ID: 1136049569

View in Genome Browser
Species Human (GRCh38)
Location 16:27640810-27640832
Sequence CAGTAGTGCTAAAGGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136049559_1136049569 25 Left 1136049559 16:27640762-27640784 CCTTAATGCCGACTGCAAACCTG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136049566_1136049569 -8 Left 1136049566 16:27640795-27640817 CCTCTGCGAGGTGAGCAGTAGTG 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136049562_1136049569 17 Left 1136049562 16:27640770-27640792 CCGACTGCAAACCTGGGTCCTGA 0: 1
1: 0
2: 2
3: 22
4: 154
Right 1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136049565_1136049569 -1 Left 1136049565 16:27640788-27640810 CCTGACACCTCTGCGAGGTGAGC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG 0: 1
1: 0
2: 2
3: 19
4: 218
1136049563_1136049569 6 Left 1136049563 16:27640781-27640803 CCTGGGTCCTGACACCTCTGCGA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG 0: 1
1: 0
2: 2
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136049569 Original CRISPR CAGTAGTGCTAAAGGGAAGA CGG Intronic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906741700 1:48191019-48191041 CAGGAGAGCAAAAGGGGAGAAGG + Intergenic
907857324 1:58316581-58316603 GAGTAGTGCTAGGGAGAAGAGGG + Intronic
908110984 1:60897166-60897188 CAGCAGTGCTAATGGGAAGTTGG - Intronic
909684220 1:78328494-78328516 CAGTTGTGCCAAGGGGAGGAGGG - Intronic
913268534 1:117069040-117069062 TTGTAGTCCTAAAGTGAAGAAGG - Intronic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
915731062 1:158054862-158054884 CAATAGAGCGACAGGGAAGATGG + Intronic
917123153 1:171661912-171661934 GAAAAGAGCTAAAGGGAAGATGG + Intergenic
918176123 1:182046838-182046860 CAGGACTGTTAAAGGGAAAAGGG - Intergenic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
920764192 1:208815965-208815987 CAGAAAGGCAAAAGGGAAGAAGG + Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
922384231 1:225065805-225065827 GAATAGTGCTAAAAGGAACATGG + Intronic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
923104792 1:230845809-230845831 CAGTAGTGATTATGGGAGGAGGG - Intronic
923128057 1:231049476-231049498 CTGTAGTACTAAAGGGTATATGG - Intergenic
923639514 1:235739942-235739964 AAGTAGTGGGAAAGGGAAGATGG + Intronic
1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG + Intronic
1064199797 10:13274664-13274686 CAGAAAAGCAAAAGGGAAGAGGG - Intergenic
1065760292 10:28975538-28975560 TAGAAGTGCTAAAGGAGAGATGG - Intergenic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1067921549 10:50463725-50463747 GAGTAGTGCTTAAGTGAACAGGG - Intronic
1070369667 10:75770513-75770535 AAGAACTGCTATAGGGAAGAAGG - Intronic
1074475840 10:113773550-113773572 CAGTAGGCCGAAAGGAAAGATGG + Intronic
1075831524 10:125416017-125416039 CCATAGGGCTACAGGGAAGAAGG + Intergenic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1079231114 11:18649559-18649581 CAGTAGTGTGAAAGGGAAGCTGG + Intergenic
1080179436 11:29406282-29406304 CAGCAGTCCTATGGGGAAGAGGG + Intergenic
1083447625 11:62719842-62719864 CAGGAGGGCAAAAGGCAAGAGGG - Intronic
1086216554 11:84389301-84389323 TACTAGTGATCAAGGGAAGAGGG + Intronic
1090562572 11:127948211-127948233 CAGGAGAGAAAAAGGGAAGAAGG - Intergenic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1095987377 12:48008424-48008446 AAATAGTGATAAAGTGAAGAAGG + Intergenic
1096335285 12:50750719-50750741 CACTGGTGGTAAAGGGCAGAAGG - Intergenic
1097134121 12:56837117-56837139 CAGGAGAGCAAAAGGGAAAAAGG + Intergenic
1098470319 12:70835989-70836011 CAGTAGTGGAAAGGGGAAAAAGG - Intronic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101266401 12:103092917-103092939 CAGAAGTGAAACAGGGAAGAGGG - Intergenic
1101538825 12:105645757-105645779 CAATAATCCTAAAGAGAAGAGGG - Intergenic
1103767537 12:123291739-123291761 AAATAGAGCTGAAGGGAAGAGGG + Exonic
1104236300 12:126940998-126941020 AAGTAGTGCAAAAAAGAAGATGG + Intergenic
1105604878 13:21919090-21919112 CCAAAGTCCTAAAGGGAAGAGGG - Intergenic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1108286015 13:48908623-48908645 CACTATTGCTGAAGGGAAGCTGG - Intergenic
1109913076 13:68942540-68942562 CAGTAGAGCTACATGTAAGATGG - Intergenic
1111223024 13:85229656-85229678 GATTAGTGCTAAAGGCAGGATGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1113163406 13:107409859-107409881 CAGTAGTACTCAAGAGATGAGGG - Intronic
1114852901 14:26401840-26401862 TAGAAGTGCTAAGGGGCAGATGG - Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1117746884 14:58878836-58878858 CAGTGGTGGTAAAGGTGAGAAGG + Intergenic
1118375029 14:65169419-65169441 CAGTAGAGCTGAAATGAAGAAGG + Intergenic
1120279456 14:82420624-82420646 TACAAGTGCTAAAGGAAAGAAGG - Intergenic
1120740925 14:88108019-88108041 CAGTAGTGCAGTATGGAAGATGG - Intergenic
1121193835 14:92052653-92052675 CAAAAGTGGTAAAGGGATGAGGG - Exonic
1127927033 15:63556942-63556964 CAGTAACGCTGATGGGAAGAAGG - Intronic
1129639602 15:77361775-77361797 CAGTAGTGCTACAGTAAACACGG - Intronic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135573109 16:23564499-23564521 TACTACTGATAAAGGGAAGATGG - Intronic
1135857374 16:26024363-26024385 CCACAGTTCTAAAGGGAAGATGG - Intronic
1135987596 16:27195348-27195370 AAGTATTGCAAAGGGGAAGATGG - Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136096310 16:27959569-27959591 CAGAAGGGCAAAAGGGAGGACGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1140280865 16:73554449-73554471 CTGAAGTGCTGAAGGCAAGATGG - Intergenic
1140777171 16:78260230-78260252 CAGCAGTGTTACTGGGAAGAGGG + Intronic
1141924329 16:87157421-87157443 CTGGTGTGCTAATGGGAAGAAGG + Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1148973860 17:51509780-51509802 CAGTCATGCTAATTGGAAGAGGG + Intergenic
1150841046 17:68605653-68605675 GAGTAGTGCTCCAGTGAAGATGG - Intergenic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1153173837 18:2347768-2347790 CACTGGTGCTTAAGGGAAAAAGG - Intergenic
1154083075 18:11276938-11276960 CTGCAGTGCTAACGGGATGAAGG + Intergenic
1157234296 18:45948905-45948927 CAGAAGTGCTAAAGAAAAGGAGG + Intronic
1157783055 18:50457270-50457292 CAGTAATTCAAAAGGGAGGAGGG + Intergenic
1159681755 18:71362427-71362449 TAGTAGTGCTCCAAGGAAGATGG - Intergenic
1159801067 18:72899740-72899762 CAGCAGTGCCAGAGAGAAGATGG - Intergenic
1160295706 18:77634770-77634792 CACTAGTGAAATAGGGAAGATGG - Intergenic
1164505171 19:28854294-28854316 TAGGAGTGAGAAAGGGAAGAGGG - Intergenic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1166371915 19:42306676-42306698 CAGGCGTGCCAAAGGGAAGAAGG - Intronic
1167740838 19:51324097-51324119 CAGGAGAGCTACAGGGATGAGGG + Intronic
1167969217 19:53176227-53176249 CAACACTGCAAAAGGGAAGAAGG + Intronic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
926999235 2:18775054-18775076 CAGTAATCCTAAAAGGGAGAAGG - Intergenic
927050570 2:19324222-19324244 CAGAAGGGATAAAGGAAAGAAGG + Intergenic
927187566 2:20492587-20492609 CAGTGGTGTTAATGGGGAGATGG + Intergenic
928994441 2:37272011-37272033 CAGAAGTGCTGAATGGATGAGGG - Intronic
931064689 2:58572104-58572126 CAGGAGGGGCAAAGGGAAGATGG - Intergenic
931092161 2:58897863-58897885 CAGAACTGCCAAACGGAAGAAGG - Intergenic
931717249 2:65038887-65038909 CAGCAGTGCTAACTGGAAGAAGG - Intergenic
932623238 2:73279076-73279098 CAGGAGTGCAAATGGGGAGAAGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933544816 2:83696452-83696474 CATCTGTTCTAAAGGGAAGAAGG - Intergenic
937110447 2:119363115-119363137 GACTAGTTTTAAAGGGAAGAAGG - Intronic
937773922 2:125753366-125753388 CAGTAGTGCTAGAAGAAAAAGGG - Intergenic
938275374 2:130015879-130015901 CAGTAGTTCTAACTGGTAGAAGG - Intergenic
938326326 2:130406616-130406638 CAGTAGTTCTAACTGGTAGAAGG - Intergenic
938363612 2:130714843-130714865 CAGTAGTTCTAACTGGTAGAAGG + Intergenic
938439989 2:131321394-131321416 CAGTAGTTCTAACTGGTAGAAGG + Intronic
938902555 2:135810185-135810207 CAGTAGTGAGAAGGGGGAGAAGG + Intronic
939249655 2:139667483-139667505 CATTAATGTTAAAGGGAATAAGG - Intergenic
940170169 2:150820470-150820492 CAGAAGTGCTAAAATGAAGGTGG + Intergenic
940613679 2:156023511-156023533 TAGAAGTGCTAAAGGTAAGTAGG + Intergenic
940876736 2:158905206-158905228 CTTTAATGCTAAAGGTAAGATGG + Intergenic
942256335 2:174103012-174103034 CAGTAGTGTGAAAGGCAAGCAGG + Intronic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
944309589 2:198218541-198218563 CTCTAGGGCTAAAGGGAGGAGGG + Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
944875278 2:203958332-203958354 TGGTACTGCTAGAGGGAAGAAGG + Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
1169951492 20:11049250-11049272 CAATAATGCTGAGGGGAAGAAGG - Intergenic
1172286179 20:33742072-33742094 CAGTAGAGCCACAGGAAAGAAGG - Intronic
1172554893 20:35832264-35832286 CAGAGGTGCAAAAGGGGAGAGGG - Intronic
1172716773 20:36970092-36970114 CAGGAGAGCAAAAGGGGAGAAGG + Intergenic
1173209278 20:41019552-41019574 CAGTATGGCTAAGGGGTAGAGGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1175066106 20:56290352-56290374 CAGGAGTGGGAATGGGAAGATGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1177903049 21:26940174-26940196 CAGTATTGCTGAAGGTGAGAGGG + Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
949976687 3:9467298-9467320 CTTAAGTGCTAAGGGGAAGAAGG + Intronic
950089463 3:10285135-10285157 CAGTAGTGGAGAAGGGAGGAAGG + Intronic
950301774 3:11885781-11885803 CAGTAGTTCCACAGTGAAGAAGG - Intergenic
951371035 3:21848287-21848309 CAGTAGTGCTACAGTGAACATGG + Intronic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
952401236 3:32966043-32966065 CTGTAGTGCAGAAGGGAAGGTGG + Intergenic
956387559 3:68736532-68736554 CAGAAAAGCTAAAGGTAAGATGG - Intronic
961392529 3:126562635-126562657 TAGAAATGCTAAAGGGAAAAGGG - Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
963486321 3:145938337-145938359 CAGCAGTGCTAAAGAGAATCAGG - Intergenic
966653623 3:182328176-182328198 CACTGGTCTTAAAGGGAAGATGG + Intergenic
967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG + Intergenic
967271517 3:187737194-187737216 CAAAAGAGCTAAAGGGAGGAAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967868056 3:194206461-194206483 AAGAAGTGCCAACGGGAAGAAGG + Intergenic
968838972 4:2986792-2986814 CAATAGTACTAAAGGAAAGATGG - Intronic
969036095 4:4255153-4255175 CAGTACTGAGAAAGGGAAGGGGG + Intergenic
969306477 4:6328819-6328841 CAGTAGTGGTGATGGGAGGAGGG + Intronic
971209656 4:24603507-24603529 AAGTACTGCTAAAGAGTAGATGG + Intergenic
972968718 4:44545602-44545624 CAGTAGTGGGAAAGGAAGGAAGG - Intergenic
973721846 4:53731764-53731786 CAGAAGTGAGAAAGGGAAGGAGG + Intronic
973788125 4:54353508-54353530 AAGTAGTGGTAATGGGAGGAAGG - Intergenic
976027105 4:80701714-80701736 CTGCAGTGCTAAAAGCAAGAAGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
980899732 4:138893191-138893213 CAGGAGTGCTGAAGGAAATAGGG - Intergenic
981479043 4:145217571-145217593 CAGTAGTGCTGAAAGCAGGAAGG + Intergenic
982524788 4:156465233-156465255 CATTAGTACTAAAGAGAAAAAGG + Intergenic
986439469 5:7767047-7767069 CTGTAGTGGTTAAGAGAAGAAGG - Intronic
988006870 5:25424725-25424747 CAGTATTGCTAGAAGGAAAATGG + Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
990782345 5:59379261-59379283 CAGTGGTGCTAAAAGTCAGAAGG - Intronic
991464131 5:66892308-66892330 CAGTAATACAAAAGGGAGGAGGG - Intronic
991550071 5:67826091-67826113 CAGAAGTGGCAAAGGGAACAAGG + Intergenic
991956753 5:72002344-72002366 CAGCATTGCTGAATGGAAGAGGG + Intergenic
992195722 5:74337027-74337049 TTGTAGTGTTAAAGTGAAGAAGG + Intergenic
992558488 5:77927360-77927382 CCTTATTGCTAAAGGAAAGAGGG - Intergenic
993336649 5:86667905-86667927 CAGAAGTTCTAAAGGGCATATGG - Intergenic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
998462899 5:142322654-142322676 CAGGAGGGCTAAGGGCAAGAGGG + Intronic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1003409530 6:5850625-5850647 CCGTGGTGCAAACGGGAAGAAGG + Intergenic
1004573240 6:16868344-16868366 CGGCAGTGCTGAAGGCAAGAAGG + Intergenic
1004735901 6:18406235-18406257 CAGGAGTGCTGTGGGGAAGAGGG + Intronic
1004819298 6:19349624-19349646 CAGTAATGAAAAAGGAAAGAAGG + Intergenic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1006730885 6:36235494-36235516 GAGTAGTGCTGAAGGAGAGAGGG + Intergenic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1009480104 6:64146521-64146543 CAGCAGGGGAAAAGGGAAGAAGG + Intronic
1009831032 6:68935307-68935329 AACTAGTGCTCTAGGGAAGAAGG - Intronic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1015100873 6:129478455-129478477 GATTATTGCTAAAGGGGAGAAGG + Intronic
1015459536 6:133473397-133473419 CAATAGTGAGAAAGGGAAAATGG + Intronic
1016308632 6:142710223-142710245 TAGTAGTTGTAAAGGGGAGATGG - Intergenic
1017013861 6:150084280-150084302 CAGTAGTTCTAAAGGCAGGATGG + Intergenic
1017076952 6:150627807-150627829 CACTAGTGCTCAAGGCAAGAGGG - Intronic
1017188351 6:151625390-151625412 GAGTATTGCTAAGTGGAAGAGGG + Intergenic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1022769399 7:33453249-33453271 CAGCTGAGTTAAAGGGAAGAAGG + Intronic
1022778591 7:33554548-33554570 CAGTAGTGCTATTGGTAAAATGG + Intronic
1023530824 7:41151869-41151891 CAGTCATGCTGAAGAGAAGAAGG - Intergenic
1023711295 7:42995800-42995822 CAATAATGAAAAAGGGAAGATGG - Intergenic
1026672194 7:72400243-72400265 CAGTAGTGCCCAAGAGAAGAGGG - Intronic
1028154680 7:87416336-87416358 CAGTATCTCTATAGGGAAGAAGG - Intronic
1028463348 7:91120932-91120954 CAGAAAAGCTACAGGGAAGATGG + Intronic
1029811995 7:103058525-103058547 CAGAAGTGCTAGAGAGCAGATGG - Intronic
1030689486 7:112517753-112517775 CAGTGGTGGTAAAGGGGTGATGG + Intergenic
1032666695 7:134043922-134043944 CAGTTGTGCTAATTGGAAGTGGG + Intronic
1037666486 8:20974162-20974184 CTGTAGTGCTGACTGGAAGATGG + Intergenic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038819225 8:30936996-30937018 AAAGAGTCCTAAAGGGAAGAGGG + Intergenic
1040006370 8:42624604-42624626 CAGTAATTTTAAAGGGAAAAGGG - Intergenic
1040625911 8:49149842-49149864 CAGCAATGCTCAAGGGAAGAGGG + Intergenic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1044463776 8:92480088-92480110 TAATAGTGCTAAAAGAAAGAAGG - Intergenic
1044846603 8:96388047-96388069 CAGTAGTGCTCAAGCAGAGACGG - Intergenic
1045311877 8:101010068-101010090 CTGTACTGCTAAAGGGAGTAGGG + Intergenic
1046940705 8:119928295-119928317 CAGAAGTTCTAAAGGCATGAAGG - Intronic
1047201088 8:122768337-122768359 CAGTAGTTTTGAAGGGAACAGGG + Intergenic
1047819615 8:128504212-128504234 CAGTAGTGATAAAGGTTTGAAGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048641374 8:136366515-136366537 CAGCAGAGCTAAAGTAAAGAAGG - Intergenic
1048946533 8:139453606-139453628 CTGGAGGGTTAAAGGGAAGAAGG + Intergenic
1050867863 9:10526764-10526786 CAGTAGTGCAGTAGAGAAGAAGG + Intronic
1052269280 9:26609546-26609568 CAGAAATGCTAAAGGAAACAGGG + Intergenic
1056122811 9:83505951-83505973 GAGAAATGCAAAAGGGAAGATGG + Intronic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1062151092 9:135019432-135019454 CAGGAGAGCTCCAGGGAAGACGG + Intergenic
1185833844 X:3327200-3327222 CAGGAGGGCAAAAGGAAAGATGG - Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1186944755 X:14553435-14553457 CAATAGTGTTTAAGGGAACATGG - Intronic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1194262230 X:91710520-91710542 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1195348836 X:103977893-103977915 GAGTAGTGCAGATGGGAAGAGGG + Intergenic
1195356204 X:104041993-104042015 GAGTAGTGCAGATGGGAAGAGGG + Exonic
1195358607 X:104060946-104060968 GAGTAGTGCAGATGGGAAGAGGG - Intergenic
1195671344 X:107472749-107472771 CAGAAGTGATAAAGGGAAAAAGG - Intergenic
1196499917 X:116367996-116368018 CAGCACTGCTACAGAGAAGAGGG + Intergenic
1197677468 X:129346089-129346111 TAGTATTGCAAAAGGGAAGGTGG + Intergenic
1200049850 X:153422975-153422997 CTGCAGGGCTAAGGGGAAGAGGG - Intergenic
1200581526 Y:4955353-4955375 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1202332310 Y:23767707-23767729 CAGCAGTGCTAAAAAGAAGGGGG + Intergenic
1202538459 Y:25902356-25902378 CAGCAGTGCTAAAAAGAAGGGGG - Intergenic