ID: 1136050512

View in Genome Browser
Species Human (GRCh38)
Location 16:27646821-27646843
Sequence CTGGGTGACCTCATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136050512 Original CRISPR CTGGGTGACCTCATGGAGCA AGG (reversed) Intronic
900536133 1:3178723-3178745 AGGGGTGCCCTCAAGGAGCAGGG - Intronic
901624624 1:10616966-10616988 TATGGTGACCTCCTGGAGCAGGG + Intronic
902731132 1:18369602-18369624 CAGGGTGCCCTGATGGTGCAAGG - Intronic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906244745 1:44265045-44265067 CTGGGTGGCCTCCTGGCTCAAGG - Intronic
909542717 1:76808416-76808438 CTGTGTCATCTCATGGAGGAGGG - Intergenic
910350275 1:86288499-86288521 CTAGATGACTTTATGGAGCATGG + Intergenic
912207919 1:107528427-107528449 CTGAATGACCTCATGGAGTAGGG + Intergenic
913370196 1:118090275-118090297 CTGTGTGACCTGATGTAACATGG - Intronic
913524971 1:119682329-119682351 CTGTATGACCTCATGGAGTAAGG + Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
916455736 1:164969574-164969596 CCAAGTGACCACATGGAGCACGG - Intergenic
916457985 1:164990933-164990955 TTCAGTGACCTCATGGAGCATGG - Intergenic
917093718 1:171379748-171379770 CAGGGTGAAGTCATGGGGCAGGG - Intergenic
917999948 1:180484130-180484152 CAGGGTTACCTCATGGCTCAGGG + Intronic
918760315 1:188396725-188396747 CTGGATGACCGCATAGAGAATGG + Intergenic
919813052 1:201420996-201421018 CTGGGGGTCCTCTTGGAGGAAGG - Intronic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
921837667 1:219794729-219794751 CAGGGTGGCCTCATGGCCCAGGG + Intronic
922419292 1:225448714-225448736 CTGGATGTCCTCATGGTGCCTGG + Intergenic
923387901 1:233483861-233483883 CTGTGTGTCATCATGGAGCAGGG + Intergenic
924217360 1:241837615-241837637 GTGGGAGTCCTCATGGACCACGG - Intergenic
924225407 1:241917733-241917755 CTGGGTGCCCTCCTGGAACCAGG - Intergenic
1065612212 10:27483109-27483131 CTGGCTGCTCTCATGGAGCCAGG + Intergenic
1065731869 10:28716908-28716930 CTGTGTCACCCCATGGAGGAAGG - Intergenic
1067216908 10:44310932-44310954 CTGGGGGACTGCATGGAGAAGGG + Intergenic
1070623788 10:78034149-78034171 CTTGTTGACTTCGTGGAGCACGG + Intronic
1071252456 10:83834362-83834384 CTGAGTGACTTCATGGGGAATGG + Intergenic
1072710326 10:97712296-97712318 CTGGGTGACAGCATGGGACAGGG + Intergenic
1075656458 10:124164980-124165002 TTGGGTGACCCCGAGGAGCATGG - Intergenic
1075712328 10:124537376-124537398 GTGGGTGGCCTCATGAATCAGGG + Intronic
1076476666 10:130758432-130758454 CTGGGTGACCTGGAGTAGCAAGG - Intergenic
1078363842 11:10691053-10691075 CTGGGTCACCTCACAGAGCCTGG - Intronic
1080551547 11:33376853-33376875 CTGGCGGCCCTCCTGGAGCACGG + Intergenic
1081991905 11:47342577-47342599 CTGGCTGAGCTCATTGTGCAGGG - Exonic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1085620800 11:78036758-78036780 CTGGCTGCCCTCATGGAGCTTGG - Intronic
1087775499 11:102253126-102253148 CTGTGTGATCTCATGGTGGAAGG + Intergenic
1088357350 11:108957823-108957845 CTGCCTGAAGTCATGGAGCAGGG + Intergenic
1089582342 11:119489294-119489316 CTGGGGGTCCTGATGGACCAGGG + Intergenic
1090012325 11:123056324-123056346 CTGGGTGACCACTTGGACCCAGG + Intergenic
1101558773 12:105835811-105835833 CAGGATGACTTCATGGAGAAGGG - Intergenic
1102537018 12:113589228-113589250 CTGGGAGATCTCTTGGAGGATGG + Intergenic
1102781833 12:115572200-115572222 CTGGGTTACTTCATAGAGCAGGG - Intergenic
1102953742 12:117046475-117046497 CTGGAAGGCCTCATGGGGCAGGG - Intronic
1103147789 12:118610486-118610508 CTGGGTGAAGTCATGGGTCAGGG + Intergenic
1103177561 12:118877842-118877864 CTGGGTGAAGTCATGGGACAGGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1105212733 13:18266926-18266948 CTAGCAGACCTCATGGACCAGGG - Intergenic
1106924537 13:34600314-34600336 CTGGGAGGTCTCATGGAGGAAGG - Intergenic
1107857396 13:44629596-44629618 CTGTGTCATCTCATGGAGGAAGG - Intergenic
1113950928 13:114070269-114070291 GTGGGTGCCACCATGGAGCAAGG + Intronic
1114075682 14:19159966-19159988 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1114086479 14:19239606-19239628 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1115705035 14:35989946-35989968 CTGAGTGATCACATGGAGCATGG + Intergenic
1118600810 14:67470463-67470485 CTGGGTGGCCTCAGGGTGGAAGG + Exonic
1119460126 14:74794947-74794969 CTGGGTCACCCCATGAGGCAAGG - Intronic
1121275954 14:92667787-92667809 CTGAATGACCATATGGAGCATGG - Intronic
1121387844 14:93545491-93545513 TTGGGAGACCTCAAGGAGAAAGG - Intronic
1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG + Intergenic
1122076589 14:99238831-99238853 CTGGGTGACCTCAGGCAGGCAGG + Intronic
1122869838 14:104633305-104633327 CTGGGAGCACCCATGGAGCACGG + Intergenic
1202897856 14_GL000194v1_random:20402-20424 CTGGGTGTCCACCTGCAGCATGG - Intergenic
1202898022 14_GL000194v1_random:21225-21247 CTGAGTGCTCTCATGGAGCCTGG - Intergenic
1123935854 15:25193726-25193748 CTTGGTGACCCCATGCAGCCTGG - Intergenic
1124601488 15:31136224-31136246 CTTGGTGACCCCATGGAGCCTGG - Intronic
1126097101 15:45097578-45097600 CTGGGCCAGCCCATGGAGCAGGG - Intronic
1129055721 15:72818687-72818709 GTGGGTGACCACTTGCAGCAGGG - Intergenic
1129343293 15:74900295-74900317 CTGGCTGACCCCATGTAGGAGGG - Exonic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1130982178 15:88820329-88820351 ATGGGGGACTTCATGGAGGAAGG + Intronic
1131133658 15:89916237-89916259 GTGGGTGACATGAAGGAGCAGGG + Intergenic
1132392190 15:101447226-101447248 CTGGGTGCCTTCATGGGGAAGGG + Intronic
1132684281 16:1155806-1155828 CTGGGTGGCCTCATGCAGGTGGG + Intronic
1133342434 16:5045338-5045360 CCGTGTGACCTCATGGCTCATGG + Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1136403347 16:30030207-30030229 CTGGGAGACCTCATCCAGCCCGG - Intronic
1138091064 16:54174980-54175002 CTGAGGGAGCTAATGGAGCAAGG + Intergenic
1138410079 16:56832193-56832215 CTAGCTGACATCATTGAGCATGG + Intronic
1138640061 16:58378388-58378410 CAGGGTGATGTCATGGGGCAGGG + Intronic
1138787460 16:59864332-59864354 CAGGGTGAAGTCATGGAACAGGG - Intergenic
1139326459 16:66156224-66156246 CTGGGTGAAATCATAGAGAAGGG - Intergenic
1139557427 16:67721212-67721234 CTGGGCATCCTCATGGAGGAAGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140973773 16:80039723-80039745 CTGAGTGATCATATGGAGCAGGG - Intergenic
1143662448 17:8334321-8334343 CTGGGTGACAGCATAGAGCAGGG + Intergenic
1144708350 17:17384559-17384581 CCTGGTGACCCCATGGACCATGG - Intergenic
1145057807 17:19714698-19714720 GTGGGTGGCCTCCTGGAGCTGGG - Intronic
1145236914 17:21214647-21214669 CTCGGTGACCTTATGGGCCAAGG - Intergenic
1145302880 17:21653362-21653384 CTGGGTGTCCACTTGGAGCGTGG - Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146653574 17:34622044-34622066 CTGCCAGACATCATGGAGCATGG - Intronic
1148039107 17:44692067-44692089 CTGGGTGCCATCATGGCTCAAGG + Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151572651 17:74935051-74935073 CTCGGGGACCTCCTGGGGCAGGG - Intergenic
1153943540 18:9997610-9997632 ATGGGTGACAACCTGGAGCATGG - Intergenic
1155140169 18:23037779-23037801 CTGGGTGAGGTCATGGGACAGGG - Intergenic
1155659949 18:28237044-28237066 CAAGGTGACAGCATGGAGCAAGG - Intergenic
1156258999 18:35427241-35427263 CTGAGAGACCTCATGGAAAATGG - Intergenic
1157351084 18:46886213-46886235 CTGAGGGGCCTCATGAAGCAGGG + Intronic
1157506945 18:48233256-48233278 CTGTGTCATCTCATGGAGGAAGG - Intronic
1159961160 18:74556753-74556775 ATGGGCGACCTGATGGACCAGGG - Intronic
1160722728 19:604495-604517 CTGGGTGGGGTCAAGGAGCAGGG + Intronic
1162353571 19:10166467-10166489 CTGGATGGCCCCATGGAGCCTGG + Intronic
1164778010 19:30869432-30869454 GTGGCTGTCCTCAGGGAGCAAGG - Intergenic
1165313726 19:35042459-35042481 CTGGCTGACCTCCTGGGCCAGGG - Exonic
1165722389 19:38088789-38088811 CTGGAAGACCACAAGGAGCACGG + Exonic
1167078265 19:47262172-47262194 CTGAGTGACATCATGGAGCAGGG - Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168680891 19:58314999-58315021 GTGGATAACCTCAAGGAGCACGG - Exonic
925201018 2:1967910-1967932 CTGTGTGTCCTCAGGGAGCCTGG + Intronic
925807705 2:7667624-7667646 CTGGGTTAAGTCATGGAGGAAGG - Intergenic
925854557 2:8117069-8117091 CCCGGTTACCTAATGGAGCAGGG + Intergenic
926096872 2:10087052-10087074 CAAGCTGTCCTCATGGAGCAGGG + Intergenic
927177778 2:20422448-20422470 CTGGGAGCCATCATGGATCAAGG - Intergenic
927514109 2:23661922-23661944 CTGGCTGTCCCCTTGGAGCATGG - Intronic
929585753 2:43113304-43113326 TTGGGTGGCCTCATTGAGAAGGG - Intergenic
931872927 2:66481113-66481135 CTGGGTGCCCTCCTGCTGCAGGG - Intronic
934721453 2:96579849-96579871 CTCAGTGAGCTCATGAAGCAGGG - Intergenic
937124896 2:119468323-119468345 CTGTGTGACACCATGGAGCTTGG - Intronic
938490274 2:131757465-131757487 CTGAGTGCCCTCATGGAGCCTGG + Intronic
938752046 2:134341743-134341765 CTGGCTGAGCTCAAGGAGTAAGG + Exonic
942378976 2:175367752-175367774 CTGAGTGACTTCACGAAGCATGG - Intergenic
944280845 2:197894826-197894848 CTGGGTCACCTCCTGAACCATGG + Intronic
946456679 2:219832182-219832204 CAAGGTGACCTCATGCATCATGG + Intergenic
947603597 2:231469399-231469421 CTGGGGGACCTGGTGGAGCTGGG - Intronic
948912050 2:241009710-241009732 CAGGGTGACTTCCTGGAGGAGGG - Intronic
948925296 2:241092472-241092494 CTAGGTGATCTCATAGAACAGGG - Exonic
1170174992 20:13459119-13459141 CTAGTTGACTTCATGGTGCATGG + Intronic
1172003041 20:31795558-31795580 CCGGGTGATCACTTGGAGCAGGG - Intronic
1172594695 20:36142683-36142705 CTGGGTGGCCTGATGGGGCTGGG + Intronic
1174463547 20:50699787-50699809 CTGGGTGAGCACATGGACCCTGG + Intergenic
1174944027 20:54964826-54964848 CTGGGAGAACTCCTGCAGCAAGG - Intergenic
1175158167 20:56988283-56988305 CTGGGTGACCTCAGGAAGCTGGG - Intergenic
1176617540 21:9036391-9036413 CTGGGTGTCCACCTGCAGCATGG - Intergenic
1176707441 21:10126455-10126477 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1176707606 21:10127279-10127301 CTGGGTGTCCACCTGCAGCATGG + Intergenic
1178053264 21:28770702-28770724 CTGTGTGATCTCATGGTGGAAGG - Intergenic
1178408821 21:32347449-32347471 CAGGGTGACCTCACGGAGCTGGG + Exonic
1179115518 21:38488227-38488249 CTGGGTCACCTCATGTTGAAGGG - Intronic
1180077053 21:45468287-45468309 CTGGGTGACCTGCTGGGGCGGGG - Exonic
1180291384 22:10853132-10853154 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1180494189 22:15882554-15882576 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1180815550 22:18787250-18787272 CTAGCAGACCTCATGGATCAGGG - Intergenic
1181201740 22:21221585-21221607 CTAGCAGACCTCATGGATCAGGG - Intronic
1181425263 22:22833090-22833112 CCGGGTGGCCTCATGGAAGATGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181700016 22:24615386-24615408 CTAGCAGACCTCATGGACCAGGG + Intronic
1183665465 22:39243753-39243775 CTGGGTGACCTCTTCGGGCTGGG - Intronic
1184535582 22:45084578-45084600 ATGAGAGACCCCATGGAGCAGGG + Intergenic
1184973764 22:48046465-48046487 CTGGGTGACTCCAAGGACCAGGG + Intergenic
1185082728 22:48718676-48718698 CTGGTTGACCTCACGGGGCCGGG - Intronic
1203225174 22_KI270731v1_random:73843-73865 CTAGCAGACCTCATGGATCAGGG + Intergenic
1203265653 22_KI270734v1_random:12941-12963 CTAGCAGACCTCATGGATCAGGG - Intergenic
949696280 3:6699660-6699682 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696292 3:6699739-6699761 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696305 3:6699818-6699840 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696318 3:6699897-6699919 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696331 3:6699976-6699998 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696344 3:6700055-6700077 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696357 3:6700134-6700156 CTGGGTGCTTTCATGGACCAGGG - Intergenic
952237922 3:31499296-31499318 CTGGGTTTCTGCATGGAGCATGG - Intergenic
953373960 3:42413115-42413137 CTAGGAGCCCTCATGGTGCAGGG + Intergenic
953917259 3:46927931-46927953 CTGGGAGAGGTCAAGGAGCATGG + Intronic
954634106 3:52062360-52062382 CTTGGTGACCTCATGGGAGATGG - Intergenic
955251516 3:57287612-57287634 CAGAATTACCTCATGGAGCAGGG - Intronic
957049592 3:75401235-75401257 CTTGGGTAACTCATGGAGCAAGG + Intergenic
958492289 3:94792637-94792659 CAGGATGACATCATGGAGCAGGG - Intergenic
959495551 3:107046979-107047001 CTGTGGGACCACATTGAGCAAGG + Intergenic
961881907 3:130067673-130067695 CTTGGGTAACTCATGGAGCAAGG + Intergenic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962920086 3:139942803-139942825 CTAGGTGACATCTTGGACCATGG + Intronic
963007774 3:140741884-140741906 CTGGGAGACCTCAGGGCACATGG - Intergenic
964096030 3:152932863-152932885 CTGTATGACCTCCTGGAGCAGGG + Intergenic
967342783 3:188419059-188419081 CTGGGAGACCTCATAGAACTTGG - Intronic
968603978 4:1522844-1522866 CAGGGTGCCCACATGGGGCAGGG + Intergenic
968725785 4:2247261-2247283 CTGGGAGGCCTGACGGAGCACGG - Intergenic
969694965 4:8729272-8729294 CAGGGGGACCTCATGGAGAGGGG + Intergenic
969989019 4:11241315-11241337 CTGGTGGACCTCATAGAGAAAGG - Intergenic
970089733 4:12391415-12391437 TTGTGTGACCTCATGGAACTAGG + Intergenic
972734427 4:41826830-41826852 CTTGGTGGCCTCGTGGAGCTGGG - Intergenic
976522533 4:86045728-86045750 CTGAGTGACTTAATGGAGAAGGG - Intronic
977984942 4:103372186-103372208 CAGGGTGAAGTCATGGGGCAGGG + Intergenic
978328900 4:107590124-107590146 CTGGGAGACTCCATGGTGCATGG + Intergenic
982320549 4:154072688-154072710 CTGGGTGAGCTTTTGGGGCAGGG + Intergenic
983619005 4:169740067-169740089 GTGGGTGACATCCTGAAGCATGG + Intronic
985008713 4:185560531-185560553 CTGGGAGACCTGAAGGTGCAGGG - Intergenic
987225081 5:15831683-15831705 CAGGCTGCTCTCATGGAGCATGG + Intronic
990868186 5:60402640-60402662 CTGGGTGCCCTTATGCAGCAAGG - Intronic
992492421 5:77258341-77258363 CAGAGTGAACTGATGGAGCATGG + Intronic
995310248 5:110702386-110702408 CTGAGTGGCCTTAAGGAGCATGG - Intronic
999183842 5:149690736-149690758 CTGGGTGACCTGAGTGAGTAGGG - Intergenic
999321695 5:150619207-150619229 GTTGCTGACCTCATGGAGCTTGG + Intronic
999644689 5:153706027-153706049 CTGGGAGCCTTCATGCAGCAAGG + Exonic
1001323942 5:170706054-170706076 CTTGGTGAGCTCAGAGAGCATGG - Intronic
1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG + Exonic
1003371679 6:5533734-5533756 CTGGGAGACCTCACTGAGAAGGG + Intronic
1007109459 6:39304535-39304557 CTGGGGCATCTCATGCAGCAGGG - Exonic
1007732216 6:43954198-43954220 CTGGGTCTCCTCATGGGGCAGGG + Intergenic
1011415620 6:87117094-87117116 CTGAGTGACTACGTGGAGCAGGG - Intergenic
1013610910 6:111794111-111794133 CCGGGTGTCCTCATGGCGGATGG - Intronic
1013980780 6:116126173-116126195 CAGGGTAACCTCATGTAGTAAGG - Intronic
1016320527 6:142839640-142839662 CCTGGTGAACTCAGGGAGCATGG - Intronic
1019256492 7:55805-55827 GTGGGTCAGCTCATGAAGCAGGG - Intergenic
1019300333 7:299909-299931 CGGGGTGCCCTCACGGGGCAGGG - Intergenic
1022019350 7:26383480-26383502 CTGGGCGGCCCCCTGGAGCAGGG - Intergenic
1024316022 7:48017488-48017510 TTGGGTGACATCATGGAAAATGG + Intronic
1024951150 7:54861610-54861632 CTGAGTGACATCATGGAAGAGGG - Intergenic
1031489365 7:122368532-122368554 CTGGGTGGCCTCATGTTTCAAGG - Intronic
1034329123 7:150267828-150267850 ATGGGTGCCTTCCTGGAGCAGGG + Intronic
1034524320 7:151647190-151647212 CTAGGTGACAGCATTGAGCAGGG + Intronic
1034668933 7:152842032-152842054 ATGGGTGCCTTCCTGGAGCAGGG - Intronic
1035604242 8:919280-919302 CTAGGTGCCCTCATGGTGCTGGG + Intergenic
1036944899 8:13086166-13086188 CTTGGTGACTTCATGAAGAATGG - Intronic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1037472276 8:19222555-19222577 CACGGGGACCTCCTGGAGCAAGG + Intergenic
1037766635 8:21776199-21776221 CTGGGTGACCACATGCAGTGGGG - Intronic
1038398295 8:27262967-27262989 CTGGGGACCCTCATGGAGCCTGG + Intergenic
1038484130 8:27921632-27921654 CTCGGTGACCGCGTTGAGCATGG + Exonic
1040386653 8:46918900-46918922 CTGGGTGAGCTCCAGGAGCAGGG - Intergenic
1040592394 8:48805581-48805603 CAGTGTGTCCTCATGGGGCAGGG - Intergenic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1043490175 8:80740915-80740937 TTGGGTGGCTTGATGGAGCAAGG - Intronic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1049251925 8:141593872-141593894 CTGGGTAGCCTCCTTGAGCAGGG + Intergenic
1049307687 8:141914535-141914557 CTGGGTGGTCTCTAGGAGCAGGG + Intergenic
1049931738 9:463866-463888 CTGGGAGAGGTCAAGGAGCAGGG - Intronic
1053644635 9:40113193-40113215 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1053644803 9:40114016-40114038 CTGGGTGTCCACCTGCAGCATGG + Intergenic
1053761182 9:41350835-41350857 CTGGGTGTCCACCTGCAGCATGG - Intergenic
1053761347 9:41351658-41351680 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1054325658 9:63711073-63711095 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1054325824 9:63711896-63711918 CTGGGTGTCCACCTGCAGCATGG + Intergenic
1054350121 9:64013203-64013225 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1054539773 9:66261953-66261975 CTGGGTGTCCACCTGCAGCATGG - Intergenic
1054539941 9:66262776-66262798 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1059237319 9:112771970-112771992 CTGGTTCAAGTCATGGAGCAGGG + Intronic
1060068857 9:120529189-120529211 CTTGGTTTCTTCATGGAGCAGGG - Intronic
1061291675 9:129653888-129653910 CTGGGTGATTTGATGGGGCAGGG + Intergenic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1202792189 9_KI270719v1_random:95335-95357 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1202792352 9_KI270719v1_random:96159-96181 CTGGGTGTCCACCTGCAGCATGG + Intergenic
1185933412 X:4228773-4228795 CTGGCTGGTCTCATGGAGCTTGG + Intergenic
1190487600 X:50943247-50943269 CTGTAAGACCTCATGTAGCAGGG - Intergenic
1194020293 X:88681839-88681861 CAGGGTGAGCTGATAGAGCACGG + Intergenic
1195247257 X:103005721-103005743 CTTGGTGACCTGATGGAGACTGG + Intergenic
1195614999 X:106905162-106905184 CTGGGTGACTTCAAAGGGCAGGG + Intronic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1198217175 X:134566282-134566304 CTGGCTACTCTCATGGAGCAGGG + Exonic
1201151091 Y:11096052-11096074 CTGAGTGCTCTCATGGAGCCTGG - Intergenic