATCGTCGG + Intronic
1149035100 17:52125154-52125176 GAAGCCCGCTGAGTCAGCGTTGG + Intronic
1165903378 19:39179041-39179063 CTCTCCCCCTGAGCCATTGTGGG + Exonic
933773910 2:85760327-85760349 GAGTCCCCCACAGCCATTGTCGG - Intronic
938103960 2:128517145-128517167 GAATCCCGGGGAGGCATCGTGGG - Intergenic
1173543158 20:43869616-43869638 CAATCCCACTGGGCTATCGTGGG + Intergenic
1175998395 20:62821422-62821444 GGACCCACCTGAGCCATCTTAGG + Intronic
1179079553 21:38158243-38158265 GAGTCCCCCTGAGCAACCATAGG - Intronic
951283466 3:20780366-20780388 GATTGCCCCAGAGCCATAGTAGG + Intergenic
952977049 3:38705407-38705429 GTCTCCCCCTGTGCCATCCTCGG + Intronic
991577623 5:68121861-68121883 TATTCCCCCAGAGCCATTGTGGG - Intergenic
1001997809 5:176175833-176175855 GAATGCCCCAGGACCATCGTAGG - Intergenic
1002478180 5:179481959-179481981 GAATCCCCCTGAGAGATTGATGG + Intergenic
1005863531 6:29920093-29920115 GAATGCCCCTGAGCCATTTTTGG + Intergenic
1017017729 6:150115479-150115501 CACTCCACCTGAGCCAGCGTCGG - Intergenic
1017129796 6:151098444-151098466 GCATCACCCTGAGCCATCCGAGG + Intronic
1020140779 7:5610541-5610563 GAAGACCCCTGAGCAATGGTTGG + Intergenic
1022337075 7:29431980-29432002 GAAGCTACCTGAGCCATCTTAGG - Intronic
1023965870 7:44962838-44962860 GCATCCCACTAAGCCATCGCGGG - Exonic
1038676095 8:29624201-29624223 AGATGCCCCTGAGCCATCCTTGG - Intergenic
1054761782 9:69011429-69011451 GAATCACCCTGAGCCCACCTGGG + Intergenic
1189505061 X:41605215-41605237 TAATCCCACTGAGCCATTTTAGG - Intronic
1192210958 X:69127373-69127395 TAATCCCCCTGAGCCAGCCATGG - Intergenic