ID: 1136065248

View in Genome Browser
Species Human (GRCh38)
Location 16:27754219-27754241
Sequence GTAGATGCCTGGCTCTGGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136065248_1136065256 19 Left 1136065248 16:27754219-27754241 CCACGCCAGAGCCAGGCATCTAC 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1136065256 16:27754261-27754283 TCTCCTGGAGCAGTGTTGGGTGG 0: 1
1: 0
2: 2
3: 39
4: 355
1136065248_1136065253 4 Left 1136065248 16:27754219-27754241 CCACGCCAGAGCCAGGCATCTAC 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1136065253 16:27754246-27754268 GAATCTGTGAGTAGCTCTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 129
1136065248_1136065255 16 Left 1136065248 16:27754219-27754241 CCACGCCAGAGCCAGGCATCTAC 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1136065255 16:27754258-27754280 AGCTCTCCTGGAGCAGTGTTGGG 0: 1
1: 0
2: 1
3: 27
4: 321
1136065248_1136065258 23 Left 1136065248 16:27754219-27754241 CCACGCCAGAGCCAGGCATCTAC 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1136065258 16:27754265-27754287 CTGGAGCAGTGTTGGGTGGAAGG 0: 1
1: 0
2: 5
3: 34
4: 456
1136065248_1136065254 15 Left 1136065248 16:27754219-27754241 CCACGCCAGAGCCAGGCATCTAC 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1136065254 16:27754257-27754279 TAGCTCTCCTGGAGCAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 133
1136065248_1136065259 26 Left 1136065248 16:27754219-27754241 CCACGCCAGAGCCAGGCATCTAC 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1136065259 16:27754268-27754290 GAGCAGTGTTGGGTGGAAGGAGG 0: 1
1: 0
2: 7
3: 53
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136065248 Original CRISPR GTAGATGCCTGGCTCTGGCG TGG (reversed) Exonic
900363577 1:2301444-2301466 GCAGGTGCCTGGCTCTGACCTGG - Intronic
900572946 1:3368367-3368389 GTGGAGCCCTGGCTCTGGCTGGG + Intronic
901700556 1:11043052-11043074 GCAGCTGCCTGGGTCTGGCCTGG + Intronic
907297203 1:53462871-53462893 GGAGATGCCTGGCTCTCCCTGGG - Intronic
910054315 1:83012809-83012831 GTAGTTGCCTGGCAATGGCAGGG + Intergenic
920019206 1:202941330-202941352 GTAGATGCCTTGCTGAGGAGGGG + Exonic
922417833 1:225437942-225437964 CTAAATGCCTGCCTCTGGTGAGG - Intergenic
922912159 1:229226768-229226790 GTAGGTGCCTGGGTATGGTGAGG + Intergenic
924931463 1:248736345-248736367 GGAGATGCCTGGGGCTAGCGTGG + Intronic
1063094629 10:2898782-2898804 GTGAAGGCCTGGCTCTGGGGAGG + Intergenic
1067569940 10:47364245-47364267 TGAGATGCCTGGTTCTGGCCTGG - Intergenic
1071603869 10:86971619-86971641 GATGAGGCCTGGCCCTGGCGCGG + Intronic
1073095707 10:100978518-100978540 GTAGAGGCCTCCATCTGGCGTGG - Exonic
1074080289 10:110163070-110163092 GAGGAAGCCTGGCTCTGGCCCGG + Intergenic
1077056794 11:597797-597819 GGTGAAGCCTGGCCCTGGCGGGG + Intronic
1077095928 11:799102-799124 GTAGAGGCCTGGCCCCTGCGGGG - Exonic
1078876981 11:15408985-15409007 GTAGCTGCCTGGGTTTGGGGAGG - Intergenic
1090177124 11:124660659-124660681 GGAGATGTCTGGCTCTGTAGTGG - Exonic
1094492597 12:30970342-30970364 GTAAATGCCTGTCTTTGGCTTGG + Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1100326965 12:93549315-93549337 GCTGCTGCCTGGCTCTGGCCTGG + Intergenic
1102026727 12:109717942-109717964 TTAGGTGCCAGGCTCTGGCGTGG + Intronic
1104042710 12:125140804-125140826 GCAGATGGCTGGCTCTGAGGAGG + Intronic
1104849714 12:131866543-131866565 GTAGTTGACTGGGCCTGGCGCGG + Intergenic
1111192745 13:84831805-84831827 GTCTGTGCCTGGCTCTGGTGGGG - Intergenic
1115516647 14:34192121-34192143 GGAGATGCCTTGTTCTGGGGTGG - Intronic
1116927014 14:50649907-50649929 GTAGATGTTTTGCTCTGGCATGG - Intronic
1119558493 14:75571445-75571467 GTAGATGCTGGGCTCTGCCCGGG - Intergenic
1121638892 14:95472278-95472300 GAAGCTGCCTGGCTCAGGCCAGG + Intronic
1121719176 14:96097380-96097402 GTGTGTGCCTGGCTCTGGCCTGG + Intergenic
1122322995 14:100866757-100866779 GGAGATGCCTGTCTGTGGCCTGG + Intergenic
1125434345 15:39629190-39629212 GTAGATTCCTGGCGCTGGGGAGG + Intronic
1132091558 15:98951557-98951579 ATAGCTGGCTGGCTCTGGCTTGG + Intronic
1132696852 16:1205852-1205874 AAAGAAGCCTGGCTCTGGCCAGG - Intronic
1136065248 16:27754219-27754241 GTAGATGCCTGGCTCTGGCGTGG - Exonic
1136509015 16:30724435-30724457 GTAGAAGCCGGGCTCGGGAGAGG - Exonic
1137578626 16:49620527-49620549 GGACAGGCCTGGCTCTGGCCTGG + Intronic
1139364658 16:66426408-66426430 GGGGATGCCTGGCTCAGGCCGGG - Intergenic
1139807249 16:69577618-69577640 GTAGTTGCCTGGGGCTGGAGTGG + Intronic
1141250226 16:82349306-82349328 GTAAATGCCTGTTCCTGGCGTGG - Intergenic
1141744017 16:85913894-85913916 GCAGAAGCCTGGGCCTGGCGGGG - Intronic
1144684854 17:17219301-17219323 GTAGATTCCTGGCTGCGGCCAGG + Intronic
1145810699 17:27762291-27762313 GTGGGTGCCTGGCACTGGGGTGG - Intronic
1146169798 17:30624350-30624372 CTAGAAGCCTGTCGCTGGCGCGG + Intergenic
1147166387 17:38595891-38595913 GCAGATACCTGACTCTGGGGGGG - Intronic
1152552420 17:81036194-81036216 GCAGCTGCCGGGCTCAGGCGTGG - Intronic
1152587511 17:81195626-81195648 CTAGCTGCCAGGCTCTGGGGCGG - Intronic
1161926159 19:7301687-7301709 GTGGATGCCTGGGGCTGGGGAGG - Intergenic
1166360521 19:42251230-42251252 CTGGATGCCTGGGTCTGGGGAGG - Intronic
946334206 2:219026810-219026832 GTAGATGCCTGGCTCTGCTGAGG - Intronic
948781541 2:240324621-240324643 GTAAAGTCCTGGCTCTGGAGGGG - Intergenic
1171380507 20:24730767-24730789 GTAGGTGTCTGGCTCTTGTGAGG + Intergenic
1173910457 20:46665408-46665430 GTAGTTGCCTGGGACTGGGGAGG - Intronic
1174649405 20:52111784-52111806 TTAGAATCCTGGCTCTGGCTGGG + Intronic
1178894610 21:36548446-36548468 ATTGATGCCTGCCTCTGGGGCGG - Intronic
1179911083 21:44449211-44449233 GTGGGTGCCTCTCTCTGGCGTGG + Intergenic
1179933599 21:44589496-44589518 GTAGATGCCTAGAACTGGAGTGG + Intronic
1181894868 22:26098362-26098384 GAAGATGCCTGGCTCTAGACTGG + Intergenic
1183541870 22:38434083-38434105 GCTGCTGCCTGGCTCTGGCAGGG - Intronic
1184282182 22:43443477-43443499 GTAGAGGCTTGGCTCTGGTTTGG + Intronic
1184949651 22:47832271-47832293 TTAGATGCCTGACTCTGGCATGG - Intergenic
950109912 3:10412332-10412354 GGAGGTGCGTGGCTCTGGTGGGG + Intronic
953200459 3:40773793-40773815 GTAGTTGCCTGGGGCTGGGGTGG - Intergenic
955862433 3:63345662-63345684 GAAGCTGCCTGGCTTTGGCTTGG - Intronic
962933753 3:140060609-140060631 GTGGATACCTGGCTCAGGGGAGG + Intronic
966807499 3:183818548-183818570 GAAGCAGCCTGGCTCTGGAGGGG - Intronic
966834524 3:184038774-184038796 GCAGATGCCAGGCCCTGGGGAGG + Exonic
967654813 3:192034256-192034278 GTAGTTGCCAGGCTCAGGAGTGG + Intergenic
968148284 3:196318013-196318035 GTAGAGGACGGGCTGTGGCGGGG - Intronic
968741266 4:2332904-2332926 CTAGATGCCTGCCTCTGTGGGGG + Intronic
969486224 4:7473827-7473849 GAAGAGGCCTGGCTCTGGCGGGG + Intronic
971917287 4:32888949-32888971 GTAAATGCCTGCCTCTGGCAAGG + Intergenic
985001069 4:185483597-185483619 GTGGTTGCCTGGGGCTGGCGGGG - Intergenic
992828794 5:80573968-80573990 GTAGATGCTTGGGCCAGGCGTGG + Intergenic
993066135 5:83099707-83099729 TTAGATCCTTGGCTCTGGCTGGG + Intronic
995757415 5:115523217-115523239 CTAGATGCCTAGATCTGGCTTGG + Exonic
998183687 5:139962798-139962820 CTAGATGCCTGGGCCTGGAGGGG + Intronic
998199330 5:140107452-140107474 GCCGAAGCCAGGCTCTGGCGGGG - Intergenic
1000090929 5:157929166-157929188 TTAGAAGACTGGCTCTGGCCAGG - Intergenic
1001238069 5:170046391-170046413 GCAGAAGCCTGGGTTTGGCGGGG + Intronic
1007041925 6:38730312-38730334 GTAGCTGCAGGGCTCTGGAGTGG - Intronic
1007100171 6:39240576-39240598 GTAAAAGCCTGGCTCCGGAGGGG - Intergenic
1016351683 6:143176098-143176120 GGAGCTGCCAGGCTCTGGCTTGG + Intronic
1016596382 6:145806325-145806347 GGAAATCCCTGGCTCTGGCCTGG + Exonic
1019587443 7:1813143-1813165 GGAGATCCCTGGCTGTGGAGGGG + Intergenic
1019587833 7:1814544-1814566 GTGGTTGCCCAGCTCTGGCGGGG + Intergenic
1019904257 7:4048652-4048674 GCAGATGACTGCCTCTGGCCTGG - Intronic
1021141686 7:17033543-17033565 GTGGAGGCCTGGCCCTGGCCTGG - Intergenic
1022469421 7:30673127-30673149 GAAGATGGCTGGATCTGGAGTGG - Intronic
1022534353 7:31086538-31086560 GTAGGTTCCTGGCTGTGGCTTGG + Intronic
1023045832 7:36209428-36209450 GTATATGCCTAGCTCAGGCTTGG - Intronic
1024705280 7:51951044-51951066 GGAGATCCCTGGCTCTGGTTTGG + Intergenic
1037477955 8:19276231-19276253 CTAGATGCTTGGCTCTTGTGCGG - Intergenic
1042250330 8:66750376-66750398 ATAGGTGCCTGGCTCAGGCTGGG - Intronic
1044309422 8:90676510-90676532 GCAGCTGCCTGGCTCTGGTGAGG + Intronic
1044322569 8:90820950-90820972 GTAAATGCCTGGCTATTGAGAGG - Intronic
1045504719 8:102770234-102770256 GTAGATGCCAGGGCCTGGCATGG + Intergenic
1046201960 8:110938738-110938760 GTAGATGGCAGGCTATGGCCAGG + Intergenic
1047934611 8:129764604-129764626 GTAGGTGCCTGGCTATGCAGAGG + Intronic
1049230434 8:141478837-141478859 GTGGTTGCCTGGCTCTAGCAGGG + Intergenic
1051566906 9:18509917-18509939 TTAGATGCCTAGATCTGGAGTGG - Intronic
1056549150 9:87636933-87636955 CTGTGTGCCTGGCTCTGGCGGGG + Intronic
1061359886 9:130134390-130134412 GTTGGTGCCTGGCTCTGAGGAGG - Intronic
1062287906 9:135781307-135781329 GTATATGCCTGGCCCTGCCCAGG - Intronic
1186500779 X:10048771-10048793 GGAGCTGGCTGCCTCTGGCGTGG + Intronic
1192506034 X:71684453-71684475 CTTGATGACTGGCTCTGGCTGGG + Intergenic
1192520663 X:71797095-71797117 CTTGATGACTGGCTCTGGCTGGG - Intergenic
1197699609 X:129588934-129588956 ACAGATGACTGGCTCTGGCAGGG - Exonic
1199757746 X:150881084-150881106 GGAGCTGCCTGGCTGTGGCTGGG + Intronic