ID: 1136048796

View in Genome Browser
Species Human (GRCh38)
Location 16:27636194-27636216
Sequence GAAAAGTCTGGCCCCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136048790_1136048796 25 Left 1136048790 16:27636146-27636168 CCTATCTCAAAATCAAAAATCTA 0: 1
1: 0
2: 6
3: 178
4: 1631
Right 1136048796 16:27636194-27636216 GAAAAGTCTGGCCCCCACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1136048789_1136048796 26 Left 1136048789 16:27636145-27636167 CCCTATCTCAAAATCAAAAATCT 0: 1
1: 0
2: 18
3: 274
4: 2260
Right 1136048796 16:27636194-27636216 GAAAAGTCTGGCCCCCACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1136048794_1136048796 -10 Left 1136048794 16:27636181-27636203 CCTGGAAAAAATGGAAAAGTCTG 0: 1
1: 0
2: 3
3: 34
4: 450
Right 1136048796 16:27636194-27636216 GAAAAGTCTGGCCCCCACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1136048793_1136048796 -9 Left 1136048793 16:27636180-27636202 CCCTGGAAAAAATGGAAAAGTCT 0: 1
1: 0
2: 5
3: 84
4: 541
Right 1136048796 16:27636194-27636216 GAAAAGTCTGGCCCCCACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136048796 Original CRISPR GAAAAGTCTGGCCCCCACGC TGG Intronic