ID: 1136061342

View in Genome Browser
Species Human (GRCh38)
Location 16:27728725-27728747
Sequence CTTTAAAGGCTGAATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136061342_1136061350 15 Left 1136061342 16:27728725-27728747 CCAGCCACATTCAGCCTTTAAAG 0: 1
1: 0
2: 5
3: 30
4: 213
Right 1136061350 16:27728763-27728785 GAACACTGGGATTCAGAGCCAGG 0: 1
1: 0
2: 3
3: 30
4: 392
1136061342_1136061346 2 Left 1136061342 16:27728725-27728747 CCAGCCACATTCAGCCTTTAAAG 0: 1
1: 0
2: 5
3: 30
4: 213
Right 1136061346 16:27728750-27728772 AGCAGCCCCACAAGAACACTGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1136061342_1136061345 1 Left 1136061342 16:27728725-27728747 CCAGCCACATTCAGCCTTTAAAG 0: 1
1: 0
2: 5
3: 30
4: 213
Right 1136061345 16:27728749-27728771 GAGCAGCCCCACAAGAACACTGG 0: 1
1: 0
2: 3
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136061342 Original CRISPR CTTTAAAGGCTGAATGTGGC TGG (reversed) Intronic
902638233 1:17749254-17749276 GTTCAAAGGCTGAATGAGCCAGG - Intergenic
903565086 1:24259151-24259173 CTTTTAAGTCTGCACGTGGCGGG + Intergenic
903841190 1:26242056-26242078 GTTTAAATGCTGAAGTTGGCCGG - Intronic
904762372 1:32815051-32815073 CTTTAAAACCTGAGTGAGGCCGG + Intronic
906077184 1:43060655-43060677 CTTTAAAAGGTGAATAAGGCCGG + Intergenic
906116709 1:43361818-43361840 CAGTGAAGGCTGAATGTGGGGGG - Intronic
910135049 1:83957699-83957721 ATTTAAAGGCTGAATTTTGAAGG - Intronic
910252066 1:85208296-85208318 CTTGGAAGGCTTAATGTGGCTGG + Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
911530060 1:99033172-99033194 CTTTACAGACTGATTTTGGCAGG - Intergenic
912134475 1:106643596-106643618 TTTTAAAGACAGAATGAGGCTGG + Intergenic
913030986 1:114902409-114902431 CTTTAAAGGGTGAGTAGGGCAGG + Intronic
915845089 1:159254460-159254482 CTTAAAAGGCAGAGTGAGGCTGG + Intergenic
916573697 1:166048981-166049003 CTGTAGAGGCTCAGTGTGGCTGG - Intergenic
917587451 1:176442160-176442182 CGCTAAAGGCAGAATGTGGCTGG - Intergenic
917886432 1:179389887-179389909 GCTTTAAGGCTGAAAGTGGCAGG - Intronic
919723298 1:200864254-200864276 CTTTAAATACTGAATTTTGCCGG + Intergenic
921970996 1:221149041-221149063 GTTCAGAGGCTGAATTTGGCAGG - Intergenic
922761525 1:228134963-228134985 CTTGATAGGCTGCATGTGGCTGG + Intergenic
924081881 1:240406710-240406732 CTCAAAAGGGTGAATGTGGTTGG + Intronic
924657046 1:245982047-245982069 CTTTAAAGGGAGAATGTCTCTGG - Intronic
1063446532 10:6121486-6121508 CTTGAAAGAATGAATGGGGCGGG + Intergenic
1063559198 10:7110773-7110795 CTTTAAAGGCTGCATTTCCCTGG - Intergenic
1064629700 10:17297185-17297207 TTTTAAAGGCAGGATGGGGCTGG - Intergenic
1065305339 10:24363330-24363352 TTTGAAAGGCTAAATGTGGCAGG - Intronic
1067114942 10:43428121-43428143 CTTCAAGGGCTTAATGTGGTTGG - Intergenic
1068222471 10:54061926-54061948 CTTTAAAAACTAAATGAGGCCGG + Intronic
1068658294 10:59596601-59596623 CTTAAAAGGCTGACTGGGGCTGG - Intergenic
1069692890 10:70365352-70365374 CTTTAAAAGTTGAATCTCGCCGG - Intronic
1071796148 10:89008386-89008408 CTTTATAGGCTGAATAGGGATGG - Intronic
1072842435 10:98789353-98789375 CTTGAGAGGATGAATGTTGCAGG + Intronic
1073804479 10:107082587-107082609 CTTTGGAGGCTGAGTGAGGCAGG - Intronic
1074224297 10:111468546-111468568 CTTTAAAGGATGAGTGGAGCTGG - Intergenic
1075466209 10:122652596-122652618 CTTTAAAGACTGGATTTGGTAGG + Intergenic
1075475144 10:122727859-122727881 CATTAAAGACTGACTTTGGCCGG + Intergenic
1076715986 10:132364014-132364036 TTTTAAAGGCCAAATATGGCAGG - Intronic
1077477269 11:2796445-2796467 GTATAAAGGCTGAAGGTGGAAGG - Intronic
1078187085 11:9061249-9061271 CTTTAAAGGCTGGGGGTGGGGGG + Intronic
1080421718 11:32116834-32116856 TTTTAAAGTCTGAATCTGTCTGG - Intergenic
1084193983 11:67513210-67513232 CTTTAATAGGTGAATGGGGCTGG + Intergenic
1087478482 11:98667875-98667897 CTGAAAAGGCTCACTGTGGCTGG - Intergenic
1087543422 11:99550470-99550492 CTTGAAAGGCTGAATAAGGTTGG - Intronic
1089175573 11:116546703-116546725 CTTCAAAGGATGAATGATGCAGG - Intergenic
1089701925 11:120250056-120250078 CTTTAAAGGCTGAATTTTAAAGG + Intronic
1090205671 11:124882774-124882796 GTTGAGAGGCTGAATGAGGCAGG - Intergenic
1094671213 12:32571156-32571178 CCTTAAGAGTTGAATGTGGCTGG + Intronic
1094705827 12:32913572-32913594 TCTTAAAGGCTGGTTGTGGCAGG - Intergenic
1095990031 12:48028191-48028213 ATAAAAAGGCTGAATGAGGCCGG + Intergenic
1096306057 12:50477026-50477048 TTTTAAAGGCTTAATTTGGGAGG + Exonic
1096686223 12:53290044-53290066 CTTTAACAGCTGAATGAGTCTGG + Intronic
1097871934 12:64609711-64609733 CGTGGAAGGCTGATTGTGGCGGG + Intergenic
1098000774 12:65939650-65939672 ATTTAAAGCTTGTATGTGGCCGG - Intronic
1098052502 12:66469495-66469517 CTTTAAAGACTGAGTTTGGAGGG + Intronic
1098148918 12:67526402-67526424 ATTTAGAGTCTGAATGTGCCAGG - Intergenic
1098560594 12:71867304-71867326 ATTTAATGGATGAATGTGTCAGG + Intronic
1101080083 12:101173007-101173029 CATCAAGGGCTGAAGGTGGCTGG - Intronic
1101594795 12:106154682-106154704 CTTCAGAGACTGAATGTGCCAGG - Intergenic
1102607016 12:114075670-114075692 CTTAAAAGGCTGAAGGTGCAGGG - Intergenic
1103156982 12:118693971-118693993 CTTTAAGGGCTGAAAGTGTGTGG + Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1104483920 12:129132986-129133008 CTCTGATGTCTGAATGTGGCAGG + Intronic
1106009060 13:25800536-25800558 CTTTAAAGGAGTAGTGTGGCAGG + Intronic
1106141056 13:27012040-27012062 CCTTAAAGTCTGAGTGAGGCTGG - Intergenic
1107445534 13:40467116-40467138 CTTTGAAGGCAGAATGGGACTGG + Intergenic
1107719121 13:43229545-43229567 ATTTAAATTCTAAATGTGGCAGG + Intronic
1108874395 13:55026486-55026508 CTTTAAAGGCTGAAGTGGGAAGG - Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1110142360 13:72146448-72146470 CTTTTAAAGATGAATGTGGTGGG + Intergenic
1110821164 13:79918447-79918469 CTTTTAAGGCTGACTTTGGAAGG + Intergenic
1111459414 13:88519977-88519999 CTTAAAAGGGTGAAGGTGGCCGG + Intergenic
1112242472 13:97695432-97695454 CTTAAAAGGCTCCTTGTGGCGGG - Intergenic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1119244565 14:73092861-73092883 CTTAAAATTCTGAATCTGGCTGG - Intronic
1119408516 14:74413214-74413236 TGGTAAAGGCTGAGTGTGGCTGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1124423477 15:29542118-29542140 CTCTGGAGGCTGAATGAGGCAGG - Intronic
1124967932 15:34452083-34452105 TTTTAAGGGTTGAATGTGGTAGG - Intergenic
1125568247 15:40694342-40694364 TTTTAAAGGCTGAGTAGGGCCGG - Intergenic
1125879260 15:43178443-43178465 CTTTAAATTCAGAATTTGGCAGG - Intronic
1127405750 15:58644071-58644093 TTTTAAAATTTGAATGTGGCAGG - Intronic
1128102986 15:65020441-65020463 CTTTAAAAGATCTATGTGGCAGG + Intronic
1130088629 15:80800429-80800451 CATTAATGGCTGAATGTGGCTGG + Intronic
1130433447 15:83873006-83873028 TTTAAAAGGAAGAATGTGGCTGG + Intronic
1130862621 15:87904450-87904472 ATTAAAAGGCTTATTGTGGCTGG - Intronic
1132411628 15:101582830-101582852 GTTTAAGGACTGAGTGTGGCGGG - Intergenic
1132425777 15:101715440-101715462 TTTTAAACAGTGAATGTGGCTGG - Intronic
1134026110 16:10955278-10955300 CAATAAATGCTGAATGGGGCAGG - Intronic
1134602927 16:15547641-15547663 CATTAAAAGCTGAAAGTGGCTGG - Intronic
1135494935 16:22943045-22943067 CTTTAAGGGAGGAATGTGTCAGG - Intergenic
1135668544 16:24355798-24355820 CTTCAAAAGCTGGATGGGGCTGG - Intronic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1139634625 16:68250565-68250587 TTTTAAAGAGTGAATGGGGCTGG - Intronic
1140453584 16:75091045-75091067 GATAAAAGGCTGAATGTGGCTGG - Intronic
1140581196 16:76233015-76233037 CTAAAAAGGCTAAATGAGGCTGG - Intergenic
1140635294 16:76905849-76905871 CATTAAAGGATGCATGTGTCAGG + Intergenic
1142432276 16:90036047-90036069 TAATAAAGGCTGATTGTGGCTGG + Intronic
1142469456 17:155286-155308 CTTTAAAAATTGTATGTGGCAGG - Intronic
1143858421 17:9869947-9869969 CTTTAAAGGCTGACAATGGAGGG + Intronic
1147132568 17:38418056-38418078 CTTTATAGGCTGGGTGTGGGGGG - Intergenic
1147724881 17:42560892-42560914 CTTGAAAGGCTGAGTGTGGAGGG - Intergenic
1148954980 17:51346077-51346099 CTGTAAGGACTGAATGTGGAAGG + Intergenic
1148999014 17:51737888-51737910 TTATAGAGGCTGACTGTGGCTGG + Intronic
1149010546 17:51852109-51852131 GTTTAAAGGCTGCATGATGCTGG - Intronic
1149170331 17:53802008-53802030 CTTTAAGGTCTGAATATGGCAGG + Intergenic
1149924554 17:60690271-60690293 TTTTAAAGGCTGAATGAGGCAGG + Intronic
1150433005 17:65133576-65133598 CTTGGGAGGCTGAATGAGGCAGG - Intergenic
1150947547 17:69765094-69765116 CTTTAATGGCTGGAGTTGGCTGG + Intergenic
1151122707 17:71810100-71810122 CTTTTGAAGCTGAATTTGGCTGG - Intergenic
1151286302 17:73114002-73114024 CTTTAAAAGTTGATTGGGGCTGG + Intergenic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1151356797 17:73563468-73563490 CTCAGAAGGCTGAATGTGGGAGG + Intronic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1157485189 18:48082008-48082030 TTTTAAAGTCAGTATGTGGCTGG + Intronic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1159730822 18:72024613-72024635 CTTTAAAAGCCGCATGGGGCCGG - Intergenic
1161250521 19:3277505-3277527 TTTTAAAGGGTGAATTTGGTAGG - Intronic
1161390516 19:4018106-4018128 TTTAAAAGGCTGACTGGGGCCGG - Intronic
1162082632 19:8227636-8227658 CTTTTAAGGCTGAATCAGGCTGG - Intronic
1162357937 19:10198332-10198354 TTTTAAAGACTGAATTAGGCTGG - Intronic
1162903846 19:13811585-13811607 CTTGGAAGGCTGAGTGAGGCAGG + Intronic
1166773005 19:45295665-45295687 CTCAGAAGGCTGAATGAGGCAGG + Intronic
1166861202 19:45812383-45812405 TTTCAAAGGCTGACTGTGGCCGG - Intronic
1167025815 19:46917310-46917332 CTTTAAAGGCTGAATAGGCCAGG + Intergenic
926880309 2:17538198-17538220 CTTGAAGGGAGGAATGTGGCAGG - Intergenic
927540202 2:23902938-23902960 CTTTAAAGGATGTTTTTGGCCGG + Intronic
927986434 2:27414415-27414437 CCTTAAAGGTTAAATGTGGATGG + Intergenic
930881747 2:56278283-56278305 CTTTTAAGTCTGAATGGGTCTGG + Intronic
932127395 2:69156437-69156459 TTTTAAAGGATGAAGGTGGCTGG - Intronic
932551377 2:72772788-72772810 CTTTACAGGCTGGCTTTGGCAGG - Intronic
936284178 2:111168618-111168640 CTTTAAAGTTTTGATGTGGCTGG + Intergenic
937225499 2:120366505-120366527 CTCCAAGGGCTGAATGTGGGAGG + Intergenic
940001850 2:148974433-148974455 CTTTGCAAGCTGAATGTGACTGG + Intronic
940280552 2:151984631-151984653 CATCAAAGGCTGAATGTGAAAGG - Intronic
943389943 2:187252729-187252751 CTTACAAGGCTGAGTTTGGCTGG - Intergenic
943670074 2:190650087-190650109 CTGTTAAGCCTGAATGTTGCAGG + Intronic
943968727 2:194374703-194374725 ATTTTAAGGCTTAATGGGGCTGG + Intergenic
944574126 2:201074750-201074772 CTAGAAAGGCTGAACATGGCTGG - Intronic
948016298 2:234693397-234693419 ATTAAAATCCTGAATGTGGCCGG - Intergenic
948127748 2:235577118-235577140 CTTTAAATGACGTATGTGGCTGG - Intronic
1169574274 20:6941008-6941030 CTTTCAAGGTTGAATGTGCATGG + Intergenic
1172086671 20:32389862-32389884 CTAAAAAGGGTGAATTTGGCTGG - Intronic
1173838859 20:46143796-46143818 TTTAAAAGGGTGAATTTGGCCGG + Intergenic
1174723018 20:52833785-52833807 CTTGAAGGGCAGAATGTGTCAGG + Intergenic
1174856100 20:54046930-54046952 CTTGAAAGGATGAAGATGGCTGG + Intronic
1174941019 20:54927230-54927252 CTTGAAAAGCTGAATATGGCTGG - Intergenic
1175987040 20:62769415-62769437 CTATGCAGGCTGAATGTGCCCGG - Intergenic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177361530 21:20078617-20078639 CTTCAAAAGTTGAATGAGGCCGG + Intergenic
1178599886 21:33986167-33986189 CTTCAAAGGATGAATTTGGGTGG + Intergenic
1178748701 21:35279863-35279885 CTTTAAAGGGTGAATTTTGGGGG - Intronic
1179956289 21:44740975-44740997 GCTCAAAGGCTGCATGTGGCAGG + Intergenic
1183577162 22:38699331-38699353 CTTTAAAGGTGGAATGTGGTGGG - Intronic
949396742 3:3622569-3622591 CTGTGAAGGCTGAATGGGGAAGG - Intergenic
950024898 3:9813481-9813503 CTTTAAAGGCTGGATAGAGCTGG + Intronic
951409216 3:22341977-22341999 ATTAAAAGACTGAATGAGGCCGG + Intronic
953321511 3:41976579-41976601 ATTTAAAAGCAGAATCTGGCCGG + Intergenic
954475210 3:50738023-50738045 CTTTACAGGCTGGTTTTGGCAGG + Intronic
958457517 3:94349809-94349831 CTTAAAAGGATTAATTTGGCTGG + Intergenic
958502103 3:94925455-94925477 CTTGAATGTCAGAATGTGGCAGG - Intergenic
959073658 3:101727506-101727528 CTGGAATGGCTGAATTTGGCAGG + Exonic
959229231 3:103626320-103626342 CTTCATAGGCTGTATGTGTCTGG + Intergenic
959527602 3:107394994-107395016 AGTTTAAGGCTGAATGTGTCAGG - Intergenic
959551850 3:107668982-107669004 CTTTAACCTCTGAATGTGGGAGG - Intronic
961725499 3:128926210-128926232 CATTAAAGCCTGAATGTGGCTGG + Intronic
962818615 3:139024688-139024710 CTTGTATGGCTGAATGTGTCTGG + Intronic
966230325 3:177644374-177644396 TTTTAAGGTCTGAACGTGGCAGG - Intergenic
967163022 3:186756179-186756201 CTTTAAATGTCGAATATGGCTGG + Intergenic
967221629 3:187252420-187252442 CTTGAAAGGCTAAATCTGACAGG + Intronic
967674338 3:192278055-192278077 CTTTAAAGGAGAAATGTGGCTGG - Intronic
968430344 4:554797-554819 CTTGAAAGGCTCAGTGAGGCGGG - Intergenic
971194067 4:24455183-24455205 CATTAAAGAATGAATGGGGCCGG + Intergenic
972719619 4:41683079-41683101 CTTGAAATGATGAATGTGTCTGG + Intronic
975979470 4:80140275-80140297 CTTTAAAAGCTGAGTTTGGAAGG - Intergenic
978238147 4:106485289-106485311 CTTGAAAGGCTGTATGTGTCTGG + Intergenic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
983994844 4:174169281-174169303 GTTTACAGGCTGAGTGAGGCTGG - Intergenic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
985206081 4:187538591-187538613 TTTTAAAGGGTGAGAGTGGCTGG + Intergenic
985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG + Intronic
986481960 5:8198509-8198531 CTTTAAAGACTTAATGTTGGTGG - Intergenic
987048640 5:14130704-14130726 CTTTCAGTACTGAATGTGGCGGG - Intergenic
987320286 5:16762662-16762684 AATTAAAAGTTGAATGTGGCTGG + Intronic
988471556 5:31544285-31544307 CTTAAAAGCATCAATGTGGCCGG + Intronic
990098066 5:52144210-52144232 CTTTAAATTATGAATGTGGCTGG + Intergenic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
995612140 5:113922126-113922148 TTTTAAAAGCCAAATGTGGCCGG - Intergenic
995938566 5:117549495-117549517 CTTTAAAGGCTGAATTGGACTGG - Intergenic
996040970 5:118810371-118810393 CTTTAAAGACTGGGTTTGGCAGG - Intergenic
996121424 5:119677926-119677948 CGTTACAGGATGAATGTGGATGG - Intergenic
996892484 5:128438287-128438309 CTTAAATGGGTGAATGTAGCCGG - Intronic
997243407 5:132325271-132325293 CTTAAATAGCTGCATGTGGCTGG - Intronic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997540549 5:134658157-134658179 CTCGAGAGGCTGAATGAGGCAGG + Intronic
1000395784 5:160773378-160773400 CTTTAAAATATGCATGTGGCTGG - Intronic
1002628311 5:180549351-180549373 TTTTAAAGGATAAATTTGGCCGG + Intronic
1005003850 6:21269058-21269080 AATTAAAGGATGAATGAGGCCGG + Intergenic
1005292645 6:24394690-24394712 TTTGAAAGGCTGCATGTAGCAGG - Intergenic
1006081165 6:31567710-31567732 CTTTAAAGGCTTCCTGTGGCTGG + Intergenic
1007787786 6:44291140-44291162 CTATAAAGGCTGAAGGTAGTAGG - Intronic
1012197194 6:96358144-96358166 CTTTAAAGACTAAATGTGGCTGG + Intergenic
1012795226 6:103750950-103750972 CTTTGAAGGGTGAATAGGGCAGG - Intergenic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1015570861 6:134619977-134619999 CCTACAGGGCTGAATGTGGCTGG - Intergenic
1015605801 6:134953610-134953632 ATTTAAAGGCTGAAAGCGCCAGG - Intergenic
1015781329 6:136869351-136869373 CTTGAGAGGCTGAGTGAGGCAGG - Intronic
1016697433 6:147014260-147014282 CTTAAAAGGCTGAAATTGTCAGG + Intergenic
1018197843 6:161370286-161370308 TTTTAAAAGCTGAATTAGGCTGG + Intronic
1019163505 6:170084457-170084479 AAAAAAAGGCTGAATGTGGCCGG + Intergenic
1019831122 7:3331672-3331694 CTTTAAAGGATGAATTTGCTTGG + Intronic
1023032398 7:36101926-36101948 CTTTAACGGTAGAATGTGGTGGG - Intergenic
1024602773 7:50999372-50999394 CTTCAAAAGTTAAATGTGGCCGG + Intergenic
1025805874 7:64834020-64834042 CTTTAAAGGCTTATATTGGCTGG - Intergenic
1026620042 7:71942266-71942288 CTTGATAGGCTGCACGTGGCTGG - Intronic
1028726452 7:94092982-94093004 TTTTCAAGGCTGAATGAAGCAGG - Intergenic
1029267994 7:99357623-99357645 ATTCAAAAGCTGACTGTGGCTGG - Intronic
1031068876 7:117139961-117139983 GTTTAAAAGCTGAATGTGGCTGG - Intronic
1032137188 7:129290632-129290654 TTTTAAAAAGTGAATGTGGCCGG + Intronic
1032768979 7:135029173-135029195 CTCTTAGGGGTGAATGTGGCTGG - Intronic
1032871542 7:135991326-135991348 ATTTAAAGGCGAAAAGTGGCTGG + Intergenic
1034041191 7:147878774-147878796 CTTTTAAGTCTGACAGTGGCAGG + Intronic
1035712629 8:1730240-1730262 CTTTAGAGTCTGAATCTCGCCGG - Intergenic
1035839019 8:2790084-2790106 CTTTAAAGGCAGAATGAGACTGG + Intergenic
1037253070 8:16919802-16919824 CCTTGGAAGCTGAATGTGGCTGG - Intergenic
1037362274 8:18085742-18085764 CTTTAAATGGAGAATGTGCCTGG + Intergenic
1039988293 8:42466380-42466402 CTTTAAATGCATAATCTGGCCGG - Intronic
1044869638 8:96606347-96606369 GTTTAAAGGCTAAAGGTGGCTGG - Intronic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045584282 8:103514014-103514036 AGTTAAAGGCTGCATGTAGCTGG - Intronic
1046071656 8:109262757-109262779 CTATAAAACCTGAATGTGGCCGG + Intronic
1048819580 8:138368590-138368612 CTCTAAAGACTGAAGATGGCTGG + Intronic
1052338298 9:27341044-27341066 CCTTAAAGGCTGGATGCGGGAGG + Intronic
1055583289 9:77730834-77730856 TTTTATAGGCTGAATGTTTCAGG + Intronic
1056128471 9:83561243-83561265 CTTTTAAAGCTGAATTTGACAGG - Intergenic
1057021921 9:91706227-91706249 CTTTACAGGCTGGTTTTGGCAGG + Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058697089 9:107568628-107568650 CTTGGAAGGCTGAGTGAGGCAGG - Intergenic
1059524503 9:114977958-114977980 CTTAAAAGGTTCTATGTGGCCGG - Intergenic
1060799229 9:126533085-126533107 CTGTAAATGCTGAGTGTGGACGG - Intergenic
1062351137 9:136139348-136139370 TTTTAAAAGCTGTTTGTGGCTGG - Intergenic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1185934248 X:4237765-4237787 CTTTGAAGGATGAATGAGGTGGG - Intergenic
1187695264 X:21913089-21913111 CTATAAAGGCTCACTGTGCCTGG - Intergenic
1188222371 X:27556835-27556857 CTTTAAAGGATGCATTTGGCAGG - Intergenic
1193212555 X:78824521-78824543 TTTGAAAAGCTGAATGTTGCAGG - Intergenic
1194235889 X:91382638-91382660 CTTTAAAGGAAGAATGGTGCTGG - Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197721639 X:129748962-129748984 CTTTAAAATCTGCAAGTGGCTGG - Intronic
1198543378 X:137664650-137664672 CATGAAAAGCTGAAAGTGGCCGG - Intergenic