ID: 1136059833

View in Genome Browser
Species Human (GRCh38)
Location 16:27718889-27718911
Sequence CAGCTGCGGTGGAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136059833_1136059841 1 Left 1136059833 16:27718889-27718911 CCCTTTGTCCTCCACCGCAGCTG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1136059841 16:27718913-27718935 AGCCTGGGCCTTCCATCTCCTGG 0: 1
1: 1
2: 0
3: 24
4: 294
1136059833_1136059844 3 Left 1136059833 16:27718889-27718911 CCCTTTGTCCTCCACCGCAGCTG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1136059844 16:27718915-27718937 CCTGGGCCTTCCATCTCCTGGGG 0: 1
1: 0
2: 4
3: 34
4: 323
1136059833_1136059842 2 Left 1136059833 16:27718889-27718911 CCCTTTGTCCTCCACCGCAGCTG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1136059842 16:27718914-27718936 GCCTGGGCCTTCCATCTCCTGGG 0: 1
1: 0
2: 4
3: 39
4: 399
1136059833_1136059845 4 Left 1136059833 16:27718889-27718911 CCCTTTGTCCTCCACCGCAGCTG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1136059845 16:27718916-27718938 CTGGGCCTTCCATCTCCTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136059833 Original CRISPR CAGCTGCGGTGGAGGACAAA GGG (reversed) Intronic
900160269 1:1220000-1220022 GAGCTGCGGTGGAGCAGACAGGG - Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
903197788 1:21705458-21705480 CAGCAGCGGGGGAAGAGAAAGGG + Intronic
904264896 1:29312687-29312709 CACCTGCAGTGGATGACAATGGG - Exonic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
906535862 1:46550626-46550648 CAGCTGCTGTGGAGGCAAACAGG + Intronic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
910193837 1:84621000-84621022 CCTCTCCGGTGGAGGACAGAAGG - Intergenic
913676086 1:121141905-121141927 CAGCAGTGGTGGAGTAAAAAAGG - Intergenic
914027979 1:143929849-143929871 CAGCAGTGGTGGAGTAAAAAAGG - Intergenic
914314315 1:146495511-146495533 CAGCTGAGGTGAAGGATATAGGG + Intergenic
914500033 1:148237870-148237892 CAGCTGAGGTGAAGGATATAGGG - Intergenic
914747465 1:150510775-150510797 AATCTGGGGTGGAGGAGAAAGGG - Intronic
915472650 1:156135167-156135189 CAGCTGGAGGGGAGGACAAAGGG - Exonic
917101869 1:171454575-171454597 AAGCTGAGGTGGAAGACATAAGG - Intergenic
917965796 1:180177756-180177778 CCGCTGGGGTGGAGGAAAAGAGG - Intronic
919100786 1:193094860-193094882 CATCAGAGGTGGAGGAAAAATGG - Intergenic
919149601 1:193678914-193678936 CAATTGCGGTGGAAGGCAAAGGG - Intergenic
920257295 1:204664288-204664310 CAGCTGCAGAGGAGGAATAAAGG - Intronic
920546303 1:206821650-206821672 CTGCTGCAGTGGAAGACAATAGG - Intronic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921622110 1:217336707-217336729 AAACTGAGGTGGAGGAGAAACGG - Intergenic
923006567 1:230054536-230054558 CAGCTGTGGTGGAGGAGGATAGG - Intergenic
923550123 1:234957211-234957233 CAGCTGTGGGGAAGAACAAAAGG - Intergenic
924368342 1:243320460-243320482 CAGCAGCCTTGGAGGGCAAAAGG - Intronic
924510270 1:244724205-244724227 CAGCTGCTGTGGAAAACAGAAGG + Intergenic
1065022971 10:21516346-21516368 CAGCGGCGGCGGAGGCCAGATGG + Exonic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1067062927 10:43087221-43087243 CAGCTGAGGAGGAGGAGAGATGG - Intronic
1069172733 10:65254154-65254176 CAACTGCTGCGGAGGCCAAAGGG - Intergenic
1070931462 10:80264011-80264033 CAGCTGAGGTGGGGTATAAAGGG + Intergenic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1072675340 10:97461535-97461557 CAGCAGCGGTGGAAGAAAAGGGG + Exonic
1072676236 10:97468428-97468450 GAGCTGGGGAGGAGGCCAAATGG + Intronic
1073248252 10:102106663-102106685 CAGCTGGAGTGGAGGAAATACGG + Intergenic
1074819553 10:117168159-117168181 CAGCCCCGGGGGAGGACGAAAGG - Intergenic
1074963337 10:118467475-118467497 CAGCAGCGGTGTTAGACAAAGGG - Intergenic
1077082376 11:729791-729813 CAGCTGTGGGGGAGGACAGAAGG - Intergenic
1078687859 11:13549709-13549731 CAGCCACTGTGGGGGACAAAGGG + Intergenic
1079504125 11:21133960-21133982 CAGCTGCAGTGGAGGAGGCATGG - Intronic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1080333718 11:31172789-31172811 AAGCTGAGGAGGAGGACAAGAGG + Intronic
1083019354 11:59490554-59490576 ATGCTGCTGTGGAGGTCAAAAGG - Intergenic
1087920881 11:103864816-103864838 CAGCTGCAGTGGAGCACCACTGG + Intergenic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1089729551 11:120511792-120511814 CTGCTGCGGAAGAGGAAAAACGG + Exonic
1092994875 12:13940409-13940431 GAGATGAGTTGGAGGACAAACGG - Intronic
1094655383 12:32414563-32414585 CAGCTGGGGAGGAGGGGAAATGG - Intronic
1095389786 12:41692202-41692224 CAGTTGTGGTGGAAGGCAAAGGG - Intergenic
1096229045 12:49887437-49887459 CACCTGCGGCAGAGGAAAAATGG + Exonic
1101801692 12:108027962-108027984 CAGCTGAGTAGCAGGACAAATGG - Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1103104193 12:118208618-118208640 CAACTGCTTTGAAGGACAAATGG + Intronic
1104829199 12:131737080-131737102 CATCCTCGGTGGAGGACTAATGG + Intronic
1106009842 13:25809489-25809511 CAGCAGGGGTGGATCACAAAGGG - Intronic
1110162305 13:72393114-72393136 CAGCTGTGGTGGAGCAGAGATGG - Intergenic
1110287985 13:73772401-73772423 CAGCTGCAGTGGCAGATAAACGG + Intronic
1111468982 13:88651713-88651735 CAGTTGTGGTGGAAGGCAAAGGG + Intergenic
1115143245 14:30198037-30198059 CAGTTATGGTGGAAGACAAAAGG - Intergenic
1116941767 14:50797956-50797978 GAGCTGGGGTGGAGGAAAGAAGG + Intronic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1120071740 14:80111097-80111119 CAGCTGGGGAGCAGGACACATGG + Intergenic
1125119244 15:36133547-36133569 CAAGTGCAGTGGAGGACATAAGG - Intergenic
1125895628 15:43299490-43299512 CAGCTAGGGTGGATGAAAAATGG + Intronic
1129670591 15:77605754-77605776 CAGCTGCCCTGCAGGAGAAAGGG + Intergenic
1130202397 15:81844106-81844128 CCACTGCAGTGGAGGACAGAGGG + Intergenic
1131260045 15:90883478-90883500 CAGCTGCGATGCAGGAGCAACGG - Intergenic
1132137877 15:99361410-99361432 CAGCTGAGGTGAAGGCCATAGGG + Exonic
1132658847 16:1052734-1052756 CAGCTGTGGTGGAGGAGGGAGGG + Intergenic
1133065668 16:3205029-3205051 CAGCTGAGTGGGAGGACAGAGGG - Exonic
1133234777 16:4382694-4382716 CAGCAGCGGCTCAGGACAAAGGG + Exonic
1134856866 16:17527334-17527356 GAGCTGCTGTGGAGGAAACAAGG - Intergenic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1136091074 16:27920465-27920487 CAGCCATGGTGGAGGACAGAAGG - Intronic
1136747952 16:32608618-32608640 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1137518881 16:49174705-49174727 CAGCTGGGATGGAGACCAAATGG - Intergenic
1138474539 16:57263105-57263127 CAGCTGGGAGGGAGGACACAGGG - Intronic
1138475091 16:57265923-57265945 AAGCTGAGGTGGAGGATCAATGG + Intronic
1142144540 16:88487433-88487455 GAGCTGGGGTGGAGGAGAGATGG + Intronic
1203050089 16_KI270728v1_random:867825-867847 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1143426354 17:6842286-6842308 CAGCTGCTGTGCTTGACAAATGG - Intergenic
1144100787 17:11940488-11940510 CTGCTGGGGTAGAAGACAAATGG - Intronic
1145747796 17:27332950-27332972 CATCTTCGGTGGAGGAGAAAGGG + Intergenic
1147477738 17:40729429-40729451 CAGCTACTAGGGAGGACAAAGGG - Intergenic
1149457690 17:56801635-56801657 CAGCTGGGGTAGAGGGCAGATGG + Intronic
1149961863 17:61118439-61118461 CAGTTTTGGTGCAGGACAAATGG - Intronic
1154026865 18:10716191-10716213 CAGCAGAGGTGGAGGAGAGAAGG - Intronic
1159022556 18:63155498-63155520 CTGCTGGGGTGGAGGCCACAGGG + Intronic
1159279781 18:66270481-66270503 CAGCAGCAGTGGTGGACAGATGG + Intergenic
1163016406 19:14458143-14458165 GAGCTGCGTTGGAGGACAGCAGG + Intronic
1163191421 19:15679562-15679584 CAGCTGTGGTCGAGGACACTTGG + Intronic
1164702549 19:30296202-30296224 CAGCTGCAGTGGAGGTGGAAGGG + Intronic
1166902723 19:46078281-46078303 CAGCTGCTGTGGAAAACAATGGG + Intergenic
1168283756 19:55320453-55320475 CAGATGCTGGGGAAGACAAAGGG + Exonic
1168341077 19:55623403-55623425 TAACTAGGGTGGAGGACAAAAGG - Intronic
926962846 2:18377879-18377901 CAGTTGGGGAGGAGCACAAATGG + Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929772011 2:44900351-44900373 CAGCTGGGGTAGAGGACTCAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932617021 2:73239097-73239119 CAGCTGCAGTGTAGGAAAACAGG - Intronic
933199235 2:79430054-79430076 CAGAAGCGGAGGAGGACAAGTGG + Intronic
933207743 2:79528323-79528345 CAGCTACTGTGGAGACCAAAGGG - Intronic
935449171 2:103189761-103189783 CAGCTGATGTGGAGCCCAAAAGG + Intergenic
936456877 2:112682001-112682023 AAGGTGTGGTGGAGGCCAAAAGG - Intergenic
938081457 2:128372526-128372548 CAGCTCCAGAGGAGGAAAAAGGG - Intergenic
938297295 2:130186120-130186142 AATCTGGGGTGGAGGACATAAGG + Intronic
938335420 2:130491306-130491328 CAGCTGCATTGAAGGACAACAGG - Intronic
938354404 2:130629361-130629383 CAGCTGCATTGAAGGACAACAGG + Intronic
938369800 2:130762037-130762059 CAGCTGCTGTGGAGGAAAGCAGG - Exonic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938430825 2:131236144-131236166 CAGCTGCATTGAAGGACAACAGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
947855830 2:233323896-233323918 CAGATGCTGTGGAGAACAAGAGG + Intronic
948658720 2:239493297-239493319 CAGTTGTGGTGGAAGGCAAACGG + Intergenic
948791415 2:240379311-240379333 CATCTGCTGTGGATGCCAAATGG - Intergenic
1168749215 20:270474-270496 CAGCTGCAGTGCAGGCCCAAGGG + Intergenic
1170531003 20:17291614-17291636 CAATTGCTGTGGAGGACAATTGG - Intronic
1171447310 20:25214041-25214063 CAGCTGCCATGGGGAACAAACGG - Intronic
1173416059 20:42856916-42856938 CAGCTGGGGTGCAGTAAAAAGGG + Intronic
1175935713 20:62513019-62513041 CAGCTGAGGAGGAGGACAACGGG - Intergenic
1182736395 22:32534391-32534413 AAGAGGCTGTGGAGGACAAAGGG + Intronic
1183087256 22:35493989-35494011 CAGCTGGGGAGGAGGAGAAGTGG - Intergenic
1183363400 22:37394576-37394598 GAGCTGCGGGGGAGGACTCACGG - Intronic
952848385 3:37707984-37708006 GAGCTGCTGTGAAGAACAAATGG - Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
954201269 3:49024745-49024767 CTGGTGCTGTGCAGGACAAAGGG - Exonic
958072565 3:88633387-88633409 CAACTATGGTGGAAGACAAAGGG + Intergenic
962001658 3:131304891-131304913 CAGCTGGGGTGGAGCACCATTGG + Intronic
963348004 3:144119024-144119046 CAAATGCTGTGGAGCACAAAAGG + Intergenic
966714358 3:183000697-183000719 CAGCTGATGTGGAGCCCAAAAGG - Intergenic
967888248 3:194347456-194347478 CAGCTGAGCTGGAGCCCAAATGG - Intronic
969582237 4:8072137-8072159 CCTCTGCTGTGGAGGAGAAAGGG - Intronic
971597772 4:28553917-28553939 CAACTGTGGTGGAAGGCAAAGGG + Intergenic
971983493 4:33787998-33788020 CAGCTGCATGGGAGGACCAAAGG + Intergenic
973788388 4:54356450-54356472 CAGCTGCCTTGGATGTCAAATGG - Intergenic
975361672 4:73477605-73477627 CAGCTGATGTGTAGGCCAAAGGG - Intergenic
979166560 4:117539850-117539872 CAGCTGCTGTGCAGGAGAAAAGG + Intergenic
981179803 4:141727267-141727289 AAACTGGGGTGGAGAACAAAGGG + Intronic
981566881 4:146111219-146111241 GAGCTGGGGTGGAGAACAACTGG + Intergenic
982204301 4:152985496-152985518 GAGCTGGGGTGGAGGACGACTGG - Intergenic
983432049 4:167663073-167663095 AAGCTGCGGTGAGGGAGAAAGGG - Intergenic
985800684 5:2003862-2003884 CAGCTGAGGCGGAGGAAAGAGGG + Intergenic
988771938 5:34440966-34440988 CTGCTCAGGTGGAGGACAAAGGG + Intergenic
991300192 5:65122160-65122182 CAACAGCGGTGGATGACACATGG - Intergenic
991339186 5:65587233-65587255 AGGCTGTGTTGGAGGACAAATGG - Exonic
992856494 5:80867013-80867035 CAGATGAGCAGGAGGACAAAGGG - Intronic
995187897 5:109290558-109290580 CAGCTGATGTGGAGCCCAAAGGG + Intergenic
996764678 5:127023918-127023940 CACCTGCATTGGATGACAAAAGG + Intronic
997336624 5:133113278-133113300 CAGGAGAGGTGGAGGAGAAAGGG + Intergenic
1000552100 5:162679729-162679751 CACCAGGGGTGAAGGACAAAGGG - Intergenic
1001210812 5:169808536-169808558 CAGCTCAGGTGAAGGATAAAAGG + Intronic
1001310006 5:170603763-170603785 CAGCTGAGGCTGAGGACACATGG + Intronic
1001987974 5:176091946-176091968 CAGCTGTGGTGGACGATGAATGG - Intronic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1001989173 5:176101974-176101996 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001989842 5:176107298-176107320 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001990154 5:176109861-176109883 CAGCTGTGGTGGACGATGAATGG - Intronic
1001998121 5:176178384-176178406 CAGCTGCCATGGAGGATGAAAGG + Intergenic
1001998320 5:176179903-176179925 CAGCTGTAGTGGAGGATGAATGG + Intergenic
1002226717 5:177728278-177728300 CAGCTGTGGTGGACGATGAATGG + Intronic
1002227029 5:177730840-177730862 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227697 5:177736164-177736186 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1002228896 5:177746194-177746216 CAGCTGTGGTGGACGATGAATGG + Intronic
1002266449 5:178037589-178037611 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002267119 5:178042934-178042956 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002649904 5:180683761-180683783 CAGCTGAGGTGGAGGATGAATGG - Intergenic
1002662853 5:180803077-180803099 CAGCTGCGCTGGAGGGCCGAGGG - Intronic
1002756226 6:162881-162903 CAGAAGCTGTGGAGGAGAAATGG + Intergenic
1004673584 6:17820337-17820359 CAGCTACGGTGGAGGTCTAGGGG + Intronic
1005009367 6:21321485-21321507 CAGGTCCGGTGGAGGACAGGTGG + Intergenic
1006618344 6:35344730-35344752 GAGCTGCGGTGGAGAGCCAAAGG + Intronic
1008065508 6:47043646-47043668 CAGCTGGTGTGGAAGACAAGTGG - Intergenic
1011347082 6:86381959-86381981 CACCTGCGGGGAAGGAAAAAAGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012602353 6:101114019-101114041 CAGCTTCTGTTGATGACAAATGG + Intergenic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1019486509 7:1291962-1291984 CAACTGCTGGGGAGGACAACTGG - Intergenic
1019559082 7:1647050-1647072 CATCCGGGGTGGAGGACAGATGG + Intergenic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1019664709 7:2246024-2246046 CAGCTGGGGAGGAGGACCACTGG + Intronic
1019716808 7:2542884-2542906 AAGCTGCGGTGGGGGACAGGTGG + Intronic
1020442930 7:8238218-8238240 CAGCTGCTGTGGAAAACAATAGG - Intronic
1021033321 7:15765788-15765810 CAGCGGAGGTGAATGACAAAGGG - Intergenic
1023311772 7:38894843-38894865 CAGCTGATGAGGAGGAGAAAGGG - Intronic
1024107452 7:46107716-46107738 AAGCTGAGCTGCAGGACAAAGGG + Intergenic
1024633038 7:51264766-51264788 CAGCTGAGGTAGAGGGCAAGTGG + Intronic
1031460347 7:122040960-122040982 CACCTGCAGTGGACGACAACAGG - Exonic
1031880989 7:127198465-127198487 CAGCTGCTGGGAAGGCCAAATGG + Intronic
1031944451 7:127824864-127824886 CATCTGAGGTGGAAGACAATGGG - Intronic
1032074073 7:128828028-128828050 GAGCTGCTGGGGAGGAGAAAGGG - Intergenic
1032558474 7:132862548-132862570 TGGCTGCGGTGGTGGCCAAATGG + Intronic
1033612976 7:142984003-142984025 CAGCTGGGGTGGGGGACAGTGGG + Intergenic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036775730 8:11611847-11611869 GGGCTGCGGGGGAGGAGAAATGG + Intergenic
1041195940 8:55401423-55401445 CAGCTAAGGCTGAGGACAAAGGG + Intronic
1044281873 8:90365941-90365963 CAGATGCTGTGGAGGAAAAATGG - Intergenic
1045476557 8:102557624-102557646 CAGCTTCTGTGGAGGTCAAGAGG + Intronic
1046523907 8:115359706-115359728 GAGCTGCTGTTGAGGCCAAAGGG - Intergenic
1048442623 8:134471001-134471023 TAGCTGCGGTGGAGACCATATGG + Intergenic
1049099040 8:140566298-140566320 CAGTCATGGTGGAGGACAAAAGG - Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1058619767 9:106870715-106870737 CAGCTTGGTTGGAGCACAAAAGG + Intronic
1059875443 9:118629265-118629287 CAGCAGCAGTGGTGGAAAAAGGG + Intergenic
1062103596 9:134740789-134740811 CAGCTGCCGTGGAGGAGCCAAGG + Intronic
1187527013 X:20063438-20063460 GAGCTGCTGTGGAAGAGAAAAGG - Exonic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1188450266 X:30301407-30301429 CAGCTGGGATGGAAGAGAAAGGG - Intergenic
1188580124 X:31701658-31701680 CAGGTGGGGTGTAGGACCAAAGG - Intronic
1190713828 X:53087989-53088011 TAGCTGAGGAGGAGGGCAAATGG - Exonic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1192427788 X:71092704-71092726 TAGCTGGGGTGAAGGAAAAAGGG + Intergenic
1195971717 X:110480538-110480560 CAGCTGCAGGGGAGCACAGACGG - Intergenic
1196199007 X:112864360-112864382 CTGCTGAGGTGGGGGACAAGGGG + Intergenic
1200278566 X:154757453-154757475 CACCTGCTGTGCAGGCCAAACGG - Intergenic