ID: 1136053914

View in Genome Browser
Species Human (GRCh38)
Location 16:27673697-27673719
Sequence GGATGTCCCCTGGAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136053908_1136053914 12 Left 1136053908 16:27673662-27673684 CCCAGTTGTGATCAAAAAAATCT 0: 1
1: 1
2: 0
3: 22
4: 272
Right 1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 203
1136053906_1136053914 14 Left 1136053906 16:27673660-27673682 CCCCCAGTTGTGATCAAAAAAAT 0: 1
1: 1
2: 6
3: 29
4: 253
Right 1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 203
1136053904_1136053914 30 Left 1136053904 16:27673644-27673666 CCAATAGGACACCTCTCCCCCAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 203
1136053907_1136053914 13 Left 1136053907 16:27673661-27673683 CCCCAGTTGTGATCAAAAAAATC 0: 1
1: 1
2: 1
3: 19
4: 216
Right 1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 203
1136053905_1136053914 19 Left 1136053905 16:27673655-27673677 CCTCTCCCCCAGTTGTGATCAAA 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 203
1136053909_1136053914 11 Left 1136053909 16:27673663-27673685 CCAGTTGTGATCAAAAAAATCTC 0: 1
1: 1
2: 3
3: 31
4: 226
Right 1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136053914 Original CRISPR GGATGTCCCCTGGAGTTGGG TGG Intronic
900539697 1:3196642-3196664 GAATGTGGCCTGGAATTGGGTGG - Intronic
900744843 1:4354034-4354056 TGAGGTTCCCTGGAGTTTGGAGG + Intergenic
900798931 1:4726003-4726025 CCATGACCCCTGGAGGTGGGAGG - Intronic
903262713 1:22139971-22139993 GGATGGAGCCTGGAGCTGGGAGG - Intronic
903461662 1:23524978-23525000 GGAAGTCCCCTGGGTCTGGGCGG - Intronic
904463736 1:30695631-30695653 GAATGTCCTCTGGGGGTGGGTGG - Intergenic
905338366 1:37260762-37260784 TGATGTCCCCTGCCGTGGGGTGG + Intergenic
908183851 1:61632908-61632930 TGATGTCCCATGGGATTGGGAGG - Intergenic
909343780 1:74561585-74561607 AGAAGTCCCCTTGACTTGGGTGG + Intergenic
915305338 1:154974100-154974122 GGGAGCCCCCTGAAGTTGGGAGG + Intronic
915311916 1:155009282-155009304 GGGTGTCCTCTGGGGCTGGGGGG + Intronic
921893871 1:220379357-220379379 GGTTTTCCCCTGGAGTTGGGCGG + Intergenic
922203182 1:223424208-223424230 GGGTGTCTCCTGAAGGTGGGAGG + Intergenic
922801379 1:228366220-228366242 GGATGGCCCCAGGAGCTGGGGGG + Intronic
924057879 1:240141863-240141885 GGAAGTCCTCAGAAGTTGGGTGG + Intronic
1064833692 10:19501047-19501069 GTATGTGCCTTGGAGTTGGGAGG + Intronic
1065739524 10:28784563-28784585 GAATGTCCCATGGGATTGGGGGG - Intergenic
1065771940 10:29085927-29085949 AAATGTCCCCTGGAATTGAGTGG + Intergenic
1066475010 10:35738412-35738434 GTCTGCCCCCTGGATTTGGGAGG + Intergenic
1069931909 10:71888755-71888777 GCAAGTCCGCTGGAGGTGGGAGG + Intergenic
1069958207 10:72064269-72064291 GACTGTCCCCTGGTGCTGGGGGG + Intronic
1074942020 10:118245419-118245441 GGCTTACCCATGGAGTTGGGAGG - Intergenic
1075641791 10:124069982-124070004 GCATGTCCCCAGGAAATGGGCGG - Intronic
1075937580 10:126356179-126356201 GGAGGTTCCCTGGGGTTAGGTGG - Intronic
1076822068 10:132944345-132944367 GGATGATCCCTGGAGGAGGGTGG + Intergenic
1076842854 10:133055009-133055031 GGAAGCCTCCTGGGGTTGGGGGG + Intergenic
1077327147 11:1968834-1968856 GCATGTCCCCTGGAGGGGGCAGG + Intronic
1077669683 11:4146035-4146057 GGACTTCCTCAGGAGTTGGGAGG + Intergenic
1077886963 11:6393774-6393796 TGTTGTCCCATGGAGTGGGGAGG + Intronic
1078118465 11:8480526-8480548 GAATTTACCCTGGAGTGGGGAGG + Intronic
1079678925 11:23267649-23267671 GGAGGTCACTTGGAGTTGGAGGG - Intergenic
1081620224 11:44614986-44615008 GGAACTGCCCTGGAGGTGGGAGG + Intronic
1084362432 11:68677635-68677657 GGCTGACGCCTGCAGTTGGGAGG - Intergenic
1084463504 11:69309096-69309118 GGAGGTCCCGTGGGGGTGGGTGG + Intronic
1085529275 11:77182063-77182085 GGTTGTCCCCTGGAAGTAGGTGG - Exonic
1089013611 11:115149119-115149141 GGCTGCCCCATAGAGTTGGGAGG - Intergenic
1089555368 11:119313010-119313032 GGTTGTCCACTGGGGTTGGCAGG + Intronic
1091239297 11:134041901-134041923 GGATGACCACTGGACTGGGGAGG - Intergenic
1202810129 11_KI270721v1_random:24014-24036 GCATGTCCCCTGGAGGGGGCAGG + Intergenic
1091835689 12:3583979-3584001 AGGTGTGCCCTGGAGGTGGGAGG + Intronic
1092231143 12:6775918-6775940 GGAAGTGGCCTGGATTTGGGAGG + Intronic
1096821024 12:54234447-54234469 TGATGTCCCCTGGCATTGGCAGG - Exonic
1100018568 12:90042300-90042322 TTCTGTCCCTTGGAGTTGGGAGG - Intergenic
1100220544 12:92500403-92500425 AGATGTACCCTGGTGTTGAGTGG + Intergenic
1102589967 12:113949639-113949661 GCAAATTCCCTGGAGTTGGGAGG - Intronic
1102977518 12:117217262-117217284 GGATCGCCCCTGGAGCTAGGTGG - Intronic
1104043102 12:125143411-125143433 AGCTGTGCCCTGGAGTTGTGTGG + Intergenic
1104703311 12:130923786-130923808 GGATGTCCCCAGGACTTACGTGG + Intergenic
1104844574 12:131840424-131840446 GGATGACTCCTGGCGTGGGGAGG + Intronic
1105202161 13:18190184-18190206 GGATGTCCCCTGGGGTTCTCAGG - Intergenic
1108527478 13:51298202-51298224 AGATGTCCCATGGAGTAGGACGG + Intergenic
1109132956 13:58611375-58611397 AGTTTTCCCCTGGAGTTGGGTGG - Intergenic
1118740445 14:68735785-68735807 GAAGCTCCCCTGGACTTGGGTGG - Intergenic
1119387279 14:74265607-74265629 GGATGCCCCCTGGGCTTGAGAGG - Intergenic
1119477653 14:74940376-74940398 GGATGTCCAGCGGAGTGGGGTGG - Intergenic
1120211909 14:81641717-81641739 GGTCTTCCCCTGGAGTCGGGCGG + Intergenic
1122209530 14:100165898-100165920 GGAGGCCCCCTGAAGTGGGGTGG + Intergenic
1125118640 15:36125679-36125701 GGATGCCCCACGGAGTTTGGTGG - Intergenic
1126292781 15:47100131-47100153 GTATGCTCCCTGGAGTTGGCAGG - Intergenic
1126704775 15:51397088-51397110 GGGTGTCCCCTGGAGGAGAGTGG + Intronic
1131832968 15:96366018-96366040 GGATGTCCCCTGAACTAGGCCGG + Intergenic
1133573288 16:7063295-7063317 GGTGGTCCCCTGGGGTTGGGGGG - Intronic
1134475736 16:14572055-14572077 GGAAGTCCCATGGAGGAGGGAGG + Intronic
1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG + Intronic
1138335000 16:56246064-56246086 GGCTGACCCAGGGAGTTGGGAGG - Intronic
1139170875 16:64627995-64628017 GGTTTTCCCCTGGAGTGTGGCGG - Intergenic
1139948883 16:70659770-70659792 GGATGGCGCCTGGGGGTGGGAGG + Intronic
1141809449 16:86365182-86365204 TGATGTCACCTGGGGGTGGGTGG - Intergenic
1141909232 16:87047219-87047241 GGAAGGTCTCTGGAGTTGGGTGG + Intergenic
1142144035 16:88485254-88485276 GCCTGTCCCCTGGTGCTGGGGGG + Intronic
1142217967 16:88839125-88839147 GAGTGTCCCCTGTGGTTGGGCGG - Intronic
1142244506 16:88963476-88963498 TGATGTGCTCTGGAGTTAGGTGG - Intronic
1143131285 17:4679114-4679136 GGAGATCCCCTGAAGCTGGGAGG - Intronic
1143380880 17:6495699-6495721 GGAAGACCCCTGGAGTTTTGAGG + Intronic
1146455398 17:33005546-33005568 GGCTGCCCCCTGGAGTGGGAAGG + Intergenic
1146543848 17:33721130-33721152 GGTGGTCCCCTGGTGTTGTGTGG + Intronic
1146724727 17:35147926-35147948 GGGTGTGCCCTGGACTGGGGAGG + Intronic
1148684443 17:49493461-49493483 GGCTGTCCCCTGGACTTTGTGGG + Intergenic
1149454524 17:56777144-56777166 GAATGTGGCCTGGAGTAGGGTGG - Intergenic
1149657526 17:58318181-58318203 TGGGGTCCCCAGGAGTTGGGTGG - Intronic
1150291122 17:63983018-63983040 GGATGTGCCCTGGAGTTAACAGG - Intergenic
1151555494 17:74844500-74844522 GTGTCTCTCCTGGAGTTGGGGGG + Exonic
1152067475 17:78119474-78119496 GGATGTCCCCTGGCTGGGGGCGG - Intronic
1152691335 17:81719455-81719477 GGAAGCCCCATGGAGTTGGCGGG - Intronic
1154349226 18:13569187-13569209 GGAAGGCCCCAGGAGTGGGGAGG - Intronic
1156162362 18:34374503-34374525 GCCTGTCCCATGGAGGTGGGAGG + Intergenic
1157781233 18:50441013-50441035 GGAGCTCCCCTGGATCTGGGAGG + Intergenic
1159079892 18:63725080-63725102 GGATGTCACCTGGAAGTGTGGGG + Intronic
1159516861 18:69470030-69470052 CAATTTCCCCTGGAGATGGGTGG - Intronic
1159951640 18:74488421-74488443 GGAGGTCCCCTGGATTAGGATGG + Intergenic
1160784307 19:892560-892582 GGATGGACCCTGGAGATTGGGGG - Intronic
1161027081 19:2041755-2041777 GCAGGTCCCCTGGGGTTAGGGGG + Intronic
1161362401 19:3858133-3858155 TGACGTCCCCTTGAGTTTGGTGG - Intronic
1162836047 19:13318628-13318650 GGATGGGGGCTGGAGTTGGGTGG + Intronic
1165273775 19:34732006-34732028 GGAGGTGCCCTGGGGTTGGTGGG - Intergenic
1166935319 19:46329158-46329180 GGATGAGCCTTGGACTTGGGTGG - Intronic
1167163816 19:47784538-47784560 AGTTGTCCCCTGGAGTTTGGGGG + Exonic
1168361440 19:55744246-55744268 GGGTGTCCCCTAGAGCAGGGAGG - Intergenic
926119531 2:10234644-10234666 GAACAGCCCCTGGAGTTGGGTGG + Intergenic
926725914 2:15997795-15997817 GGATATTCCTTGTAGTTGGGTGG - Intergenic
928042420 2:27891146-27891168 AGACGTCCCCTAGAGTGGGGTGG + Intronic
929666068 2:43834803-43834825 GGAGTTCCCCTGGAGTTGGATGG + Intronic
932346964 2:71001811-71001833 TGATGGCCCCTGTAGTTGGCAGG + Intergenic
932738921 2:74276851-74276873 GGATGGTCCCTTGAGTAGGGTGG + Intronic
933462897 2:82612115-82612137 GGTCTTCCCCTGGAGTTTGGTGG - Intergenic
934562556 2:95320736-95320758 ATGTGTCCCCTGGAGTTTGGGGG - Intronic
934653929 2:96107730-96107752 GGAGGGGCACTGGAGTTGGGGGG - Intergenic
934902557 2:98172265-98172287 GGTTTTCCCCTGGAGTCAGGCGG + Intronic
935620578 2:105126135-105126157 GGAGCCCCTCTGGAGTTGGGAGG - Intergenic
936399232 2:112153374-112153396 GGATGACCCCTAGACTTGGAGGG - Intronic
937635133 2:124146954-124146976 GGATGTTGGCTGGGGTTGGGGGG + Intronic
937840394 2:126519034-126519056 GGTCTTCCCCTGGAGTTTGGTGG - Intergenic
944612109 2:201421553-201421575 AGATGTCCCCTGGGGTGGGGGGG + Intronic
945254122 2:207789860-207789882 GCCTGACCCCTGGGGTTGGGGGG + Intergenic
946236313 2:218326635-218326657 TGATGTGGCCTGGAGTTGGGTGG + Intronic
947705747 2:232274096-232274118 TCATGTCCCCTGGAGATGCGAGG - Intronic
948151358 2:235747399-235747421 GGGTGGCCTCTGGGGTTGGGAGG + Intronic
1170073680 20:12396106-12396128 TCATGCCCCCTGGAGTTGTGTGG - Intergenic
1170816993 20:19721882-19721904 GGGCGTCCCCTGGGGTTGGGGGG + Exonic
1171536596 20:25898463-25898485 GTATGCTCCCTGGAGTTGGCAGG + Intergenic
1171839538 20:30193728-30193750 GTATGCTCCCTGGAGTTGGCAGG + Intergenic
1172515004 20:35527337-35527359 GGTTGTCCCTGGGAGCTGGGAGG + Intronic
1172873287 20:38148874-38148896 GAAGGGCCCCTGGAGGTGGGTGG - Intronic
1173363588 20:42366033-42366055 GGAAGTCCCCTGGAGCAGGAGGG - Intronic
1174224640 20:48987086-48987108 GGCTGTCCCCAGGAGGTGGCAGG + Intronic
1175159983 20:57001121-57001143 GTTTGTGCTCTGGAGTTGGGTGG - Intergenic
1175253361 20:57623014-57623036 GCATGGGCCCTGGAGATGGGGGG - Intergenic
1175347806 20:58294772-58294794 TGATGTCCCCTGGGGGTGGGGGG + Intergenic
1175592016 20:60200704-60200726 GGAGGTCCCCTTGCCTTGGGTGG + Intergenic
1175889004 20:62307837-62307859 TGCTGTCGCCTGGAGCTGGGTGG + Intronic
1177757579 21:25366347-25366369 GGATCTTCCCTGGGGTTGGCAGG - Intergenic
1178199823 21:30390877-30390899 GGTTTTGCCCTGGAGTCGGGTGG - Intronic
1179090532 21:38261163-38261185 GGAGCTGCCCTGGTGTTGGGCGG + Intronic
1180876281 22:19176685-19176707 GGTTGTCCCCTGGATATAGGAGG + Exonic
1180918582 22:19506477-19506499 GGGAGTTCCCAGGAGTTGGGAGG + Intronic
1182356346 22:29723879-29723901 GGATGTCCCTTGGAGTCTGCTGG + Intronic
1183329555 22:37212065-37212087 GGATGTGTCCTGGAGATGGGGGG - Exonic
1184993692 22:48187277-48187299 GGATGTAGTCTGGGGTTGGGAGG - Intergenic
1185052587 22:48561657-48561679 GGATCTCCAGTGGGGTTGGGGGG - Intronic
1185112161 22:48906110-48906132 AGAAGTCAACTGGAGTTGGGAGG - Intergenic
1185296340 22:50057115-50057137 GGATGAGGTCTGGAGTTGGGAGG + Intergenic
1185368529 22:50447845-50447867 GGATGCTCCCTGGAGTCTGGAGG - Intronic
951805039 3:26634591-26634613 GGCTGTTCCCTTGAGATGGGGGG + Intronic
951811178 3:26701709-26701731 ACATGACCCCTGGAGTTGGGAGG - Intronic
952110738 3:30121381-30121403 GAATGTCCTCTGGAGTTAAGTGG + Intergenic
954751657 3:52817494-52817516 GGATGTCCCTTGGCTTTGAGCGG + Intronic
955205962 3:56896035-56896057 TGATGCCCTCTGGAGTTGTGTGG + Intronic
955558145 3:60159818-60159840 GCATGTTCCCTGGAGTTAGAGGG - Intronic
956908789 3:73795312-73795334 GGATCTCCAGTGGAGTTTGGGGG - Intergenic
958939796 3:100299109-100299131 GGATCTCACATGGAATTGGGAGG - Intronic
960978676 3:123201784-123201806 GGAGGGCCCCGGGAGCTGGGGGG + Intronic
961821783 3:129578969-129578991 GGGTGTCCCCTGGAGACCGGTGG - Intronic
962775349 3:138653829-138653851 GGAGGCCCCCTGGACTTTGGTGG - Exonic
963785055 3:149526040-149526062 GGAAGTCCTCCGGAGTTGTGGGG + Exonic
964507043 3:157410954-157410976 GCATGTCACCTGGATTTGGGTGG - Intronic
968622718 4:1610958-1610980 GGCTGTGCCCTGGAGCAGGGTGG - Intergenic
969533550 4:7742101-7742123 GGGTGGCCTCTGGAGTGGGGAGG - Exonic
971382940 4:26116514-26116536 GGAAGTCCCCTGGAGATATGTGG + Intergenic
972480456 4:39491436-39491458 GGGTGTCCCCAGGAGGTTGGAGG + Intergenic
973530450 4:51832551-51832573 GGAGGCTCCCTGGACTTGGGAGG + Intergenic
986543378 5:8870407-8870429 TGGTCTCCCCTGGAGTTGGGCGG + Intergenic
986744475 5:10731556-10731578 GGAGGTCTCCTGGAGTAGTGGGG - Intronic
990614495 5:57493607-57493629 TGATGCCCACTGGAGTTGTGTGG + Intergenic
993694801 5:91048512-91048534 GTGTGTCCCCTGGAGCTGAGGGG - Intronic
994279719 5:97886584-97886606 GGTTGTACCCTGCAGTTGGAGGG - Intergenic
996603013 5:125288741-125288763 CGAGGTGCCCTGGAGTGGGGTGG - Intergenic
997270164 5:132529737-132529759 GAATGTTCCCTTCAGTTGGGTGG - Intergenic
997699508 5:135886905-135886927 GTCTGTGCCTTGGAGTTGGGGGG + Intronic
998401456 5:141850942-141850964 GGCTGTCTCCGGGTGTTGGGAGG - Intergenic
998467323 5:142356704-142356726 GGAGCTGCCCTGGGGTTGGGGGG + Intergenic
1001087024 5:168707865-168707887 GGCTGTCCCTTGGAGAAGGGAGG + Intronic
1001809273 5:174614913-174614935 GGCTTTCCCCTGGAGCTAGGGGG - Intergenic
1003938000 6:10995458-10995480 GGATCTCCCATGGGCTTGGGTGG + Intronic
1005029286 6:21494009-21494031 GGTTTTCCCTTGGAGTCGGGCGG - Intergenic
1005168654 6:22955866-22955888 GCATGGCCCCTGGAGTGGGAAGG + Intergenic
1005886023 6:30098369-30098391 GGATTTCCCCAGGAGTGGAGTGG + Intergenic
1006750464 6:36373570-36373592 GGACGTCACCTGGAGGTGGGTGG + Exonic
1007172948 6:39877361-39877383 TCATGTTCCCTGAAGTTGGGAGG - Intronic
1007404920 6:41629639-41629661 AAATGTCCCCTGGCCTTGGGGGG - Intergenic
1007655926 6:43450904-43450926 GGGTGTCCACTGTGGTTGGGGGG + Exonic
1008265882 6:49425772-49425794 GGTGGTCCCCTGGAGCTGGGAGG - Intergenic
1013479807 6:110543888-110543910 GGATGTCCCCTGAATATGGTGGG + Intergenic
1013757000 6:113473539-113473561 GGTGGTTCCCTGGAGCTGGGGGG - Intergenic
1017592119 6:155989368-155989390 GGCTCTCACCTGGAGTTGGATGG - Intergenic
1018059393 6:160078818-160078840 GGAGGTGCCCTGGAATTGAGAGG + Intronic
1018412099 6:163560446-163560468 GGATGGCCCCTGGAGAAGGAAGG + Intronic
1019289842 7:245101-245123 GGATGCTCCCAGGAGTTGGGCGG + Intronic
1019868596 7:3737156-3737178 GGCTGTGCCCTGCAGTCGGGTGG + Intronic
1022535091 7:31093585-31093607 GGTTGTCCCCTGTGGTTGGCTGG + Intronic
1028606698 7:92663274-92663296 GGAGGTGCCCTGGAGTGGGAAGG + Intronic
1029310657 7:99660470-99660492 GGATGACCCCTGGAGATGAAGGG - Intronic
1030101791 7:105953180-105953202 AGTTTTCCCCTGGAGTTAGGTGG - Intronic
1032957006 7:136983699-136983721 GCATGTCCGCTGGAGTTTGCTGG + Intronic
1033286873 7:140049114-140049136 GGAAGTCCCATGGAGGAGGGTGG + Intronic
1034395906 7:150824825-150824847 GGAGGGCCCCGGGAGTGGGGTGG - Intronic
1035383780 7:158457267-158457289 GGATGTTCATTGGAGTTAGGAGG - Intronic
1035643714 8:1202558-1202580 GGAATTCCCCAGGAGATGGGAGG + Intergenic
1036924500 8:12891587-12891609 AGTTGTCCCCTGGAGGTGGTTGG - Intergenic
1037404380 8:18525865-18525887 GCCTGTCCTCTGGAGGTGGGGGG - Intergenic
1037407054 8:18554138-18554160 GCCTGTCCCCAGGAGGTGGGGGG - Intronic
1039306338 8:36267369-36267391 TGATGTTCCCTGGACTTTGGAGG + Intergenic
1040023751 8:42763262-42763284 TGACATCCCCTGGAGTTGTGCGG + Intronic
1040802506 8:51358756-51358778 GCCTGTCCCCTGGGGTTGTGGGG - Intronic
1041292556 8:56320630-56320652 GGAAGTCCCCGGGAAGTGGGTGG + Exonic
1041500780 8:58535872-58535894 GGATGTCCCCTGGAGTTAAGGGG - Intergenic
1042084846 8:65095848-65095870 GGATGGCCCCTGCAGTGGGTTGG - Intergenic
1047667877 8:127112181-127112203 GGGTATCCCTTGCAGTTGGGTGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1053044881 9:34907243-34907265 GAATGGACCCAGGAGTTGGGAGG - Intergenic
1053131008 9:35615727-35615749 GGATGAGCCTTGGAGCTGGGTGG + Intronic
1055750783 9:79502529-79502551 AAATGTCCCCTGTAGTTGGGTGG - Intergenic
1056885096 9:90433996-90434018 AGATTTCCCATGGAGCTGGGTGG - Intergenic
1056963161 9:91144325-91144347 GAATGTCCTTTAGAGTTGGGAGG + Intergenic
1059042608 9:110830586-110830608 GGTTTTCTCCTGGAGTTGAGGGG + Intergenic
1060201713 9:121655231-121655253 GCATGTCCCATGGATTTGGGGGG + Intronic
1061063192 9:128261086-128261108 GAATGCCCCAGGGAGTTGGGTGG - Intronic
1061880678 9:133567426-133567448 GGCTGTCCCTTGGATGTGGGTGG + Intronic
1062335243 9:136062255-136062277 GGTGGTCCCTTGGCGTTGGGGGG - Intronic
1185603946 X:1356360-1356382 GGATGTCCACGGGGGTGGGGGGG - Intronic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1190556140 X:51637508-51637530 GGCTGCCCTCTGCAGTTGGGTGG + Intergenic
1194535675 X:95103572-95103594 GGTTTTCCCCTGGAGTCAGGTGG + Intergenic
1196258887 X:113554775-113554797 GATTTTCCCCTGGAGTCGGGCGG + Intergenic
1196624273 X:117860288-117860310 AGATGTCCCCTGAAGTTTTGTGG - Intergenic
1199735760 X:150685423-150685445 AGATGTCAGCTGGAGTTAGGGGG - Intergenic