ID: 1136061241

View in Genome Browser
Species Human (GRCh38)
Location 16:27728140-27728162
Sequence TGGGGGCCCGGGAAGTATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136061234_1136061241 -1 Left 1136061234 16:27728118-27728140 CCATGGCAGGGTCTGGGCGCTGT 0: 1
1: 0
2: 4
3: 20
4: 254
Right 1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG 0: 1
1: 0
2: 0
3: 6
4: 122
1136061232_1136061241 1 Left 1136061232 16:27728116-27728138 CCCCATGGCAGGGTCTGGGCGCT 0: 1
1: 0
2: 2
3: 20
4: 216
Right 1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG 0: 1
1: 0
2: 0
3: 6
4: 122
1136061233_1136061241 0 Left 1136061233 16:27728117-27728139 CCCATGGCAGGGTCTGGGCGCTG 0: 1
1: 0
2: 2
3: 20
4: 179
Right 1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG 0: 1
1: 0
2: 0
3: 6
4: 122
1136061227_1136061241 14 Left 1136061227 16:27728103-27728125 CCTGATGGCTCTGCCCCATGGCA 0: 1
1: 0
2: 3
3: 23
4: 206
Right 1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG 0: 1
1: 0
2: 0
3: 6
4: 122
1136061223_1136061241 29 Left 1136061223 16:27728088-27728110 CCCGAGTCAGTGCGGCCTGATGG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG 0: 1
1: 0
2: 0
3: 6
4: 122
1136061225_1136061241 28 Left 1136061225 16:27728089-27728111 CCGAGTCAGTGCGGCCTGATGGC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136061241 Original CRISPR TGGGGGCCCGGGAAGTATGA CGG Intronic
906128226 1:43440651-43440673 TGGGGGACTGGGAAGCAGGAGGG - Intronic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
908723290 1:67148690-67148712 TGGGGGACAGGGAAGCAGGAAGG - Intronic
912385623 1:109269894-109269916 AGGGGGCCAGGGAATTAGGAAGG - Intronic
912935627 1:114001782-114001804 TGGGGGCCCAGGAAGGGTGGGGG + Intergenic
915549383 1:156623803-156623825 TGGGGGCCCGGGTGGGATGCTGG - Exonic
916790005 1:168116667-168116689 TGAGTGCCAGGGAAGGATGAAGG - Intronic
917925092 1:179782592-179782614 AGGGTGCCTGGGAAGGATGATGG - Intronic
919936064 1:202251708-202251730 TGGGGGCCAGGGGAGGATGCTGG - Intronic
924230172 1:241956257-241956279 TGGGGGCCAGGGAAGTTTCTTGG + Intergenic
1063421609 10:5916696-5916718 TGGGGGAACGGGAAGTGTTAGGG + Intronic
1063508784 10:6626341-6626363 TGTGGACACGGGAAATATGAAGG + Intergenic
1064739721 10:18420436-18420458 TGGGGACCCAGGAAGGCTGATGG + Intronic
1069841267 10:71340881-71340903 TGCGGTCCAGGGAAGTAAGAGGG + Intronic
1075315180 10:121447555-121447577 TGGGGCATCGGGAGGTATGAAGG + Intergenic
1075975730 10:126692429-126692451 TAGGGGCTTGGGAAGTAAGAAGG + Intergenic
1077303859 11:1859139-1859161 TGGGAACCCAGGAAGTATGCTGG - Intronic
1081660901 11:44887845-44887867 AGGGGGCCTGGGAACTAGGAGGG - Intronic
1084490552 11:69476111-69476133 TCGGGGCCTGGGAAGGTTGAGGG + Intergenic
1085974102 11:81631188-81631210 TGTGGGCTAGGGAAGTATCAAGG - Intergenic
1090381323 11:126329525-126329547 TGAGGGCCTGGGATGTTTGATGG + Intronic
1091761791 12:3092472-3092494 TGGGCCCTCGGGAACTATGAGGG - Intronic
1091773945 12:3172205-3172227 TGGGGGCGGGGGAAGGGTGACGG - Intronic
1094338999 12:29389633-29389655 TGGTGGGCCGGAAAGTATGGCGG + Intergenic
1102497091 12:113327184-113327206 TGGGGGCCAGGGAAGCAGGCGGG + Intronic
1105928986 13:25034270-25034292 TGGCGAGCCGGGAAGAATGAAGG - Intergenic
1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG + Intronic
1112458310 13:99581790-99581812 TGGTGGCCCAGGAAGGGTGATGG + Intergenic
1121236085 14:92392094-92392116 TAGGGCCCCGGGAAGGAGGAAGG - Intronic
1121700599 14:95951205-95951227 TGGAGGCCCGAGAAGTACCAAGG - Intergenic
1121896023 14:97648587-97648609 AGGGGGCCTGGGAAGTAGGGAGG - Intergenic
1122034434 14:98937105-98937127 TGTGGGGCAGGGAAGTAAGAAGG + Intergenic
1127266383 15:57365628-57365650 TGTGGGTCCTGGAAGTATGGTGG - Intergenic
1128082211 15:64863428-64863450 TGGGGGCCGGGGACGGATGTAGG + Intronic
1129198164 15:73983292-73983314 TGGGGCCCAGGGCAGCATGAAGG - Exonic
1130403421 15:83578029-83578051 TGTGGGCTCGGGAATTGTGAAGG + Intronic
1132568516 16:634148-634170 TGGGGCACCTGGAAGGATGAGGG - Intergenic
1133149667 16:3818179-3818201 TGGGGGGCCGGGGAGGAGGACGG + Intronic
1135305196 16:21361911-21361933 TGAGGGCCCAGGAAGCCTGAGGG - Intergenic
1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG + Intronic
1136301940 16:29341076-29341098 TGAGGGCCCAGGAAGCCTGAGGG - Intergenic
1138450217 16:57089414-57089436 TGAGGACCCCGGAAGTGTGAGGG + Intergenic
1139896077 16:70289121-70289143 TGGGGGCACGGGAGGAAGGATGG - Intronic
1140044477 16:71431604-71431626 TGGGCCCCCGGGAAGTTTCAGGG + Intergenic
1142075827 16:88117178-88117200 TGAGGGCCGGGGATGTGTGAGGG + Intronic
1142320240 16:89377488-89377510 TGGGGGGCGGGGAGGGATGAAGG + Intronic
1142400950 16:89858554-89858576 TGGGGGCCAAGGAAGTGAGAAGG + Intronic
1143490966 17:7285033-7285055 TTTGGGCACGGGAAGTAGGAGGG - Intronic
1144632071 17:16879118-16879140 TGAGGGCAGGGGAAGTATGTGGG - Intergenic
1145099939 17:20066501-20066523 AGGGAGACCGGGAAGTATCAGGG - Intronic
1145208942 17:20999068-20999090 TGAGGGCAAGGGAAGTATGTGGG + Intergenic
1147285877 17:39402128-39402150 TGGGTGGCCGGGAAGGATGCGGG - Intronic
1147741755 17:42674181-42674203 TGGGGGCGCGGGGAGAAAGAGGG - Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1149568559 17:57656209-57656231 TGGGGGAACGGGGAGTGTGAGGG - Intronic
1149994497 17:61399624-61399646 TGGGGGCCGGGGCAGGAGGAGGG + Intergenic
1152528268 17:80902126-80902148 TGGGGGCACTGGAAATAGGAGGG - Intronic
1156460715 18:37319932-37319954 TGAGGGCCCAGGTAGTAAGATGG - Intronic
1157240571 18:46005980-46006002 AGGGTGCCCGGGCAGTATGAAGG + Intronic
1160340789 18:78087132-78087154 TGGGGGCCTGGGCAGTGTGGCGG + Intergenic
1160631049 18:80246859-80246881 TGGGGGCCCGGGCCGTGGGATGG - Intronic
1161720195 19:5898069-5898091 TCGGGCCCCGAGAAGGATGAGGG - Intronic
1164894991 19:31867666-31867688 TGGGGGCCCAGAAAGCATAAGGG + Intergenic
1165120645 19:33556461-33556483 TGGGGGCCAGGGAGGTACAAGGG + Intergenic
1165438160 19:35808119-35808141 TAGGGGCCGAGGAAGCATGAAGG - Intronic
1165972163 19:39640586-39640608 TGTGGGGCCTGGAAGTGTGAGGG + Intergenic
1166670557 19:44707268-44707290 TGGGGACCCTGGAAGTTAGAGGG - Intronic
1167375522 19:49108868-49108890 TGGGGGGCTGGGAATTAGGAGGG + Intergenic
1168136034 19:54352374-54352396 TGGGGGCCCGTGCAGCAGGAGGG + Exonic
926440826 2:12886809-12886831 TGTTGGCCCTGGATGTATGAGGG + Intergenic
932713688 2:74086161-74086183 TGTGGGCAGGGGAAGGATGAGGG - Intronic
934475356 2:94589864-94589886 TGGGGGAGAGGGAAGTATCAAGG - Intronic
942403519 2:175628738-175628760 TGGAGACCCAGGAAGTCTGAAGG - Intergenic
943060494 2:183037935-183037957 GGCGGGCCCGGGAGGGATGAAGG - Intronic
944488871 2:200236963-200236985 TGTGGGTCCGTGAAGTTTGAAGG + Intergenic
948895460 2:240924966-240924988 TGGGGGCCGGGTCAGTGTGAGGG - Intronic
948993247 2:241565019-241565041 TGGGGGCCAGGGAGGGCTGAGGG + Intronic
1172581233 20:36050578-36050600 TGGTGGGCCGGGAAGTATGGCGG - Intergenic
1175768565 20:61608071-61608093 TGGGGGCGAGGGGAGAATGATGG - Intronic
1180079330 21:45479759-45479781 CTGGGGCCCGGAAAGTACGAGGG - Intronic
1183600220 22:38835665-38835687 TGGGGGCCCGGAAGGTGTGTGGG - Intronic
950061110 3:10071691-10071713 TGGGGGACTGGGAAAAATGAGGG + Intronic
952945939 3:38477957-38477979 TGGGGGCCCGGAAGGTAAGGGGG + Exonic
954146400 3:48636422-48636444 TGGGGGCTGGGGAGGTAGGATGG - Intergenic
958593464 3:96190316-96190338 TGGGCCCCCAGGAAGTGTGATGG - Intergenic
960632393 3:119745230-119745252 TGGAGGCTGGGGAAGTAGGATGG - Intronic
968629480 4:1642647-1642669 TGGGGGCCCGGGAGTGCTGAGGG - Intronic
969617994 4:8264956-8264978 TTGGGGCCCGGGAGGGATGGAGG + Intergenic
971346368 4:25815287-25815309 TGGGGGCCCCAGAAGTCTAACGG + Intronic
977330251 4:95628597-95628619 TGGGGGACCAGGAAAGATGAGGG + Intergenic
985098346 4:186433923-186433945 TGGGGCCTTAGGAAGTATGATGG - Intronic
985098418 4:186434334-186434356 TGGGGCCTTAGGAAGTATGATGG - Intronic
985098505 4:186434841-186434863 TGGGGCCTTAGGAAGTATGATGG - Intronic
986054259 5:4120106-4120128 TGGGGGCCAAGGCAGGATGATGG - Intergenic
986773496 5:10994333-10994355 CGGGGGCCGGGGAAGGAGGAGGG + Intronic
987132611 5:14872402-14872424 TAGCGGCCCGGGAGGTATGGAGG + Intergenic
987989334 5:25190644-25190666 TGGTGGGCCGGGAAGTATGGCGG - Intergenic
992793871 5:80238158-80238180 TGGGGGGCGGGGAGGAATGAGGG - Intronic
993647331 5:90476710-90476732 AGGGGGACCTGGAAGTGTGAAGG - Intronic
994981215 5:106876489-106876511 TGGGTCCCCGGCAAGCATGAAGG - Intergenic
995851643 5:116552590-116552612 AAGCGGCCCGGGCAGTATGAAGG + Intronic
997361837 5:133300144-133300166 TGGAGGCCCGGGATGCAGGATGG + Intronic
1023835628 7:44065688-44065710 TGGGGGCCAGGGGAGTGTGCAGG + Intronic
1024242733 7:47448015-47448037 TGGGGGCCCTGGCAGAAGGAGGG + Intronic
1026257742 7:68727060-68727082 AAGGGCCCCAGGAAGTATGAAGG - Intergenic
1028173666 7:87628711-87628733 TGGGGGCGCGGGAAGGATGTAGG - Exonic
1029482063 7:100819448-100819470 TGGGTACCCCGGAAGTGTGAGGG - Intronic
1030122578 7:106124463-106124485 TGAATGCCTGGGAAGTATGATGG + Intergenic
1030247934 7:107405955-107405977 TGGAGGCTGGGGAAGTCTGAAGG - Intronic
1033139039 7:138808771-138808793 TGGGGGGCCGGGGAGGATGAGGG - Intronic
1039088726 8:33805649-33805671 TGGGGGTGGGGGAAGTTTGAGGG + Intergenic
1042505866 8:69559736-69559758 TGGTGGCTGGGGGAGTATGATGG - Intronic
1043472892 8:80578923-80578945 TCGGGGCCCGGGACGCCTGAGGG - Intergenic
1052854693 9:33399917-33399939 TGGGGGAGAGGGAAGTATGAAGG + Intronic
1053932692 9:43124539-43124561 TGGGGGAGAGGGAAGTATCAAGG + Intergenic
1057146811 9:92764355-92764377 AGGGGGCACGGGCAGTATGTGGG - Intronic
1057355521 9:94328265-94328287 TGGTGGCCCAGGGAGAATGACGG - Intronic
1057652234 9:96929357-96929379 TGGTGGCCCAGGGAGAATGACGG + Intronic
1058766581 9:108188006-108188028 TGGGGGCCCAGGTAGCAGGAAGG - Intergenic
1060111469 9:120909799-120909821 TGGGGACCCAGCAAGAATGAGGG + Intronic
1061533340 9:131231850-131231872 TGGGGGCCAGAGAAGCAAGATGG - Intronic
1061973983 9:134059243-134059265 TGGGGGCCCGGGGAGAAGGGAGG - Intronic
1062725944 9:138073647-138073669 TGGGGGCAGGGGAAGCAAGACGG - Intronic
1192269615 X:69566475-69566497 TGGTGGCCCAGGTAGGATGATGG + Intergenic
1193397586 X:81003852-81003874 TGGAGGGCCGGGAAGCATGGCGG - Intergenic
1193989900 X:88293749-88293771 TGGGGGGCAGGGAATTAGGAGGG + Intergenic
1196866933 X:120078549-120078571 GGGGGGGCCGGGGAGTAGGATGG + Intergenic
1196876166 X:120157733-120157755 GGGGGGGCCGGGGAGTAGGATGG - Intergenic
1201319249 Y:12679332-12679354 TGGGGGAGGGAGAAGTATGAAGG - Intergenic