ID: 1136060844

View in Genome Browser
Species Human (GRCh38)
Location 16:27725381-27725403
Sequence GTTCCAGATCTTTCTCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136060844_1136060849 3 Left 1136060844 16:27725381-27725403 CCGTCCTGAGAAAGATCTGGAAC 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1136060849 16:27725407-27725429 CTTTCTGGTTCATCGAGGAAAGG 0: 1
1: 0
2: 1
3: 7
4: 124
1136060844_1136060847 -2 Left 1136060844 16:27725381-27725403 CCGTCCTGAGAAAGATCTGGAAC 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1136060847 16:27725402-27725424 ACCTTCTTTCTGGTTCATCGAGG 0: 1
1: 0
2: 1
3: 14
4: 109
1136060844_1136060850 4 Left 1136060844 16:27725381-27725403 CCGTCCTGAGAAAGATCTGGAAC 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1136060850 16:27725408-27725430 TTTCTGGTTCATCGAGGAAAGGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136060844 Original CRISPR GTTCCAGATCTTTCTCAGGA CGG (reversed) Intronic
900834216 1:4987654-4987676 CTTCCAGATCTTTTAGAGGAAGG - Intergenic
905068298 1:35203125-35203147 ATATCAGATCTTTGTCAGGAAGG + Intergenic
905250964 1:36648060-36648082 GTTCCAGGTCTTCCTCAGGTTGG - Intergenic
910649039 1:89544643-89544665 TTTGCAGATCTCTCGCAGGATGG + Intronic
912565232 1:110582773-110582795 GTCCCAGACCTTTCTCAGCTTGG + Intergenic
914342969 1:146776061-146776083 GCTCCAGACTTTTCTCAGCAGGG + Intergenic
915037888 1:152943843-152943865 GGTCCTGGTCTTTCTCAGGTTGG + Intergenic
918116259 1:181500570-181500592 GCTCCAGATCTGTCTTCGGATGG + Intronic
920050142 1:203159500-203159522 GTCCCAGATCTTTCCCTGGCTGG + Intronic
920544072 1:206801055-206801077 GATCCAGTGCTTTCTGAGGAAGG - Intronic
1063037934 10:2306280-2306302 ATTCCAGCTCTTTCTCCAGATGG + Intergenic
1065126476 10:22579017-22579039 GCCCCAGATTTTTCTCACGATGG + Intronic
1067715015 10:48684413-48684435 GTTCAAGTTCTATCTGAGGATGG + Intergenic
1067968763 10:50944481-50944503 CTTCTAGATCATTCTCAAGATGG - Intergenic
1068714526 10:60173930-60173952 ATTCCAGATCCTTCTCTAGATGG + Intronic
1068869671 10:61929461-61929483 GTTCATGTTCTTTCTCTGGAGGG + Intronic
1069718287 10:70534473-70534495 GATCCAGAGCTTTCTCCGCATGG + Exonic
1070069552 10:73073786-73073808 TCACCAGATCTTTCTCAGTATGG + Exonic
1071232431 10:83603898-83603920 GTTCCAGCTCTTGCTAAAGAGGG - Intergenic
1073690678 10:105805670-105805692 TTTGAAGATCTTTCTGAGGAGGG - Intergenic
1074449488 10:113547634-113547656 GATCCAGAACTTTCTGTGGATGG + Intergenic
1074880852 10:117656933-117656955 GTTCCTCATCTTTCACAGCAAGG - Intergenic
1077779170 11:5306137-5306159 GGCCCAGATCTTTCCCAGGTTGG - Intronic
1077805090 11:5582250-5582272 GTTCAACATCTTTCTCATGACGG + Intronic
1077979637 11:7286726-7286748 GTTCCAGAGCTTTCTGGGGCAGG + Intronic
1078367437 11:10718427-10718449 CTTCCATATCTTTCTCACAACGG + Intergenic
1078435142 11:11318522-11318544 GTTCGAGATCGGTCTCAGCAGGG - Intronic
1079148083 11:17872268-17872290 GTTCTATATCTTGCTCTGGATGG + Intronic
1079530048 11:21440865-21440887 GTTGCAGACTTTTCTCAGGCAGG - Intronic
1080599735 11:33809817-33809839 CTTCTAGAGCTTTCTCAGGTCGG - Intergenic
1081240258 11:40696929-40696951 TTTCCAGATTTTTCTCAGTTTGG - Intronic
1084056555 11:66637864-66637886 GCTCCAGTTTTTTCTCAGGGTGG + Intronic
1084422141 11:69065811-69065833 TTTACAGATGTTTCTCAGGTCGG + Intronic
1085318820 11:75562176-75562198 TTTCCAGAAGTTTCTCGGGACGG + Intronic
1087537706 11:99471557-99471579 GTTTCACAACTTTCTCAAGATGG - Intronic
1091325664 11:134685177-134685199 GCTCCAGCGCTTTCTGAGGAGGG + Intergenic
1099223030 12:79935898-79935920 GCTCCATCTCTTTCTAAGGAGGG + Intergenic
1100660493 12:96692979-96693001 TCTCCACATCTTTCTCTGGATGG + Intronic
1103290213 12:119839467-119839489 GTTCCTGATCTTTGGCATGAGGG + Intronic
1106218157 13:27721501-27721523 TTCCCAGATCTTTCTCACGGAGG - Intergenic
1106971418 13:35146081-35146103 TTTCCAGATCTTACTTTGGAAGG + Intronic
1108320996 13:49290482-49290504 TTTCCAGATCTACCTCTGGAAGG + Intronic
1108880936 13:55114889-55114911 ATTCCAGAAATGTCTCAGGAAGG - Intergenic
1112211004 13:97376983-97377005 GTTAAAGCACTTTCTCAGGAAGG - Intronic
1116778124 14:49204872-49204894 GTTCCAGATCTTCCTCACCTGGG + Intergenic
1118850768 14:69581652-69581674 GTTCCTGGTCATACTCAGGAAGG - Intergenic
1120501752 14:85306230-85306252 GTAGCAGAGCTCTCTCAGGAAGG - Intergenic
1124816342 15:32997711-32997733 GTTCTAGAACATTTTCAGGAAGG - Intronic
1127905777 15:63374707-63374729 GTGTCAGATCTTTCTCTGGACGG + Intronic
1128420669 15:67488906-67488928 GTACCAGATCTGTCTCAGACAGG - Intronic
1132281890 15:100625061-100625083 GTTTCCCATCTTTCTCATGAAGG - Intronic
1135678054 16:24434021-24434043 GCTCCAGATCTTCCTTAGAAAGG - Intergenic
1136060844 16:27725381-27725403 GTTCCAGATCTTTCTCAGGACGG - Intronic
1136596335 16:31252754-31252776 TTCCCACAACTTTCTCAGGAGGG + Intergenic
1138446250 16:57066053-57066075 GTTCCAGAATTTTCTGAGGGAGG - Intronic
1139756138 16:69145219-69145241 CTTCCAAATCTCTCTCTGGATGG + Intronic
1144253857 17:13446037-13446059 GTTTCACATGTTTCTCAGGCTGG + Intergenic
1144668696 17:17119138-17119160 GCTCCAGAGTTTTCTCAGGAAGG - Intronic
1149522906 17:57331551-57331573 CTTTCAGATCTCGCTCAGGAGGG - Intronic
1150772900 17:68056575-68056597 GTTCCATGTCTTTATCTGGATGG - Intergenic
1151031999 17:70752148-70752170 TTTCTAAAACTTTCTCAGGATGG - Intergenic
1151588833 17:75029762-75029784 GTTCCAGCAGTTTCTCAGCATGG - Intergenic
1151952861 17:77364756-77364778 GCTCCAGAGCTTTCTCCAGAGGG - Intronic
1154966634 18:21364403-21364425 GTTCCTTGTCTTTCACAGGAGGG - Intronic
1155223838 18:23710427-23710449 GTTGAAGAACTTTCTCAGGGAGG - Intronic
1155552676 18:26982548-26982570 GTTCCAGACCTTACTGGGGACGG + Intronic
1155936539 18:31760665-31760687 GCTTAAGATCTTTCTCATGAAGG + Exonic
1157951698 18:52045681-52045703 TTTCCAGAGCTTTCTCATGTTGG + Intergenic
1158358300 18:56644378-56644400 TTTCCAGAACCTTCTCATGAAGG + Intronic
1160498025 18:79386537-79386559 GGTCCACATCTTCCCCAGGAGGG + Intergenic
1161035303 19:2081214-2081236 GGTCCAGATCATTCTCTGGTGGG - Intronic
1161159305 19:2753037-2753059 GGGCCAGATCATTCTCTGGAGGG + Intergenic
1163596237 19:18222534-18222556 GTTCCAGATCTTCCTCAAAGTGG + Intronic
1168332159 19:55577169-55577191 ATTCCAGCTCTTTCAGAGGAAGG + Intergenic
925958648 2:8994445-8994467 CATCCAGTTCTTTCTTAGGAAGG - Intronic
927461451 2:23301959-23301981 CTTCCAGATCTTTCTTCTGAAGG - Intergenic
930459117 2:51648145-51648167 GTATCTGATCTTTCTCAGGAAGG + Intergenic
932104327 2:68928803-68928825 GTGCTGGCTCTTTCTCAGGAGGG - Intergenic
933538361 2:83606500-83606522 GTTGAAGGTCTTTATCAGGAAGG - Intergenic
940789809 2:158020307-158020329 GTTCCAGCTCTTTCTTCAGAAGG + Intronic
944170910 2:196776486-196776508 CTTCCAGAGCTTTCTCAGGCTGG + Exonic
946054369 2:216888068-216888090 TTTCCAACTCTTTCCCAGGAGGG + Intergenic
946746711 2:222853677-222853699 GTTACAGATCTATCTCAGAAAGG - Intergenic
946761059 2:222993504-222993526 GTTTCAGTTCTTTCTCACAAAGG + Intergenic
1171049186 20:21839742-21839764 GTTCCTGAACTTTCTATGGAGGG - Intergenic
1172528860 20:35617224-35617246 GTTCAAGAGCTTTCTGAGTACGG + Exonic
1173042952 20:39481999-39482021 ACTGCAGATCTTTTTCAGGATGG - Intergenic
1178572761 21:33755969-33755991 GTTCAAAATTTTTCTCACGAAGG + Intronic
1181443974 22:22954184-22954206 GTTACAGATCTTTATCTGGTGGG - Intergenic
952993708 3:38856074-38856096 GTTCCAGATCTTTCTGCTGGTGG + Intronic
954358380 3:50102519-50102541 GTTACAATTCTTTCTCAAGAGGG - Intronic
955212438 3:56954618-56954640 GTGCCACACCTTGCTCAGGAGGG + Intronic
955617046 3:60820486-60820508 GTGCCAGATTTTTCTCTGGCAGG - Intronic
955775468 3:62427953-62427975 GCTCCAGGTCTTGCCCAGGATGG - Intronic
960543735 3:118888735-118888757 GTTCCAAATCTATCACATGAAGG + Intergenic
960578063 3:119246411-119246433 GTTCCAGATCTTTCTACTGGTGG + Intergenic
962530601 3:136276842-136276864 GTTCCAGATCTTTCCACTGATGG - Intronic
963317024 3:143770660-143770682 GGTTTAGATCTTTCTCAGAAAGG - Intronic
964184173 3:153923041-153923063 GTACCAGATATTTCTAAGTATGG + Intergenic
964636301 3:158861024-158861046 TTTCCAGCTCTTTCTCTGCATGG + Intergenic
967782665 3:193456991-193457013 GTTACAGACCTGTCTCAGGTTGG + Exonic
967928901 3:194675677-194675699 GCTCCACATCTGTCTGAGGAAGG + Intergenic
967966274 3:194962398-194962420 GTTCCAGAACCCTCTCTGGAGGG - Intergenic
968919600 4:3515667-3515689 GTGCCAGATCATTCTGAGGGTGG - Intronic
971293279 4:25365057-25365079 GTTCCAGATCATTCTTGTGAGGG + Exonic
975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG + Intergenic
980029345 4:127808673-127808695 GTCCCAGGTCTCTCTGAGGATGG - Intronic
980197801 4:129614001-129614023 GTTCCAGATCCTATTCAGAATGG - Intergenic
984974348 4:185217400-185217422 GTTCAAGAATATTCTCAGGAGGG + Intronic
986908106 5:12519801-12519823 GTTCCAGAAATCTCTCAGGCAGG + Intergenic
987460780 5:18207037-18207059 GTCCCTGATCTTTCTTGGGATGG + Intergenic
996443342 5:123515262-123515284 GTTTCAGATGTTTTTCAGAATGG + Intronic
1002618221 5:180468558-180468580 TTTCCAGCTTTATCTCAGGAAGG + Intergenic
1003833881 6:10045823-10045845 GTTCCAGAGGTTTCTCATGTAGG - Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1007229533 6:40338627-40338649 GGTCCAGACCTGACTCAGGACGG + Intergenic
1012378815 6:98594801-98594823 CTTCCAGATTTTTTTCAGGGGGG + Intergenic
1014450007 6:121571672-121571694 GTTCCAGAGATTTCTCAAGCAGG - Intergenic
1015141161 6:129933619-129933641 CTTCCAGTTCCTTCTCAGAAGGG - Intergenic
1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG + Intergenic
1019050837 6:169182281-169182303 GTTCCAGAAATCTCTCAGGCAGG + Intergenic
1019656557 7:2199085-2199107 GTTGCGCATCTTTCTCAGGCTGG - Intronic
1023135496 7:37047544-37047566 ATTCCAGATCTTTTTGAGTAAGG + Intronic
1023662964 7:42489516-42489538 GTTCCAAACCTTTTTTAGGAAGG - Intergenic
1024248236 7:47486584-47486606 GGTGCAGATCTTCCTCAGTAAGG + Intronic
1024893312 7:54227280-54227302 GTCCCAGATCTTTCTCCTGGTGG + Intergenic
1024900606 7:54315107-54315129 GTCCCAGATCTTTCTCCTGGTGG - Intergenic
1026587587 7:71669154-71669176 GTTCCTGATTTTGCTTAGGAAGG + Intronic
1028033059 7:85942760-85942782 TTTCCAGTGCTTTCTCAGGCTGG - Intergenic
1030226729 7:107160572-107160594 GTTTCCGTTCTTTCTTAGGATGG + Exonic
1032374708 7:131400625-131400647 GTTTCAGATATTTATCAGTAAGG + Intronic
1033009052 7:137599835-137599857 GTCTTTGATCTTTCTCAGGAAGG - Exonic
1035590693 8:811270-811292 GTTCCTGCTCATTCCCAGGAAGG - Intergenic
1035925396 8:3722459-3722481 GTTTCAGATCTGTCTGAGGTTGG - Intronic
1036506443 8:9360865-9360887 GATCCAAATATTCCTCAGGATGG - Intergenic
1036598752 8:10239949-10239971 ATTCCAGTGCTTTTTCAGGACGG + Intronic
1036727493 8:11232463-11232485 GTTCCAGATGGTTTTGAGGAAGG - Intergenic
1036734622 8:11300112-11300134 GTTCAAATTCTTGCTCAGGAAGG - Exonic
1038608559 8:29036328-29036350 CTTCCAAATCATTATCAGGATGG - Intronic
1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG + Intronic
1040331448 8:46387765-46387787 CTTTCAGAGCTTTCTCAGGCGGG + Intergenic
1043248043 8:78031143-78031165 GTCACACATCTTTCTCAAGATGG + Intergenic
1048411436 8:134178266-134178288 GTCCCAGATTTTTCTCACCAGGG - Intergenic
1048926406 8:139276450-139276472 TCTCCAGATCCTTCTGAGGATGG - Intergenic
1048936438 8:139361448-139361470 GTTTGAGATCTTTGTCTGGAAGG - Intergenic
1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG + Intronic
1056193058 9:84203857-84203879 GTCCCAGGTCTTCATCAGGATGG + Intergenic
1058342999 9:103920975-103920997 GTTCCAGATCTTTCTGCTGGTGG + Intergenic
1059185482 9:112265973-112265995 GTACTAGATCTTTCTGAGCATGG + Intronic
1203454129 Un_GL000219v1:149212-149234 GTTCCACAGATTTCTCAGGCAGG - Intergenic
1189224515 X:39401583-39401605 GGTCCAGGTCTTTCTCTGCAGGG + Intergenic
1189479904 X:41384457-41384479 GTCCCAGGTAATTCTCAGGATGG + Intergenic
1192339373 X:70250431-70250453 GTTACAGAACTTTCTCAGAAAGG + Intergenic
1192627377 X:72744330-72744352 GTTCCTGATATATCTTAGGAAGG - Intergenic
1192654331 X:72976483-72976505 GTTCCTGATATATCTTAGGAAGG + Intergenic
1195499024 X:105572433-105572455 GTTTTAGATCCTTCTGAGGATGG + Intronic
1199282126 X:146014408-146014430 GTTACAGAGGTTTGTCAGGAGGG - Intergenic