ID: 1136061640

View in Genome Browser
Species Human (GRCh38)
Location 16:27730694-27730716
Sequence GCCTGCCTTAGGCCCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136061632_1136061640 -10 Left 1136061632 16:27730681-27730703 CCCCATACCCCTAGCCTGCCTTA 0: 1
1: 0
2: 2
3: 10
4: 173
Right 1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1136061631_1136061640 -7 Left 1136061631 16:27730678-27730700 CCTCCCCATACCCCTAGCCTGCC 0: 1
1: 0
2: 1
3: 34
4: 425
Right 1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1136061630_1136061640 11 Left 1136061630 16:27730660-27730682 CCTGACTTCACAAACAAGCCTCC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136061640 Original CRISPR GCCTGCCTTAGGCCCCTTGT GGG Intronic
901024194 1:6270433-6270455 GCCTGCCTGAGGCCACAGGTGGG - Intronic
901539179 1:9903812-9903834 GCCTCCCTTAAGCCCAATGTAGG - Intronic
904440440 1:30526292-30526314 GTCAGCCTTCTGCCCCTTGTCGG + Intergenic
910112612 1:83698895-83698917 CCCTGCCTTAGCCTCATTGTGGG + Intergenic
910438318 1:87227814-87227836 GCCTGCTGGAGGACCCTTGTGGG + Intergenic
917476657 1:175374745-175374767 ACCTGCCTTAGGCCTCATGGTGG - Intronic
918757212 1:188354094-188354116 GACTGCCTTAGGGTCCTTTTAGG - Intergenic
919895670 1:202008368-202008390 GCCTGCCTCAGGCTCCTTGGGGG + Exonic
922327264 1:224539614-224539636 GCCTTCCTTATGCCCCATGCTGG + Intronic
922786846 1:228287131-228287153 TCCTGCCTTGGGCTCCTTGTGGG - Intronic
923511851 1:234659831-234659853 GCCTGCCGGCGGCCCATTGTGGG - Intergenic
1062944070 10:1446858-1446880 GCCTGACTTAGGCCCCGGGAGGG + Intronic
1064345836 10:14532179-14532201 TCCTTCCTTAAGCACCTTGTGGG + Intronic
1069190714 10:65484841-65484863 AGCTGCCTTAGGCTCTTTGTTGG + Intergenic
1074124417 10:110516745-110516767 GCCTGCTTTAAGCCCCTGTTTGG - Intergenic
1076865503 10:133164437-133164459 GCCTGCCGTGGGGCCCTCGTGGG + Intronic
1079617760 11:22515944-22515966 GCCTGCTTTTGGCCAGTTGTGGG + Intergenic
1080642464 11:34165853-34165875 GCTTCCCTTAGGCTTCTTGTCGG + Intronic
1083908525 11:65690635-65690657 GCCTGCTCTAGGCTCCTTCTGGG - Intergenic
1084564570 11:69921732-69921754 GCCTGCGTCACGCCACTTGTGGG + Intergenic
1084605524 11:70169646-70169668 TCCTGCCTGAGGCCCCTGGAGGG - Intronic
1085261144 11:75205336-75205358 ACCTGCCTTAGGGCCCTGGGTGG + Exonic
1088403281 11:109444282-109444304 GCCTGCCTTGGGCCCCTCACAGG + Intergenic
1089302921 11:117509455-117509477 GCCTGCCTTGGGCCTCTGGGAGG - Intronic
1089525173 11:119092506-119092528 GCCTTCCTGAGGCACCTGGTAGG + Exonic
1089880655 11:121770192-121770214 GCCTACCTCAGGGCCTTTGTAGG + Intergenic
1090291212 11:125546578-125546600 GACTGCTCTAGGCTCCTTGTGGG + Intergenic
1090656967 11:128853759-128853781 CCATGCCTTTGGGCCCTTGTTGG + Intronic
1090989554 11:131803767-131803789 GCCTGGCCTCTGCCCCTTGTGGG + Intronic
1102504286 12:113374014-113374036 GCCTGCCCAAGGCCCCATGAGGG + Intronic
1103270070 12:119666061-119666083 GCCTGGCTTAAGTCCCTTCTGGG + Intergenic
1103459013 12:121089174-121089196 GCCTGTCTTAGGCCACATGAAGG - Intergenic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1109257518 13:60101407-60101429 GCTTGCTTTAGGGCCATTGTGGG - Intronic
1112276567 13:98026736-98026758 GCCTGGCTGTGGCCCCTTGCGGG + Intergenic
1119268609 14:73280937-73280959 GCCTGCCTCAGCCTCCCTGTTGG + Intronic
1119406618 14:74403109-74403131 GGCTGCCTGAGGCCCCTGGGAGG - Intergenic
1119947806 14:78713329-78713351 GCCTACCTCAGGGCCTTTGTAGG + Intronic
1124706485 15:31970692-31970714 GGCTGCCTTAGGATCCTTGTTGG - Intergenic
1125606595 15:40942854-40942876 TTCTGCCTTATGCCCCTTGGTGG - Intergenic
1132848186 16:2010372-2010394 GCCTTCCAGAGGCCCCTTCTGGG - Intronic
1135981215 16:27148909-27148931 GCCTGCCTTAGCCTCCCAGTGGG - Intergenic
1136061640 16:27730694-27730716 GCCTGCCTTAGGCCCCTTGTGGG + Intronic
1136219623 16:28820349-28820371 CTCTGCCTTATGCCCCTTGGTGG + Intergenic
1140191460 16:72820611-72820633 GCCTGTCTTTGGCCTCTTGTTGG + Intronic
1143585182 17:7847340-7847362 GCGTGCCTTACGCCCCTTCCCGG + Exonic
1144092975 17:11874324-11874346 GCCTCTCTTAGGCCCCTTCAGGG - Intronic
1145736948 17:27239846-27239868 GCCTGCCTCAGGACCTTTGCAGG + Intergenic
1146150624 17:30466665-30466687 GCCACTCTTAGGCCCCTTGTTGG - Exonic
1150348283 17:64421555-64421577 GACTGCTTTAGGCTCCTTCTGGG + Intergenic
1150517331 17:65827234-65827256 GCTTGCCACAGGCCCATTGTGGG + Intronic
1151003143 17:70401675-70401697 GCTTGCCTTAGGCCCCTGAGCGG + Intergenic
1151939291 17:77282543-77282565 CCCTGCCTTTGGGCCATTGTCGG + Intronic
1152036622 17:77877330-77877352 GCCTGCCTTTGGCCCCTTTGAGG + Intergenic
1152786319 17:82249776-82249798 GCCTGGCTCTGACCCCTTGTGGG - Intronic
1156195321 18:34768234-34768256 GCCTTCCTTAGGCTCCTTTCAGG + Intronic
1156481594 18:37439897-37439919 CCCTGCCTTAGGCTCCTAGGAGG + Intronic
1158540707 18:58351446-58351468 TCCTGCCATAGGACCCTTGAAGG - Intronic
1161316467 19:3619767-3619789 GCTTGCCTTGGGCCCCGTGGCGG - Intronic
1166283822 19:41811414-41811436 GCCTGCCCTAGGCCCTGGGTGGG + Exonic
1166912268 19:46167467-46167489 GCCTGCATTAGCCCCATTGTAGG - Intergenic
925395443 2:3530008-3530030 GCCTGCCTAAGCCCCGCTGTGGG - Intergenic
928103041 2:28450464-28450486 GGCTGCCTAAGGTCCTTTGTGGG + Intergenic
928757798 2:34547070-34547092 GCCTGTCTTGGGCCCCATGGTGG + Intergenic
929780984 2:44956804-44956826 GCCTCCCTTAGGCACCATGGTGG - Intergenic
932058355 2:68468912-68468934 ACTTGCCTTAGGTCCCTTCTGGG + Intronic
932800858 2:74741268-74741290 TCCTGCCTGAGGCTCCTGGTGGG - Intergenic
941273570 2:163461373-163461395 GTCTTCCTTAGGCCCCAAGTTGG - Intergenic
943214003 2:185006824-185006846 GCCGTCCATAGGCCCCTTCTGGG + Intergenic
1171108626 20:22459842-22459864 GCCAGCCTTAGGCCACTTCTGGG + Intergenic
1172973865 20:38892435-38892457 ACGTGCCTTGGGCCCCATGTTGG + Intronic
1173429811 20:42977038-42977060 GCCTGACTTAGCCCTCTTATGGG + Intronic
1174053196 20:47781425-47781447 GCCTGGCTTAAGCCAATTGTTGG + Intronic
1175327895 20:58142335-58142357 GCCTGCCTCTGGCCCTTTGCTGG - Intergenic
1176125705 20:63473561-63473583 CCCTGCCACAGGCCCCTTCTGGG - Intergenic
1178580098 21:33831243-33831265 TCCTTCCATAGGCCCCATGTGGG - Intronic
1180917842 22:19501219-19501241 GCCTACCTGAAGCCCCTTATGGG + Intronic
1182848652 22:33452450-33452472 GCCTGCCATGGGCCCCTTCCTGG - Intronic
1185192390 22:49446996-49447018 CCCTGACTCAGGGCCCTTGTTGG - Intronic
1185364814 22:50432596-50432618 GCCTGGCTTTGCCCTCTTGTGGG + Intronic
950448703 3:13053681-13053703 CCCTGCCTCAGGCCCCTCCTGGG - Intronic
950542895 3:13622669-13622691 TCCTCTCTTAGGCCCCATGTGGG + Intronic
960054176 3:113264897-113264919 GCCTGCCAGTCGCCCCTTGTGGG + Intronic
960951057 3:122998692-122998714 GCCTCCTTTAGGCCCCAAGTAGG + Intronic
964331235 3:155605613-155605635 GCCTGCTCTAGGCTCCTTCTGGG + Intronic
965071933 3:163925343-163925365 CTCTGCCTTATGCCCCTTGGAGG - Intergenic
967124674 3:186413138-186413160 GCCTGCCTTATGCCGCTTGCAGG - Intergenic
969132532 4:5002332-5002354 TCCTGCATCAGGCCCTTTGTTGG + Intergenic
970499225 4:16660313-16660335 CCTTGCCTAAGGCCCCTTGATGG - Intronic
972353628 4:38260186-38260208 GATTGCCTAAGGCCCCCTGTTGG + Intergenic
974626186 4:64431215-64431237 GTCTGCCAGAGGCCCCTGGTCGG - Intergenic
976008416 4:80458389-80458411 GCCTGCCTTGGATCCCCTGTGGG - Intronic
978145977 4:105372203-105372225 GTCTAACTTTGGCCCCTTGTGGG + Intronic
985674545 5:1224224-1224246 GCCTGCCATAGGACCCTGGGCGG + Exonic
986449151 5:7849638-7849660 TCCTGCCTTTGGCCGCTGGTGGG + Intronic
991368510 5:65894225-65894247 TCCTGCCTTAGGCCCCCAGGTGG + Intergenic
1001941511 5:175742891-175742913 GTCTGCCTTGGGACCTTTGTCGG + Intergenic
1003351265 6:5319677-5319699 CTCTGCCTTATGCCCCTTGGTGG + Intronic
1011664258 6:89619789-89619811 CCTTGCCTTAGGCCCGTAGTTGG + Intronic
1012529145 6:100213508-100213530 GAGTGCCTCAGGCCCCTGGTTGG + Intergenic
1016150009 6:140728971-140728993 GCCAGCCTCATGCCCCTTATAGG + Intergenic
1019261450 7:84186-84208 GCCTGCCGGAGGCCCCCTGAAGG - Intergenic
1022243968 7:28539794-28539816 ACCTGCCTTCGTCACCTTGTGGG + Intronic
1024071392 7:45788624-45788646 TCCTGCCTTAGTCTCCCTGTGGG + Intergenic
1024758450 7:52565095-52565117 TCCTGCCTTAGCCTCCATGTTGG + Intergenic
1035304109 7:157919077-157919099 GCCCGCTGTAGGACCCTTGTGGG - Intronic
1036919932 8:12842592-12842614 CCCTGCCTTGAGCCACTTGTAGG - Intergenic
1038673101 8:29598011-29598033 GCCTGCCTTACACCCCTTCCAGG - Intergenic
1042490272 8:69389909-69389931 GCCTGCCTCAGGCTCATAGTAGG - Intergenic
1046431508 8:114134644-114134666 GCCTCCCTTTGGCCACTTGGTGG + Intergenic
1047450834 8:124963710-124963732 CTCTGCCTTATGCCCCTTGGTGG + Intergenic
1047832757 8:128654566-128654588 CCCTCTCTTAGGCCCCTTTTGGG - Intergenic
1053130322 9:35610853-35610875 GCCTGCCTAAGGCCACATCTGGG + Intronic
1059032786 9:110718146-110718168 GCCTCCCTTTGTCCCCATGTGGG + Intronic
1189327616 X:40122396-40122418 GCCAGCCTGGGGTCCCTTGTTGG + Intronic