ID: 1136064507

View in Genome Browser
Species Human (GRCh38)
Location 16:27749704-27749726
Sequence GTCCCCCGGGAGCTCCGTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136064507_1136064512 13 Left 1136064507 16:27749704-27749726 CCAACACGGAGCTCCCGGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1136064512 16:27749740-27749762 TCCTGCAGCAAAAGAGCAGCCGG 0: 1
1: 0
2: 2
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136064507 Original CRISPR GTCCCCCGGGAGCTCCGTGT TGG (reversed) Exonic
900502366 1:3012686-3012708 GTCCCGCGGGAGCGCCGCGTGGG - Intergenic
900572185 1:3364128-3364150 GTCCTCCGAGAGCTCCAGGTGGG + Intronic
900996773 1:6127140-6127162 GTCCCCGAAGAGCTCCTTGTGGG - Intronic
901392417 1:8955480-8955502 GTCTCCCGGGAGCTGTGTTTTGG + Intronic
906689930 1:47785829-47785851 GACTCCTGGGAGCTCCCTGTTGG + Intronic
912576055 1:110674113-110674135 GTACCCCGAGAGCTCCGGGCCGG - Exonic
915592169 1:156876704-156876726 GTCCCCAGGGAGCTCTGAGATGG + Intronic
918542654 1:185649008-185649030 GTCGCCAGGGAGCTCACTGTGGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1072766122 10:98096508-98096530 GTCCCCCAGGAGCCCCGGGCAGG - Intergenic
1076585977 10:131547898-131547920 GTCCTCGCAGAGCTCCGTGTGGG - Intergenic
1077206880 11:1349068-1349090 ATCCCCGGGGAGCTCCGGGTGGG - Intergenic
1077488580 11:2850213-2850235 GGCCCCACGGAGCTCCCTGTGGG - Intergenic
1081993425 11:47349596-47349618 GGCCTCCGGGATCTCCCTGTGGG + Intronic
1084165590 11:67373427-67373449 GACCCCCGGGAGCCCCGCGCCGG - Intronic
1084645186 11:70452719-70452741 GTCCCATGGGAACTCCCTGTGGG + Intergenic
1085384344 11:76148569-76148591 GTCCCCTGGGAGCTCTGTGAAGG + Intergenic
1085403108 11:76246271-76246293 GTCCTCAGGGAGCTCGGTGAAGG - Intergenic
1106393736 13:29360358-29360380 GTCCCCTGGCAGCTCCTTTTTGG + Intronic
1110519840 13:76462569-76462591 GTCCCCTGGGAGCTGAGGGTGGG - Intergenic
1113582157 13:111437487-111437509 GTGCCCTGGGAGCTCCATCTGGG - Intergenic
1114365947 14:22027171-22027193 CTCCCACGGAAGCTCAGTGTGGG + Intergenic
1122796760 14:104210010-104210032 GTCCCCAGGTTGCTCTGTGTGGG + Intergenic
1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG + Intergenic
1124595724 15:31089913-31089935 GTTGGCCGGGAGCACCGTGTGGG + Intronic
1136064507 16:27749704-27749726 GTCCCCCGGGAGCTCCGTGTTGG - Exonic
1136716542 16:32287409-32287431 GTCCCCGGGCACCTCCTTGTGGG - Intergenic
1136834930 16:33493687-33493709 GTCCCCGGGCACCTCCTTGTGGG - Intergenic
1142113060 16:88342240-88342262 GTGACCAGGGAGCTCAGTGTGGG + Intergenic
1203009873 16_KI270728v1_random:230345-230367 GTCCCCGGGCACCTCCTTGTGGG + Intergenic
1143532378 17:7512866-7512888 GACCCCGGGGAGCCCGGTGTGGG - Exonic
1143830358 17:9645842-9645864 GGCCCCCGGGAGCCCCGGGGAGG + Exonic
1145876037 17:28318981-28319003 GGCCGCCAGGAGCGCCGTGTGGG - Intergenic
1146183260 17:30710033-30710055 GCGCCCCGGGAGCTCCGTGGGGG - Intergenic
1151350971 17:73532066-73532088 GTCCCCCGGGAGCTGGGGGCAGG - Intronic
1151530656 17:74702704-74702726 GTCCCCGTGGAGCTCAGTGTGGG - Intronic
1160528344 18:79549874-79549896 GTCTCCTGGGAGCTCCCTCTCGG - Intergenic
1161218269 19:3105562-3105584 GCCCCCCAAGAGCTCCGTGGCGG + Intronic
1162914028 19:13865054-13865076 GGGCCCCGGGAGCTGCGTTTTGG + Intronic
1162975532 19:14205741-14205763 GCGCCCCGGGCGCTCCGTGGGGG + Intronic
1165755959 19:38293107-38293129 GTACCCCAGGACCTCCTTGTTGG - Intronic
1168148058 19:54430485-54430507 TTCCCCCGGGAGATCCCTGGGGG + Intronic
1168528499 19:57106854-57106876 GTCGCCCTGGAGCTCAGGGTCGG + Intergenic
926107008 2:10158832-10158854 CTCTCCCGGGAGCTCGGGGTTGG + Intronic
928278486 2:29922743-29922765 GGCCCCCAGGAGCTCAGTGAGGG - Intergenic
932142609 2:69293116-69293138 GTCCTCCAGGATCTCTGTGTTGG - Intergenic
932429266 2:71664216-71664238 GTCCCTTGGGTGCCCCGTGTTGG + Intronic
934843508 2:97646396-97646418 GTCACCCGGCACCTCCGTTTAGG - Intronic
935062803 2:99622888-99622910 TTCCACCGGGAGCTCCCTGTCGG - Intronic
937242056 2:120468205-120468227 GTCTCCCAGGAGCACCCTGTTGG + Intergenic
945080855 2:206085485-206085507 GTCCCCCGGGGTCTCCGGGTGGG - Intronic
947765326 2:232633943-232633965 GAACTCCGGGAACTCCGTGTAGG - Exonic
1170546306 20:17437994-17438016 GTCCTCTGGGAGCACGGTGTGGG - Intronic
1171458754 20:25286754-25286776 GTTCCCCGGGGGCTCCTTGGTGG + Intronic
1173566027 20:44039290-44039312 GTCCCCAGGGAGCTCTGGGAAGG + Intronic
1174414368 20:50357322-50357344 ATCCCCCGGGAGCTTGGTGTGGG + Intergenic
1175429005 20:58889782-58889804 GGCCCCCGTGCGCCCCGTGTCGG - Intronic
1183335522 22:37243945-37243967 CACCCCCGGGTGCTCCCTGTGGG + Intronic
1184955010 22:47880047-47880069 GTCCCCAGAGAGCTCCGAGAAGG - Intergenic
1185025072 22:48404148-48404170 GGCCCCGTGGAGCTGCGTGTGGG - Intergenic
1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG + Intronic
951569073 3:24043356-24043378 GTCCACTGGGAGCTCCATGGGGG + Intergenic
955186395 3:56718977-56718999 GGCCCCCTGGAGTTCCGGGTGGG + Intergenic
957913766 3:86659066-86659088 GTCCCCTGGGAGGTCAGTGCAGG + Intergenic
961476957 3:127153011-127153033 GTTCCCTGGGAATTCCGTGTGGG + Intergenic
971204134 4:24546131-24546153 GTCCCCAGGGAACTCTGTGGTGG + Intronic
981191715 4:141872262-141872284 GTCCCGGGGGACCTCTGTGTGGG + Intergenic
986416930 5:7538076-7538098 CTACCCTGGGAGCTCCGTGAGGG + Intronic
998106225 5:139471091-139471113 GTCCCAAGGGAGCCCTGTGTCGG + Intergenic
999199506 5:149805901-149805923 TTCCCCAGGGAGCCCAGTGTGGG + Intronic
1005762194 6:28977600-28977622 CTCCCCCGGGAGTACCATGTTGG - Intergenic
1012829646 6:104188168-104188190 CTCCCATGGGAGCTCAGTGTGGG + Intergenic
1015195788 6:130523579-130523601 CTTCCCATGGAGCTCCGTGTGGG - Intergenic
1022763365 7:33381356-33381378 GTCTCCTGGGAGCTCCTTGAGGG + Intronic
1026404129 7:70047334-70047356 ATCCCCTGTGAGCTCCGTGAGGG - Intronic
1030115650 7:106060376-106060398 GTCCTCCTGGAACTCAGTGTTGG - Intergenic
1032786637 7:135205936-135205958 GTCCCCCAGGCGGTCCATGTTGG + Exonic
1033657085 7:143381589-143381611 GTCTCCCGCGATCTCCGTTTCGG + Exonic
1035653988 8:1291757-1291779 GGCCCCCGGGGGCTCAATGTTGG - Intergenic
1048546330 8:135390848-135390870 GTCAGCCGGGAGCTCAGTGGGGG - Intergenic
1049628277 8:143636398-143636420 GTCCCTGAGGAGCGCCGTGTGGG + Intronic
1053073576 9:35115133-35115155 GTCCCCCGGGACCTCAGCTTAGG + Intronic
1061321862 9:129835710-129835732 GCCCCCAGGGAGCTCAGAGTGGG - Intronic
1061682467 9:132249864-132249886 GCCCACCGGGAGCTCCGGGAGGG - Intergenic
1185456364 X:312781-312803 GTTCCCCGTGATCTCCGTGGTGG - Exonic
1186095813 X:6100545-6100567 GTCCAGTGGGAGCTCCGTGGAGG + Intronic
1188870541 X:35365601-35365623 CTCCCATGGGAGCTCAGTGTGGG + Intergenic
1189674201 X:43444101-43444123 TTCCCCTGGGAGCTCTGTCTCGG + Intergenic
1199711344 X:150471736-150471758 TTCCACCGGGAGCACCTTGTGGG - Intronic