ID: 1136065762

View in Genome Browser
Species Human (GRCh38)
Location 16:27757290-27757312
Sequence TGGTGGGTAGGGCGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 1, 1: 1, 2: 6, 3: 88, 4: 978}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136065747_1136065762 26 Left 1136065747 16:27757241-27757263 CCCGGCTAATTCATATGTCCATC 0: 1
1: 0
2: 0
3: 20
4: 152
Right 1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG 0: 1
1: 1
2: 6
3: 88
4: 978
1136065749_1136065762 8 Left 1136065749 16:27757259-27757281 CCATCCTTAAGTCAGCCACTGTG 0: 1
1: 0
2: 0
3: 20
4: 277
Right 1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG 0: 1
1: 1
2: 6
3: 88
4: 978
1136065753_1136065762 -7 Left 1136065753 16:27757274-27757296 CCACTGTGACTCACCATGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG 0: 1
1: 1
2: 6
3: 88
4: 978
1136065748_1136065762 25 Left 1136065748 16:27757242-27757264 CCGGCTAATTCATATGTCCATCC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG 0: 1
1: 1
2: 6
3: 88
4: 978
1136065750_1136065762 4 Left 1136065750 16:27757263-27757285 CCTTAAGTCAGCCACTGTGACTC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG 0: 1
1: 1
2: 6
3: 88
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136065762 Original CRISPR TGGTGGGTAGGGCGGGAGGT GGG Intronic
900099579 1:955881-955903 AGGGGGGTAGGGTGGAAGGTGGG - Intronic
900229936 1:1551628-1551650 TGGTGGGCAGGATGGGAGCTCGG - Intronic
900300390 1:1973986-1974008 TGCTGGGAAGGGATGGAGGTGGG + Intronic
900608884 1:3536119-3536141 TGGTCTGTTGGGCGGGAGGAAGG - Intronic
900939145 1:5786673-5786695 TGGTGGTTAGGGTGGCAGGAGGG + Intergenic
900941816 1:5803805-5803827 AGGTGGGTAGGTTGGTAGGTTGG - Intergenic
901101991 1:6726231-6726253 TGGCGGGGGGTGCGGGAGGTGGG - Intergenic
901163774 1:7199738-7199760 TGGTGGCTGGGGAGGGAGGGTGG + Intronic
901458411 1:9377001-9377023 AAGGGGGTGGGGCGGGAGGTGGG + Intergenic
901497310 1:9629458-9629480 TGGTGGGTGGGGGCGGGGGTGGG - Intergenic
901634610 1:10664811-10664833 AGGTGGGGAGGGAGGGAGGGAGG - Intronic
901646741 1:10720914-10720936 TGGTAGGCAGGGCATGAGGTCGG - Intronic
901662838 1:10809506-10809528 TGGGGGCTAGGGCGGGACCTTGG + Intergenic
901686748 1:10947569-10947591 TGATGGGTCGGCCTGGAGGTGGG - Intronic
901790218 1:11650021-11650043 TGGTGGGGACGGCTGGAGGGTGG - Exonic
902130243 1:14253949-14253971 TGGTGGTTGGGGCGGGGGGTGGG + Intergenic
902183381 1:14706876-14706898 TGGTGGGGTGGCGGGGAGGTGGG - Intronic
902283039 1:15388320-15388342 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
902385258 1:16072605-16072627 TGATGGGTGGGGGTGGAGGTAGG + Intronic
902394998 1:16127731-16127753 TGGTGGGAGGAGCGGGTGGTGGG + Intronic
902542737 1:17166211-17166233 TGGTGGGCATGGTGGGTGGTGGG - Intergenic
903739371 1:25549738-25549760 TGGCGAGTAGGGCGGGTGGCGGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
904032890 1:27544152-27544174 TGTGGGATAGGGCGGGAGGCAGG + Intronic
904040267 1:27580240-27580262 TGCTGGGAAGGGGTGGAGGTGGG - Intronic
904068525 1:27773778-27773800 AGGTGGGTGGGGAGGAAGGTGGG - Intronic
904395506 1:30218813-30218835 TGCTAGGTAGGGAGGGAGATAGG + Intergenic
904491126 1:30859789-30859811 TGGTGGTGAGGGCAGGAGGGTGG - Intergenic
904622145 1:31782097-31782119 TGGGGGGCAGGGCAGGAGGGAGG - Intergenic
905011702 1:34751546-34751568 AGGTGGGAAGGGTGGAAGGTGGG - Intronic
905241276 1:36583176-36583198 TGGTGGGTAGGTGGGTGGGTGGG - Intergenic
905524062 1:38623474-38623496 TGGTGGGTGGGGGGGGGGGTAGG - Intergenic
905572638 1:39017894-39017916 TGGAGGAAAGGGCGGGAGGGGGG - Intergenic
905692905 1:39955759-39955781 AGGTGGGTGGAGTGGGAGGTAGG - Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906156908 1:43619229-43619251 GGGTGGGTGGGGTGGGAGGTGGG + Intronic
906201810 1:43965426-43965448 GGATGGGTAGGGTGGGAGGAGGG + Intronic
906262735 1:44406223-44406245 GGGTGTGGAGGGAGGGAGGTGGG + Intronic
906491130 1:46269653-46269675 TGGTGGGTATGGCAGGCAGTAGG - Intronic
906674768 1:47685272-47685294 AGAGGGGTGGGGCGGGAGGTGGG + Intergenic
907499134 1:54865790-54865812 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
907556956 1:55352451-55352473 TGGGGGGTAGTGCTGGGGGTTGG + Intergenic
907964956 1:59319872-59319894 TGGGGGGAAGGGCTGGAGGGTGG + Intronic
908427873 1:64025859-64025881 TGGGGGAAAGGGTGGGAGGTGGG + Intronic
908495432 1:64689666-64689688 TGGAGGGTAGGGCAGGTGGGAGG - Intronic
909618401 1:77639061-77639083 TGGTCGGTAGGTAGGTAGGTAGG + Intronic
910030772 1:82719967-82719989 TAGGGGGTTGGGAGGGAGGTGGG - Intergenic
910678909 1:89843229-89843251 TGGGGGGTAGGGGTGGGGGTTGG + Intronic
911678471 1:100686424-100686446 TGGCGGGAAGGGTGGGAGGGGGG - Intergenic
912313700 1:108647526-108647548 TGGTGGGGAGGAGGTGAGGTGGG + Intergenic
912391563 1:109306803-109306825 GGGTGGGGAGGCCGGGTGGTGGG - Intronic
912412553 1:109488738-109488760 TGGGGGGCAGGGAGAGAGGTGGG - Intronic
912437723 1:109673571-109673593 TGGTGGGAAGGGAGGGATGGAGG + Intronic
912471768 1:109911370-109911392 TGGCGGGTAGGGAGAGAGGCAGG - Intronic
912513341 1:110202737-110202759 TGCTGGGTTGGGGGGGGGGTGGG + Intergenic
912845880 1:113073972-113073994 TGGTTGGTGGGGCGGGGGGTGGG + Intronic
912903816 1:113681997-113682019 GGTGGGGTAGGGCAGGAGGTGGG - Intronic
912941917 1:114052785-114052807 TGGGGGAAAGGGTGGGAGGTGGG - Intergenic
912958512 1:114173958-114173980 TGCTGGGTAAAGAGGGAGGTGGG + Intergenic
913275798 1:117136707-117136729 TGGGGGGTGGGGTGGGGGGTAGG + Intergenic
914703566 1:150154009-150154031 TGGTGGAGAGGGTGGGAGATGGG - Intronic
914968455 1:152283450-152283472 TGGTGGGAAGAGTGTGAGGTGGG + Intergenic
915318227 1:155041635-155041657 TGGAGGGTGGGGTGGGATGTGGG + Intronic
915470820 1:156124725-156124747 TGCCGGGTTGGGGGGGAGGTAGG + Intronic
915530135 1:156498598-156498620 TGGGGGGAAGGGGGGGAGGGGGG - Intronic
915588740 1:156859141-156859163 GGGCGGGGAGGGCGGGAGCTGGG - Intronic
915873170 1:159583949-159583971 TGGCAGGTGGGGAGGGAGGTGGG - Intergenic
915941017 1:160118111-160118133 TGGAGAGCAGGGCGGGAGCTTGG + Intronic
916025737 1:160831838-160831860 TAATGGGTAGTGGGGGAGGTTGG + Intronic
916251460 1:162742597-162742619 TGGTGGGTGGGAGAGGAGGTAGG - Intronic
916331178 1:163619013-163619035 TGGGGGGAAGGGTGGGAGGGGGG - Intergenic
916425329 1:164674848-164674870 TGGTGGGTGGGGGGGGGGGGGGG - Intronic
916590724 1:166187552-166187574 TGGGGGGAAGGGTGGGAGGGGGG + Intergenic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916644032 1:166764360-166764382 TGTTTGGTAGGGCGAGAGGAAGG + Intergenic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917101362 1:171449156-171449178 GGGTGGGTGGGGTGGGATGTGGG - Intergenic
917642204 1:176994099-176994121 TGGTGGGTGGCGGGGGGGGTGGG - Intronic
917897939 1:179510892-179510914 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
918087642 1:181259011-181259033 TGGTGGTGGGGGTGGGAGGTGGG + Intergenic
918222854 1:182451777-182451799 TGGTTGGAAGGGCAAGAGGTGGG + Intronic
919194050 1:194260559-194260581 TTGTGGGGGGGGCGGGAGGGGGG + Intergenic
919347987 1:196411010-196411032 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
919451256 1:197775331-197775353 TGGTGGGTGGGGTGGGAGGCGGG - Intronic
919490281 1:198197949-198197971 TGGTGGGTATGGAGGAGGGTAGG + Intronic
919804398 1:201372583-201372605 TGGTGTGGAGGGCGGGCTGTTGG - Intronic
919849898 1:201665587-201665609 TGGTGGGCAGTGGGGGGGGTGGG - Intronic
919966169 1:202527692-202527714 TGGTGTTTTGGGCAGGAGGTTGG - Intronic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
921007635 1:211110952-211110974 TGGTGAGTAGGATGGGAGGAGGG + Intronic
921582063 1:216906537-216906559 TGGCTGGTAGGGAGGGAAGTAGG - Intronic
922201375 1:223404408-223404430 AGGTGGGGAGGTGGGGAGGTGGG - Intergenic
922384289 1:225066644-225066666 AGGTGGGAAGGGTGGGAGGGGGG - Intronic
922823232 1:228498683-228498705 GGGTGGTTCGGGCGGGTGGTGGG + Intergenic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
922917519 1:229270955-229270977 AGGTGGGCAGAGCGGCAGGTGGG - Intergenic
922951441 1:229561100-229561122 TGGTAGGTAAGGAGTGAGGTGGG + Intergenic
923150649 1:231230502-231230524 TGGCAGGTAGGGCAGGAGATAGG - Intronic
924155255 1:241168739-241168761 TGTTGGGGAGGTGGGGAGGTGGG - Intronic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924624753 1:245688832-245688854 GGGTGAGGAGGGCGGCAGGTGGG + Intronic
1063260986 10:4389237-4389259 TGGTGGGGAGGTGGGGAGGAGGG + Intergenic
1063415856 10:5871998-5872020 TGGAGGCAAGGGCGGCAGGTTGG - Intronic
1063497797 10:6526481-6526503 TGCTGGGTGGGGCGGCAGGGAGG + Intronic
1063805886 10:9639862-9639884 TGGTGGGAAGGGTGGCAGGATGG + Intergenic
1063830817 10:9950605-9950627 TGGTGGGTAGGGTTGGGGGAGGG - Intergenic
1064503991 10:16009631-16009653 GGGTGGGGAGGGTGGGAGGACGG + Intergenic
1064848814 10:19686760-19686782 TGGAGGGTAGGGAGTGAGGATGG + Intronic
1066269434 10:33808016-33808038 TGTAGGGTAGGGGGGGATGTGGG - Intergenic
1067102310 10:43342423-43342445 TGGAGGGCAGGGAGGGAGGGAGG + Intergenic
1067809789 10:49417875-49417897 TGGAGGGTGGGTCTGGAGGTGGG - Intergenic
1069592031 10:69648072-69648094 TGGTGGGGAGTGTGGCAGGTGGG + Intergenic
1070565408 10:77600337-77600359 TAGTGGGGAGAGCAGGAGGTGGG + Intronic
1070690692 10:78522691-78522713 TGTGGGGAAGGGCAGGAGGTAGG + Intergenic
1072190082 10:93071594-93071616 TGGTGGGCGGGGAGGGGGGTGGG - Intergenic
1072190107 10:93071683-93071705 AGGGGGGCAGGGCGGGGGGTGGG - Intergenic
1073051161 10:100668229-100668251 TGGGGGGAGGGGCGGGAGGAGGG - Intergenic
1073711252 10:106045318-106045340 TAGTGGGTGGGGTGGGGGGTGGG + Intergenic
1073768658 10:106710748-106710770 TGGTGAGAAGTGGGGGAGGTTGG - Intronic
1073897632 10:108181667-108181689 TGGGGGGCTGGGAGGGAGGTAGG - Intergenic
1074300853 10:112232288-112232310 TTGTGTGAAGGGCTGGAGGTAGG + Intergenic
1075073267 10:119333270-119333292 TGGTGGGCAGGGGGAGGGGTGGG - Intronic
1075258066 10:120940731-120940753 AGGTGGGTGTGGCGGGAGGGAGG - Intergenic
1075708829 10:124519585-124519607 TGCCGGGAAGGGTGGGAGGTAGG - Intronic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076113696 10:127880758-127880780 TGTTGGGTAGGGAAGGAAGTGGG - Intronic
1076421592 10:130335863-130335885 TGGTGGGTAGGGAGGGAGACAGG + Intergenic
1076428502 10:130384294-130384316 TGGTGGGTAGGTTGGTAGATTGG - Intergenic
1076835592 10:133019511-133019533 TGGTGCGTTGGGCGGGGGGTGGG + Intergenic
1077225142 11:1436315-1436337 AGGTGGGCAGGGCTGGAGGGAGG - Intronic
1077299283 11:1839742-1839764 GGGTGGACAGGGCAGGAGGTGGG - Intronic
1077347427 11:2070095-2070117 TGGAGGGTGGAGCGTGAGGTAGG - Intergenic
1077376035 11:2205486-2205508 AGGTGGGCAGGCTGGGAGGTGGG - Intergenic
1077376098 11:2205676-2205698 AGGTGGGCAGGCTGGGAGGTGGG - Intergenic
1077376119 11:2205740-2205762 AGGTGGGGAGGCTGGGAGGTGGG - Intergenic
1077376134 11:2205780-2205802 AGGTGGGGAGGCTGGGAGGTGGG - Intergenic
1077376269 11:2206179-2206201 AGGTGGGGAGGCTGGGAGGTGGG - Intergenic
1077798647 11:5516729-5516751 TGGTGGGTGGGGTAGGAGGAGGG - Intronic
1077859274 11:6160510-6160532 TGGGGGGTAGGGGGGCAGGGGGG + Intergenic
1077912881 11:6588022-6588044 TGGTGGTCAGTGTGGGAGGTGGG + Intronic
1078040378 11:7856110-7856132 TGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079163215 11:18013103-18013125 TGATGGGTAGGGCGCGGGGCGGG + Exonic
1079908820 11:26284035-26284057 TGGGTGGTATGGCGGGAGGAGGG + Intergenic
1080114571 11:28607233-28607255 TGGTGGGGAGGGGGAGAGGAGGG - Intergenic
1080458579 11:32435442-32435464 TGGGAGGGAGGGCGGGAAGTGGG + Exonic
1080618588 11:33967678-33967700 TGGTAGGTAGGGCTGGATGCAGG - Intergenic
1080649309 11:34209771-34209793 TGGAGGGTAGGGGTGGGGGTAGG + Intronic
1081401858 11:42653140-42653162 TGGTGGGGTGGGGGGGCGGTGGG - Intergenic
1083192376 11:61061592-61061614 GGGTGGGGCGGGAGGGAGGTGGG - Intergenic
1083275309 11:61593787-61593809 AGGAGGCTAAGGCGGGAGGTGGG - Intergenic
1083281527 11:61629768-61629790 TGGGGGGTGGGGCAGGGGGTGGG + Intergenic
1083282316 11:61634722-61634744 TGGTGGCTAGGGCAGGATGAGGG + Intergenic
1083697180 11:64450591-64450613 TGGTGGTCAGGAGGGGAGGTGGG - Exonic
1083793194 11:64999188-64999210 TGGCAGGGAGGGAGGGAGGTAGG + Intergenic
1084026322 11:66452333-66452355 TGGAGGGTATGGTGTGAGGTAGG + Intronic
1084716479 11:70877493-70877515 TGGTGGGGAGGGCAGGAGCCGGG - Intronic
1085162335 11:74360287-74360309 AGGGAGGTAGGGAGGGAGGTAGG + Intronic
1085238651 11:75033983-75034005 TGGTAGGTAGGTGGGTAGGTGGG - Intergenic
1085464261 11:76713459-76713481 TGGTGGGTAGGCAGGTAGATGGG + Intergenic
1085465447 11:76720164-76720186 AGTTGGGTAGGGCAGGACGTTGG - Intergenic
1085524873 11:77158253-77158275 TGGTGGGCAGGGTGGGAGAGTGG - Intronic
1086158246 11:83692464-83692486 TGGTGCCTAGGGCTGGAGGTAGG + Intronic
1087824476 11:102749431-102749453 TGGTGGGTAGGGGGGTGGGGGGG - Intergenic
1087860715 11:103151056-103151078 TGAGGGGTAGGACTGGAGGTAGG + Intronic
1088878494 11:113955415-113955437 TGGTAGATAGGGAGGTAGGTAGG + Intergenic
1089160219 11:116431729-116431751 AGGTGGGTAGGGTGGGATGGGGG - Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089739095 11:120569798-120569820 TGGTGGGTGGGGAGCTAGGTAGG + Intronic
1089772856 11:120815755-120815777 TGGTGGGTAGAGGGAGAGGCTGG + Intronic
1090004149 11:122984989-122985011 TGGTGGGTGGGGTGGGGGTTAGG - Intergenic
1090048504 11:123357664-123357686 TGTTGGGTGGCCCGGGAGGTAGG - Intergenic
1090697171 11:129258488-129258510 TGGTGGATAGAGTGGGAGCTCGG - Intronic
1090832870 11:130431270-130431292 TGGTGGGTGGTGGGGGTGGTGGG - Intergenic
1090939565 11:131375193-131375215 TGGTGGGCAGGTGGGGAGATAGG - Intronic
1091151621 11:133334493-133334515 TGATGGGGAGGGTGGGAGGAAGG + Intronic
1091273766 11:134335891-134335913 TGGTGGAGAGGGAGGGAGGGAGG - Intronic
1091807474 12:3366469-3366491 GGGCGGGTAGGGCGGGGGCTGGG - Intergenic
1092113327 12:5980205-5980227 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1092607330 12:10134814-10134836 TGGAGGGAAGGGCGGGAGGTGGG + Intergenic
1092846433 12:12589482-12589504 TGGTGGGTTGTGCGGCAGGAAGG + Intergenic
1092846453 12:12589554-12589576 TGGTGGGTTGTGCGGCAGGAAGG + Intergenic
1092846502 12:12589734-12589756 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092846540 12:12589898-12589920 TGGTGGGTTGTGCGGCAGGAAGG + Intergenic
1092846570 12:12590006-12590028 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092846601 12:12590134-12590156 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1092846623 12:12590226-12590248 TGGTGGGTTGTGTGGGAGGAAGG + Intergenic
1092846632 12:12590262-12590284 TGGTGGGTTGTGCGGAAGGAAGG + Intergenic
1092846641 12:12590298-12590320 TGGTGGGTTGTGTGGAAGGTTGG + Intergenic
1093390602 12:18615114-18615136 TGGGGGGAAGGGTGGGAAGTGGG - Intronic
1093896939 12:24584339-24584361 GGCTGGGTGGGGCGGGAGGGTGG - Intergenic
1095509822 12:42938666-42938688 TGCAGGGAAGGGCGGGAGGAGGG - Intergenic
1095953529 12:47794418-47794440 AGGTGGCTAGGGCCAGAGGTGGG - Intronic
1096154248 12:49332984-49333006 GGGTGGGGCGGGCAGGAGGTGGG + Exonic
1096197566 12:49658395-49658417 TGAAGGGTAGGGTGGGAGGCAGG + Intronic
1096220560 12:49826138-49826160 AGGTGGGCAGGGCTGGGGGTGGG + Intronic
1096519244 12:52174831-52174853 GGGTGTGTAGGGAGGCAGGTGGG + Intronic
1096633654 12:52945300-52945322 TGGTGGGGTGGGCTGGAGGGAGG - Intronic
1096677204 12:53232250-53232272 AGTTGGGCAGGGAGGGAGGTTGG - Exonic
1096790327 12:54040377-54040399 TGGTGGGAAGGGAGGGAGGGAGG - Intronic
1096885235 12:54711899-54711921 TGGTGGTTACGGGGGGAGGGAGG - Intergenic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097405535 12:59184961-59184983 TGGTGGGGAGTGCAGGAGATTGG + Intergenic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098710766 12:73757589-73757611 TGGGGGGGAGGGAGGGAGGGAGG + Intergenic
1099165945 12:79307602-79307624 TGGTCGGAAGGGCTGGGGGTGGG + Intronic
1099620270 12:84995194-84995216 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1100207566 12:92367206-92367228 TGGTTGGTTGGGTGGGTGGTTGG + Intergenic
1100571482 12:95847131-95847153 TGCTGGGTTGGGTGGGAGGGGGG + Intergenic
1101027185 12:100621858-100621880 TGGTGGGGAGGGAGGGTGGGGGG + Intronic
1101371054 12:104130917-104130939 GGGTGGGGAGGGCAGGCGGTGGG + Intronic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1102016085 12:109648830-109648852 TGGTGAGGAGGGAGGGAGCTGGG + Intergenic
1102598832 12:114013143-114013165 GGATGGGGAGGGAGGGAGGTGGG + Intergenic
1102754163 12:115323303-115323325 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1103195158 12:119037374-119037396 TGGTGGGGAGGCTGGGAGGCAGG + Intronic
1103908467 12:124339383-124339405 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103937322 12:124483501-124483523 TGGTGGGTAGGGGTGCAGGGAGG - Intronic
1104610205 12:130221395-130221417 TGTTGGGTGGGGGGGGGGGTTGG - Intergenic
1104647722 12:130509044-130509066 TGGTGGGGAGGGCCGGGGGCCGG - Intronic
1104729032 12:131094946-131094968 GGGTGGGTAGGGCAGGAGACGGG - Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1104964560 12:132503103-132503125 TGGGGGGTGGGGTGGGAGGCGGG - Intronic
1105649445 13:22358833-22358855 GGGTGGGGAGTGGGGGAGGTGGG - Intergenic
1106102767 13:26708723-26708745 TGGGGGAGAGGGTGGGAGGTGGG + Intergenic
1106191773 13:27459724-27459746 TGGTGGGTTGGGGGGGAAGCCGG + Intergenic
1106410116 13:29505754-29505776 TGGTGGGCAGGGGCGGCGGTCGG - Exonic
1106841666 13:33690810-33690832 TGGGCGGTGGGGGGGGAGGTGGG + Intergenic
1107203936 13:37757909-37757931 TGGTGGGTAGGGTTCAAGGTTGG + Intronic
1107414133 13:40185486-40185508 GGGTGGATAGGGCTGGAGGGAGG - Intergenic
1107888799 13:44896293-44896315 GGGTTGGGAGGGCGGGAGGAAGG - Intergenic
1108418768 13:50227814-50227836 TGGTGGGTGGGTGGGTAGGTGGG + Intronic
1109611855 13:64775814-64775836 TGGAGGAAAGGGTGGGAGGTGGG - Intergenic
1109926381 13:69145620-69145642 TGGGGGAAAGGGTGGGAGGTGGG + Intergenic
1110129506 13:71989691-71989713 TGGTGTGTGGAGTGGGAGGTGGG + Intergenic
1110486617 13:76051977-76051999 AGGTGGGGAGGTGGGGAGGTGGG - Intergenic
1111131018 13:83975694-83975716 GGGTGGGTGGGGTAGGAGGTGGG + Intergenic
1111403769 13:87775173-87775195 TGGTGAGTAAGCCTGGAGGTTGG - Intergenic
1111869468 13:93812142-93812164 TGGGGGGGGGGGCGGGGGGTGGG + Intronic
1111927488 13:94478917-94478939 TGGTGGGGAGGGCCAGAGCTGGG - Intronic
1112441419 13:99427097-99427119 CGGAGGGTAGGGTGGGAGGGAGG + Intergenic
1113093549 13:106639289-106639311 TGGTGGGGAGGCCGGGAGCTAGG + Intergenic
1113203477 13:107891709-107891731 TGGTGGGGTGGGGGGGAGGGGGG + Intergenic
1114276871 14:21154622-21154644 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1115320767 14:32077174-32077196 TGGCGGGGAGGGAGGGAGGGAGG + Intronic
1116223835 14:42122035-42122057 TGGGGGGAAGGGTGGGAGGAAGG + Intergenic
1116338125 14:43685835-43685857 AGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1117569642 14:57034050-57034072 TGGTGGTAAGGGTGAGAGGTGGG + Intergenic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118034426 14:61851053-61851075 TGGAGGGTGGGGTGGGAGGAGGG - Intergenic
1118072463 14:62260828-62260850 AGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1118098677 14:62569774-62569796 TGGTGGGTGGGGGTGGGGGTGGG + Intergenic
1118313388 14:64708807-64708829 TGGGGGGTGGGGCGGGGGGGTGG - Intronic
1118360690 14:65054078-65054100 TGCTGGGCAGGGCTGGAGGATGG + Intronic
1118389811 14:65286771-65286793 TGATGGGGAGGGAGGGCGGTGGG + Intergenic
1118469386 14:66061063-66061085 GGGTGGGTAGGTAGGTAGGTAGG + Intergenic
1119140862 14:72265938-72265960 TGGGGGGGGGGGCGGGAGGCAGG + Intronic
1119231476 14:72983342-72983364 TGGTGGGGTGGGGGGGAGGGGGG - Intronic
1119848319 14:77847192-77847214 TGGAGGGTAGAGAGTGAGGTGGG + Intronic
1120483507 14:85082318-85082340 TGGTGGGGAGGGTGGGTGGTGGG - Intergenic
1121488893 14:94343752-94343774 TGGGGGGAAGGACTGGAGGTCGG + Intergenic
1121528463 14:94636238-94636260 TGGGGGAAAGGGCGGGAGGTGGG + Intergenic
1121756430 14:96406590-96406612 GGGTTGGTAGGGCATGAGGTTGG + Intronic
1122044990 14:99016971-99016993 TTGTGGGGAGGGCAGGGGGTGGG - Intergenic
1122628140 14:103094651-103094673 TGGAGGGTAGGGCTGTGGGTGGG + Intergenic
1122737974 14:103854832-103854854 TGGAGGCTATGGAGGGAGGTAGG + Intergenic
1122857631 14:104567443-104567465 GGGTAGGAAGGGCCGGAGGTGGG + Intronic
1122898332 14:104771538-104771560 TGGAGGGCAGGGCAGGAGGGTGG + Intronic
1122916346 14:104860748-104860770 TGGTGGGTGGTGAAGGAGGTTGG - Intergenic
1123035530 14:105470310-105470332 TGCAGGTGAGGGCGGGAGGTGGG - Exonic
1124253138 15:28120668-28120690 TGGTGGGGAGGGTGTGAGGATGG + Intronic
1124636007 15:31365634-31365656 TGGGGGGTTGGGGGGGAGTTTGG + Intronic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1124930445 15:34114604-34114626 TGGCGGGTGGGGCGGGCAGTAGG - Intergenic
1125521113 15:40348361-40348383 TGCAGGGTGGGGAGGGAGGTGGG - Intergenic
1125894860 15:43293728-43293750 TGGTGGGGCGTGCGGGGGGTAGG + Intronic
1126335875 15:47585876-47585898 TGGTGGTTAGGGCTGCAGGCTGG - Intronic
1127047522 15:55043016-55043038 TGGTGGGTGGGGCAGGAGGGTGG + Intergenic
1129249620 15:74301651-74301673 TGGTGGATAGGGGGAGAGGCAGG + Intronic
1129895858 15:79105334-79105356 TGGTGGGCAGGGAGGCAGGTGGG + Intergenic
1130791991 15:87165166-87165188 TAGGGGCTAGGGCAGGAGGTGGG - Intergenic
1130821027 15:87495934-87495956 TGGAGGGTAGGTGGGGATGTAGG - Intergenic
1130957338 15:88637009-88637031 TGGTTGGAAGTGTGGGAGGTGGG + Intronic
1131071632 15:89470000-89470022 GGGTGGGAGGGGTGGGAGGTGGG + Intergenic
1131149325 15:90037048-90037070 TGGTGGGGAGGACGGGAAGTGGG + Intronic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1131464838 15:92646570-92646592 TGATGGGAAGGGTGGGGGGTTGG + Intronic
1131867275 15:96724447-96724469 TGGGGTGAAGGGCGTGAGGTTGG + Intergenic
1132202418 15:99964118-99964140 TGGTGGCCAGGAGGGGAGGTGGG - Intergenic
1132835517 16:1951046-1951068 TGGTGGGCTGGGGGTGAGGTGGG - Intronic
1133457221 16:5953112-5953134 GGGAGGGTGGGGTGGGAGGTAGG + Intergenic
1133532394 16:6667107-6667129 TGGTGGGTTGGGGGAGAGGGAGG + Intronic
1133552841 16:6874771-6874793 TGAGGGGAAGGGTGGGAGGTGGG + Intronic
1133647597 16:7778788-7778810 TGGTCAGTGGGGAGGGAGGTGGG + Intergenic
1133896791 16:9937219-9937241 TGGGGGTTGGGGCGGGAGGTGGG + Intronic
1134159283 16:11873389-11873411 TGGGGGGTACGGGGGGAGATAGG - Intronic
1134901605 16:17943241-17943263 TGGTGGATAGGGTGGGATGAAGG - Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135393852 16:22115949-22115971 GGGTGGGGAGGGAGGGAGGGAGG + Intronic
1135552399 16:23408284-23408306 GGGCGAGTGGGGCGGGAGGTAGG + Intronic
1135552409 16:23408307-23408329 GGGCGAGTGGGGCGGGAGGTAGG + Intronic
1135552418 16:23408329-23408351 GGGCGAGTGGGGCGGGAGGTAGG + Intronic
1135552445 16:23408397-23408419 GGGTGAGTGGGGCGGGAGGCAGG + Intronic
1135583680 16:23650431-23650453 TGGTGTGTGGGGAGGGAGGGAGG - Intronic
1136008144 16:27345086-27345108 GGGTGGGCAGGGGAGGAGGTGGG + Intronic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136496240 16:30646577-30646599 TGGTGGGGTGGGGGGGAGGTGGG + Intergenic
1137699667 16:50488379-50488401 TGGTGGCTAAGGCAGGAGGGTGG + Intergenic
1138083683 16:54115258-54115280 TGGGAGGAAGGGAGGGAGGTAGG - Exonic
1138186429 16:54981259-54981281 TGGTGGAAAGGGAGGGAGGCTGG - Intergenic
1138677998 16:58665740-58665762 TGGGGAGTAGGGTGGGAGGTGGG + Exonic
1138751644 16:59429948-59429970 TGCTGGGTGGGGTGGGAGGTGGG + Intergenic
1138926123 16:61593280-61593302 TGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1138940903 16:61787938-61787960 TGGTGGGGGGGGCGGGGGGAGGG + Intronic
1139209900 16:65067036-65067058 TGGTGGGGAGAGCTGGAGGGAGG + Intronic
1139433961 16:66925675-66925697 TGGCGGGTAGGGCGGGGTGTCGG - Intergenic
1139475922 16:67202532-67202554 AGGTGGGTGGGGTGGGAGCTGGG + Exonic
1139507690 16:67407363-67407385 TGGTGGGAAGGCCAGGAGCTGGG + Intronic
1139949728 16:70663117-70663139 TGGGGGCCAGGGCGGCAGGTTGG - Exonic
1140575534 16:76163781-76163803 TGGTAGGTAGGTAGGCAGGTAGG - Intergenic
1140790493 16:78386621-78386643 TGGGGGGTGGGGCGGGGGGGTGG - Intronic
1140826908 16:78715460-78715482 CGGTGGGTAGGGGTGGGGGTGGG - Intronic
1140860129 16:79010852-79010874 TGGTGAGGAGTGCGGGAGATGGG + Intronic
1141113996 16:81292917-81292939 AGGTGAGGAGGGCAGGAGGTAGG - Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141693007 16:85607062-85607084 GGGTGGGGGGGGCGGGAGGGAGG + Intergenic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1141790119 16:86228697-86228719 AGGTAGGTAGGGAGGGAGGGAGG - Intergenic
1141910730 16:87056854-87056876 GGCCGGGTAGGGCGGGAGGAGGG + Intergenic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142311626 16:89317525-89317547 TGGTGAGTGGGGCGTGAGGCTGG - Intronic
1142764860 17:2059195-2059217 TGGTCGCAAGGGCCGGAGGTAGG - Exonic
1142932254 17:3296822-3296844 TGGTGGGGATGGCGGAATGTTGG - Intergenic
1142981901 17:3677266-3677288 GGGTGGGGAGGGCAGGAGCTCGG + Intronic
1143102743 17:4513319-4513341 TGGGGGGGAAGGTGGGAGGTGGG - Intronic
1143201236 17:5115182-5115204 TGGGGGGTGGGGCGGTGGGTGGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143687737 17:8532554-8532576 TGGTGGGCAAGGATGGAGGTGGG - Intronic
1144625547 17:16842701-16842723 TGGGGGGTGGGTGGGGAGGTAGG - Intergenic
1145781984 17:27569420-27569442 TGGGGGTTAGGTGGGGAGGTGGG + Intronic
1145978845 17:28999639-28999661 TGGTGGTTTGGGCAGCAGGTAGG + Intronic
1146059604 17:29597558-29597580 TGGTGGGGAGGGCTGGGTGTTGG + Intronic
1146060533 17:29603498-29603520 TGGAGGCCAAGGCGGGAGGTTGG - Intronic
1146162701 17:30568618-30568640 TGGGGGGTGGGTGGGGAGGTAGG - Intergenic
1146550627 17:33777496-33777518 TGGTGGGCTGGGAGGGAGGTGGG - Intronic
1146674003 17:34760549-34760571 TGTTGGGTGGGGGGGGCGGTAGG - Intergenic
1146792609 17:35760953-35760975 TGGTGAGTGGGGCTGGAGGCAGG + Exonic
1146918360 17:36692610-36692632 TGGGGGGAAGGGTGGGAGGAAGG - Intergenic
1146978642 17:37138850-37138872 TGGTGAGTAATGGGGGAGGTGGG + Intronic
1147134214 17:38425862-38425884 AGGTGGGAAGGGCGGCAGGGTGG + Intergenic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147422131 17:40327108-40327130 TGGTGGGCTGGGGGTGAGGTGGG + Intronic
1147579703 17:41621397-41621419 TGGCGGGTGGGTGGGGAGGTAGG - Intronic
1147768317 17:42851417-42851439 TGGTGGGCAGGGGTGGAGATGGG + Exonic
1147846443 17:43407243-43407265 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
1147846447 17:43407251-43407273 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
1147846451 17:43407259-43407281 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
1147919287 17:43906519-43906541 TGGAGGGATGGGTGGGAGGTTGG - Intronic
1148127802 17:45245823-45245845 GGGTGGGTAGGGCAGTAGGGAGG + Intronic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148391403 17:47275653-47275675 TGGGGGGAGGGGCGGGAGCTGGG + Intronic
1148469583 17:47884926-47884948 CGGTGGGTAGGGAAGGAGCTGGG - Intergenic
1148583813 17:48762429-48762451 TGGTGGGGATGGGCGGAGGTCGG + Exonic
1148855797 17:50578686-50578708 TGGCAGGTAGGAGGGGAGGTGGG + Intronic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149409888 17:56394559-56394581 TGGTGGGGATGGCGGTAGCTGGG - Intronic
1149541469 17:57471110-57471132 TAGGGGGTAGGGTGTGAGGTGGG - Intronic
1149566441 17:57643908-57643930 TGCTGGGAAGGGTGAGAGGTTGG - Intronic
1149572197 17:57680091-57680113 TGAAGTGCAGGGCGGGAGGTGGG + Exonic
1149698965 17:58639294-58639316 TGAGGGGAAGGGTGGGAGGTGGG + Intronic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151418885 17:73984769-73984791 AGGTGGGGAGGGTGAGAGGTGGG - Intergenic
1151418897 17:73984795-73984817 AGGTGGGGAGGGTGAGAGGTGGG - Intergenic
1152303841 17:79510096-79510118 TGGTGGGTGGGCCGGGCTGTTGG - Intronic
1152314323 17:79571514-79571536 TGGTTGGGGGGGCGGGGGGTGGG - Intergenic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1152593132 17:81223255-81223277 TTGTGGGCGGGGCGTGAGGTGGG + Intergenic
1152741345 17:82019828-82019850 TGGGGGTGCGGGCGGGAGGTGGG - Intronic
1152757396 17:82092666-82092688 TGGTGAGTGGGGCGGGGGGGGGG + Intronic
1152823294 17:82448217-82448239 TGGTGGGTAGCGATGGAGGACGG + Intronic
1153301295 18:3594349-3594371 TGGTTGGGAGGGAGGGAGGGAGG - Intronic
1153320813 18:3772430-3772452 TGGGGGGGAGGGAGGGAGGGAGG - Intronic
1153564268 18:6404091-6404113 TGGGGGGAAGGGTGGGAGGAGGG + Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1153979031 18:10293914-10293936 TGGTGGGAGGGGCAGGAAGTGGG - Intergenic
1154429127 18:14294903-14294925 AGGTGGGTAGGGTGAGAAGTAGG + Intergenic
1154501755 18:15000920-15000942 GGGTGGGCAGGGCGGAGGGTGGG + Intergenic
1155028630 18:21964777-21964799 TGGGGGGGAGGGGGAGAGGTGGG - Intergenic
1155407307 18:25503058-25503080 GGCTGGGAAGGGTGGGAGGTGGG + Intergenic
1155863632 18:30936144-30936166 TGGTGTTTAGGGCTGGGGGTAGG - Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156482513 18:37445188-37445210 TGGTGGGGAGGGGAGGATGTAGG - Intronic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157132122 18:45016792-45016814 AGGTGGGGAGGTGGGGAGGTAGG - Intronic
1157157592 18:45282804-45282826 AGGGAGGTAGGGAGGGAGGTAGG - Intronic
1157472085 18:47997359-47997381 TGGTGGCTAGGGAGGGAGGCAGG + Intergenic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157810003 18:50688139-50688161 TGGTGGGGGAGGCGGCAGGTTGG + Intronic
1157945330 18:51972984-51973006 TGGTGGTTAGGGGTGGAAGTTGG - Intergenic
1158858393 18:61567478-61567500 TGTTGGGGAGGGTGGGAGGAGGG - Intergenic
1159023436 18:63161766-63161788 TGGTGTGTAGTGCGTCAGGTGGG - Intronic
1160034047 18:75285158-75285180 TGGTGGGAAGGGCAGGAACTTGG - Intronic
1160163815 18:76494298-76494320 TGTGTGGTTGGGCGGGAGGTGGG - Intronic
1160363122 18:78301124-78301146 AGGTGGGGAGGGCGGGAAGGAGG - Intergenic
1160431345 18:78814916-78814938 TGCTGGCTAGGGCGGGAGGAGGG - Intergenic
1160480079 18:79232006-79232028 TGGGGGAAAGGGTGGGAGGTGGG + Intronic
1160729015 19:632345-632367 TGGTGGTGTGGGAGGGAGGTGGG - Intronic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160919074 19:1511589-1511611 TGGTGGGGAGGGCGGGGAGGGGG - Intronic
1160933068 19:1579718-1579740 TGGTGGGTTCCGCAGGAGGTAGG - Intronic
1161051062 19:2164288-2164310 AGGAGGGGAGGCCGGGAGGTAGG - Intronic
1161103953 19:2434189-2434211 TGCTGGGCAGGGGTGGAGGTGGG - Intronic
1161141617 19:2651347-2651369 TGGAGGGAAGGGAGGGAGGGAGG - Intronic
1161141628 19:2651372-2651394 TGGAGGGAAGGGAGGGAGGGAGG - Intronic
1161168658 19:2802218-2802240 AGGTGGGTGGGTCAGGAGGTGGG - Intronic
1161200203 19:3010445-3010467 AGATGGGCAGGGCTGGAGGTTGG - Intronic
1161321404 19:3643353-3643375 TGGCGTGCAGGGCAGGAGGTCGG + Exonic
1161378425 19:3951660-3951682 TGGTGGTGAGGGCGGAAGGAAGG - Intergenic
1161592868 19:5136636-5136658 TGGTGGGCACGGCTGGGGGTGGG - Intronic
1161853301 19:6750119-6750141 TGCTGGGTGGGGTGGGGGGTCGG + Intronic
1162029847 19:7912600-7912622 GGGTGGGAAGGGCGGGGGCTTGG - Exonic
1162111849 19:8403799-8403821 GGGTGGGGAGGGCGGCAGGATGG + Exonic
1162575472 19:11496492-11496514 GGGTGGTTAGGGCGGGAGCCTGG - Intronic
1162738956 19:12763125-12763147 TGGTGGGGAGGGAGGGCGGGAGG - Exonic
1163156174 19:15440844-15440866 TGGGGGTGAGGGTGGGAGGTAGG + Intronic
1163176993 19:15571378-15571400 TGGTAGGTAGGTGGGGAGGGAGG - Intergenic
1163655458 19:18542983-18543005 TGGTGGTTGGGGTGGGGGGTGGG - Intronic
1163734146 19:18968496-18968518 TTGTGTGTAGGGTGTGAGGTAGG - Intergenic
1164289940 19:23858253-23858275 AGGTAGGTAGGGTGGGGGGTGGG + Intergenic
1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG + Intronic
1165255673 19:34576228-34576250 TGGGGGGTAGAGCTGGATGTGGG + Intergenic
1166062417 19:40334951-40334973 AGGGGGGTAGGGAGGGAGGGAGG + Intronic
1166584977 19:43937740-43937762 TGGAGGGCAGGGTGGGGGGTAGG - Intergenic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166991890 19:46697633-46697655 AGGTGGGTGGGGCTGGAGCTAGG - Intronic
1167080321 19:47273292-47273314 TGCTGGGCCGGGGGGGAGGTGGG + Intergenic
1167156782 19:47743478-47743500 TGCCGGGCAGGGCGGGAGCTGGG - Intergenic
1167792160 19:51689435-51689457 TGGCGGGGACGGCGGGAGGAAGG + Intergenic
1168380099 19:55913097-55913119 TGGTGGGGAGGGCAGGGGTTGGG - Exonic
925361471 2:3283374-3283396 GGGTGGTCAGGGCAGGAGGTGGG - Intronic
926144197 2:10386809-10386831 GGGTGGGTAGGGCCTGAGGTGGG - Intronic
926162089 2:10496206-10496228 GGTTGGGTGGGCCGGGAGGTCGG - Intergenic
927087480 2:19686294-19686316 GGGAGGGGAGGGAGGGAGGTAGG + Intergenic
927381929 2:22489260-22489282 CTATGGGTAGGGCAGGAGGTTGG + Intergenic
927413714 2:22855155-22855177 TGGTGGGGTGGGGGGCAGGTGGG + Intergenic
927670267 2:25063071-25063093 TGGTGGGTGGGGCGGGTTGGGGG - Intronic
927708295 2:25310469-25310491 TGGCGGGTAGGGCAGGCGGCAGG + Intronic
928130813 2:28648869-28648891 TGGTGGGGAGGGGCGGGGGTTGG - Intergenic
928498600 2:31862940-31862962 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
929070925 2:38029718-38029740 GGGAGGGTGGGGCAGGAGGTGGG + Intronic
929642064 2:43591439-43591461 TGGAGGGTAAAGAGGGAGGTGGG - Intronic
929875709 2:45794842-45794864 TGGTGGATGGGGGGGGGGGTAGG - Intronic
929968589 2:46553907-46553929 TTGGGGGTTTGGCGGGAGGTAGG - Intronic
930124349 2:47783891-47783913 TGGTGGGCGGGGCGGGGGGCGGG + Intronic
930570824 2:53084638-53084660 TGGTGGGAAGGGTAGGAGGAAGG + Intergenic
930771508 2:55134648-55134670 GGGTGGGTGAAGCGGGAGGTGGG + Intergenic
931038454 2:58269074-58269096 GGGGGGGTAGGGCGGGCGGGGGG - Intergenic
931115449 2:59162053-59162075 TGGTGGGGTGGGGGGGAGGGGGG - Intergenic
931391676 2:61849966-61849988 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
931528469 2:63185906-63185928 AGGTGGGGGGGCCGGGAGGTGGG - Intronic
931694535 2:64861874-64861896 TGGTGGCTTTGGAGGGAGGTAGG - Intergenic
931800151 2:65750232-65750254 TGGTGGGGGGAACGGGAGGTAGG - Intergenic
932693466 2:73933509-73933531 TGGTAGGCAAGGCGGGAGGAGGG + Intronic
932910391 2:75800206-75800228 TGGTGGGTGGGGAGGAACGTTGG + Intergenic
933206497 2:79513240-79513262 AGGTGGGGAGGGAGGGAGGCAGG - Intronic
933723062 2:85410393-85410415 TGGTGGGTGGGGCTGGTGGTTGG - Exonic
933729160 2:85444479-85444501 GGGTGAGTAGGGTGGGAGTTGGG - Intergenic
933889542 2:86754658-86754680 AGGAGGCTAAGGCGGGAGGTTGG - Intronic
934636727 2:95996231-95996253 TGGAGGGTGGGGCTGGAGGATGG - Intergenic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
934796924 2:97109193-97109215 TGGAGGGTGGGGCTGGAGGATGG + Intergenic
934836489 2:97594238-97594260 TGGAGGGTGGGGCTGGAGGACGG - Intergenic
935104444 2:100026925-100026947 TGGGGGGAAGGGTGGGAGGGTGG + Intronic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
936545315 2:113387222-113387244 TGGAGGGTGGGGCTGGAGGACGG + Intergenic
936679797 2:114757147-114757169 GGGTGGGGAGGGAGAGAGGTGGG + Intronic
936718874 2:115224517-115224539 TGGAGGGAAGGTGGGGAGGTTGG + Intronic
937135694 2:119550097-119550119 TGTTGGGGAGGGGCGGAGGTGGG + Intronic
937177705 2:119957498-119957520 GGGTTGGGAGGGTGGGAGGTGGG - Intronic
938211170 2:129466663-129466685 TGGTGGGGAGGGTGAGGGGTTGG + Intergenic
938547343 2:132346898-132346920 TGGTAGGTAGGTAGGAAGGTAGG + Intergenic
938826648 2:135012314-135012336 GGGTGGGAGGGGTGGGAGGTGGG + Intronic
938926247 2:136045241-136045263 TGGTCCGTGGGGTGGGAGGTGGG + Intergenic
939160521 2:138583177-138583199 TGGGGGGTAGGGCAGTTGGTGGG + Intergenic
939462180 2:142511336-142511358 TGGGGGGCGGGGAGGGAGGTTGG + Intergenic
940708912 2:157138476-157138498 TGAAGGGAAGGGTGGGAGGTGGG - Intergenic
940900819 2:159124855-159124877 TGGTGAGGAGGGCGGGGGGTGGG - Intronic
942246480 2:174013136-174013158 GGGTTGGGAGAGCGGGAGGTTGG - Intergenic
942460817 2:176167254-176167276 TTGTGGTTTGGGTGGGAGGTAGG + Intronic
942461040 2:176169248-176169270 GGGTGGGTAGGGCTGGTGGGGGG - Exonic
943449034 2:188025351-188025373 TGGGGGTAAGGGTGGGAGGTGGG - Intergenic
944274414 2:197819254-197819276 TAGTGGCTAGGGCTGGGGGTGGG - Intronic
944651743 2:201837403-201837425 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
944666975 2:201966988-201967010 TTGGGGGTGGGGAGGGAGGTTGG - Intergenic
946057583 2:216915699-216915721 AGGTGGGCAGGGCTGGCGGTAGG - Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946321833 2:218959142-218959164 TGGGGGGTGGGGGGCGAGGTGGG + Intergenic
946341716 2:219073773-219073795 GGGCGGGTAGGCGGGGAGGTGGG + Intergenic
946502758 2:220267213-220267235 TGGTGGGTGGGTTGGGAGGGTGG + Intergenic
947189505 2:227487731-227487753 GGGTGGGTAGGGTGGGGTGTGGG + Intronic
947325616 2:228972787-228972809 TGGGGGAAAGGGTGGGAGGTGGG - Intronic
947376395 2:229500844-229500866 CGGTGGAAAGGGCGGGAGGGGGG - Intronic
947740616 2:232483230-232483252 TGGTGGGTAGGGTGGGGGGCGGG - Intronic
948389904 2:237604582-237604604 CGGTGGGGAGGTGGGGAGGTGGG - Intergenic
948548883 2:238754114-238754136 CGGTGGGCAGGGTGGGCGGTGGG + Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
948990557 2:241551853-241551875 GGGTGGGCAGGGCAGGAAGTGGG - Intergenic
1168753398 20:299106-299128 GGGCGGGGAGGGCGGGAGGGGGG - Exonic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169113274 20:3046518-3046540 CGGTGCGTGGGGCGGGAGGCGGG + Exonic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169404675 20:5313882-5313904 TGGTGGGTGGGGTGAGTGGTGGG - Intronic
1169874205 20:10278916-10278938 AAGTGGGTGGGGCGGGGGGTGGG + Intronic
1170837251 20:19895022-19895044 TGGTGGGCAAGGCTGGAGGCAGG - Intronic
1171010842 20:21508701-21508723 TGCGGGGTGGGGCGGGGGGTGGG + Intergenic
1171022881 20:21602702-21602724 GGGTAGGGAGGGCTGGAGGTGGG + Intergenic
1171250303 20:23641128-23641150 TGGTAGGTGGGGTGTGAGGTGGG + Intergenic
1171876214 20:30579652-30579674 TGGTAGGTAGGTAGGAAGGTAGG + Intergenic
1171986011 20:31661790-31661812 TGGAGGGCAGGCCTGGAGGTGGG - Intergenic
1172037405 20:32019472-32019494 TGGTGGGTGGGGCGGGGGCAAGG - Intronic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173618132 20:44416126-44416148 TGGGGGGTGGGCCGGGAGGTCGG - Intronic
1174460408 20:50678396-50678418 TGTGGGGTGGGGTGGGAGGTGGG - Intronic
1174611135 20:51800241-51800263 TGGTGGGTGGGACGGGTTGTGGG - Intronic
1174656590 20:52177028-52177050 GGGAGGGTAGGGTGGGATGTGGG - Intronic
1174757424 20:53173730-53173752 GGGTGGGTAGGCAGGTAGGTAGG + Intronic
1175325912 20:58128501-58128523 GGATGGGTAGGTGGGGAGGTGGG + Intergenic
1175528250 20:59651827-59651849 TGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175607953 20:60327133-60327155 TGGTGGGCAGGCAGGTAGGTGGG + Intergenic
1175727810 20:61331638-61331660 AGGTGGCTGGGGCGGGAGGTGGG - Intronic
1175807586 20:61838299-61838321 TGGAGGGGAAGGCAGGAGGTGGG + Intronic
1175899464 20:62354342-62354364 GGATGGGTAGGGAGGGAGGGAGG - Intronic
1175923238 20:62459595-62459617 GGGAGGGCAGGGCGGGAGGGAGG - Intergenic
1175953386 20:62595817-62595839 TGGAGGGGCTGGCGGGAGGTGGG + Intergenic
1175973065 20:62696851-62696873 TGGGGGGTGGGGTGGGGGGTGGG + Intergenic
1175997146 20:62816998-62817020 GGGCGGGCGGGGCGGGAGGTGGG - Intronic
1176206201 20:63889544-63889566 CCGGGGGTAGGGCGGGAGGAAGG - Intronic
1176359417 21:5982601-5982623 TGGTGGGTTGGGTGGGTGGGTGG + Intergenic
1177746797 21:25224998-25225020 AGGTGGGTAGGGGGGAAGCTGGG - Intergenic
1178058036 21:28821160-28821182 TGGTGGGTGGAGTGGAAGGTTGG - Intergenic
1178584584 21:33861393-33861415 TGGGGGGTGGGGCAGGGGGTAGG + Intronic
1178631664 21:34266406-34266428 TGATGGGCAGGGAGGGAGGTGGG - Intergenic
1178920850 21:36737291-36737313 TGGTGGGTGAGGCGTGGGGTGGG - Intronic
1178934742 21:36851529-36851551 TGGGGGGCAGGGAGGTAGGTGGG + Intronic
1179030674 21:37717304-37717326 AGGTTGGGAGGGCTGGAGGTGGG + Intronic
1179217631 21:39380920-39380942 GGGTGGGTAGGGTGGGAGACAGG + Intronic
1179354116 21:40642685-40642707 GGGTGGCTAGGGTGGGAGGATGG - Intronic
1179544480 21:42105229-42105251 TGCAGGGTAGGGCCTGAGGTTGG + Intronic
1179764101 21:43555949-43555971 TGGTGGGTTGGGTGGGTGGGTGG - Intronic
1179788743 21:43743604-43743626 GGGTGGCTGGGGAGGGAGGTGGG - Intronic
1180085387 21:45505784-45505806 TGGCGGGGAGGGCGGGGGGCAGG - Intronic
1180109920 21:45643030-45643052 TGGTGGGCGGGGCGGGCCGTTGG - Intergenic
1180112150 21:45664761-45664783 TGGTGGGGTGGGGGGGAGGGGGG - Intronic
1180140999 21:45893297-45893319 TGGAGGGTGGGGCAGGAGCTGGG + Intronic
1180201887 21:46229173-46229195 TGGTGGGTGGGGCCGAAGGGCGG + Intergenic
1180712150 22:17846682-17846704 TGGAGTAGAGGGCGGGAGGTAGG - Intronic
1181031436 22:20150333-20150355 TGGTGGGTGGGGCTGGGGCTGGG + Intronic
1181031459 22:20150382-20150404 TGGTGGGTGGGGCTGGGGCTGGG + Intronic
1181761772 22:25063554-25063576 TGGGGGGAAGGTTGGGAGGTGGG + Intronic
1181792588 22:25279513-25279535 TGCTGGGTGGGGTGGGAGCTGGG - Intergenic
1181806175 22:25375739-25375761 TGGTGGGTGGGGTGGGAGGTGGG - Intronic
1182063852 22:27416779-27416801 TGGCGTGTTGGGCGGGGGGTGGG + Intergenic
1182330948 22:29551644-29551666 TGGAGGCTAGGGTGGGAGGATGG + Intronic
1182551797 22:31104728-31104750 GGGCGGGTGGGGTGGGAGGTCGG - Intronic
1182941588 22:34282235-34282257 TGGTGGGGAGAGCGGGGGGGCGG - Intergenic
1183451761 22:37899952-37899974 TGGTGGGTAGGGGGAGTGGTTGG - Intergenic
1183517918 22:38278272-38278294 TGGAGGATAGAGAGGGAGGTGGG + Intergenic
1184146379 22:42614050-42614072 TGGTGTGTTGGGCAGGAGATTGG - Intronic
1184340617 22:43883983-43884005 TGGTGGGTAGGATTGGAAGTCGG - Intronic
1184373359 22:44096805-44096827 AGGTGGGGAGGGCGGGGGCTCGG + Intronic
1184377898 22:44126007-44126029 TTGGGAGTAGGGTGGGAGGTTGG + Intronic
1184515081 22:44956840-44956862 TGATGAGAAGGGAGGGAGGTCGG - Intronic
1184672404 22:46021729-46021751 TGGTGGGAATGGCTGGAGTTGGG - Intergenic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184717454 22:46290099-46290121 GGCTGGGAAGGGTGGGAGGTTGG - Intronic
1184820171 22:46904154-46904176 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1184835339 22:47017585-47017607 AGGTGGGGAGGGAGTGAGGTGGG + Intronic
1184895665 22:47405203-47405225 TGGTGGCCAGGGCGTGAGGATGG + Intergenic
1184938031 22:47739395-47739417 TAGTGAGTGGGGTGGGAGGTGGG + Intergenic
1185020235 22:48370261-48370283 TGGTGGGTGGTGCTGGAGTTTGG + Intergenic
1185178776 22:49347444-49347466 AGGTGGGTGGGGCTGGAGCTGGG + Intergenic
1185332985 22:50260007-50260029 TGGTGTGATGGGCGGGTGGTGGG + Intronic
1185336787 22:50274609-50274631 AGGTGGGGGGGGTGGGAGGTGGG - Intergenic
949326309 3:2868839-2868861 TGGTGGGTTTGGGGGGTGGTGGG + Intronic
949487281 3:4552306-4552328 TGGTGTGTCAGGTGGGAGGTGGG - Intronic
949509704 3:4757460-4757482 TGGTGGGTAGGGGTAGGGGTGGG + Intronic
949823104 3:8136989-8137011 TGGTGGGTATAGCTGGAGGGTGG - Intergenic
949891335 3:8735732-8735754 TGGTGGGTGGGCTGGCAGGTGGG - Intronic
950337480 3:12208493-12208515 TGGTGTGTATGGTGGGAGGTAGG + Intergenic
950569343 3:13790601-13790623 TGGAGGGCGGGGCTGGAGGTGGG - Intergenic
950731559 3:14963914-14963936 TGCTGGGTGGGGAGGGGGGTAGG - Intronic
950823754 3:15792574-15792596 TGGGGGGTTGAGTGGGAGGTGGG + Intronic
951412719 3:22384288-22384310 TGGGGGGATGGGAGGGAGGTGGG + Intergenic
952968024 3:38633002-38633024 GGGTAGGCAGGGCTGGAGGTGGG + Intronic
953352204 3:42223792-42223814 TGGGGGGAAGAGAGGGAGGTGGG - Exonic
953385667 3:42504484-42504506 AGGTGGGTAGGGCTGAAGGGTGG - Intronic
953752515 3:45619818-45619840 TGGGGGGGGGGGCGGGGGGTTGG - Intronic
953810339 3:46107439-46107461 GGCTGGGGAGGGTGGGAGGTGGG + Intergenic
953903717 3:46857767-46857789 AGGTGGGTAGGAAGGGAGGGAGG + Intergenic
954349390 3:50030165-50030187 TGGTGGGTGGGGCGGGGGTGAGG + Intronic
954405856 3:50344784-50344806 GGTTGGGGAGGGCGGGAGGGAGG - Intronic
954411621 3:50373633-50373655 GGGTGGGGAGAGCGGGAGGGAGG + Intronic
954479271 3:50782781-50782803 TGGGGGGAAGGGTGGGAGGTGGG - Intronic
954582296 3:51709454-51709476 TGGGGGCTAGGGAGGGAGGCCGG + Intronic
956075077 3:65496388-65496410 CGGAGAGTAGGGCAGGAGGTGGG + Intronic
956159671 3:66335895-66335917 TGGTGGGGAGGGAAGGAGGGAGG + Intronic
956321948 3:68007601-68007623 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
956466244 3:69523374-69523396 TGGTGGGGAAGGCTGGTGGTAGG + Intronic
958049175 3:88322346-88322368 GGGTGGATAGGGAGTGAGGTGGG - Intergenic
958271810 3:91509086-91509108 TGATGGGCAGTGCGGGAGTTGGG - Intergenic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
959244104 3:103841325-103841347 AGGTAGGTAGGTCGGTAGGTAGG - Intergenic
959244110 3:103841349-103841371 AGGTAGGTAGGTCGGTAGGTAGG - Intergenic
960067683 3:113392406-113392428 TGGTGGGTGTGGCGGGGGGTGGG + Intronic
960586559 3:119325639-119325661 TGGTGGGGATGGCGGGGGTTGGG + Intronic
960865385 3:122194441-122194463 TGGTGGGTAGGGGGACAGGAAGG - Intronic
961197322 3:125013665-125013687 GGGTGTGTAGGACGGAAGGTTGG + Exonic
961411199 3:126721704-126721726 TGGTGGGGAGGGTGGGGGGTGGG - Intronic
961801334 3:129452409-129452431 TGCTGGGCAGGGCAGGGGGTTGG + Intronic
961838095 3:129681546-129681568 TGGTGGGTAGGAGGCCAGGTAGG + Intronic
962170234 3:133094211-133094233 TGGGGGGTGGGGTGGGAGGTGGG - Intronic
962237374 3:133718080-133718102 TGGTGGGAAGGGAGAGTGGTGGG + Intergenic
962571660 3:136719633-136719655 AGGTGGGTAGGTGGGTAGGTGGG + Intronic
962673176 3:137730065-137730087 TGGGGGGAAGGATGGGAGGTGGG - Intergenic
962764540 3:138549351-138549373 TGTTGGGTGGGGCGGGTAGTGGG + Intronic
963331257 3:143918961-143918983 TGGTGGGTAGGTGTGGAGGTGGG + Intergenic
963600136 3:147371718-147371740 TGGTGGGAGGGGTGGGGGGTGGG + Intergenic
964076192 3:152695102-152695124 TGGGGGAAAGGGTGGGAGGTGGG + Intergenic
964498257 3:157318500-157318522 TGGGGGGCAGAGCAGGAGGTGGG + Intronic
964626905 3:158768416-158768438 TGGTGGTGGGGGCGGGAGTTGGG + Intronic
964645818 3:158957437-158957459 TGGTGGGGTGGGGGGGAGGGGGG - Intergenic
965179537 3:165384191-165384213 TGGTGGGAGTGGTGGGAGGTTGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965474408 3:169137183-169137205 GGGTGGGTAGGAGAGGAGGTAGG + Intronic
965657462 3:171003441-171003463 TGGGGGGGAGGGTGGGAGGCGGG + Intronic
966431081 3:179832347-179832369 TGGTGGGTAGGTAGGCAGGTGGG - Intronic
966431106 3:179832451-179832473 AGGTGGGTAGGTAGGTAGGTGGG - Intronic
966431109 3:179832459-179832481 TGGTGGGTAGGTGGGTAGGTAGG - Intronic
966431146 3:179832599-179832621 TGGTGGGTAGGTGGGTAGGTAGG - Intronic
966431203 3:179832836-179832858 TGGTGGGTAGGTAGGTAGGTGGG - Intronic
966630013 3:182062027-182062049 TGGTGGGTAGGGATGGAGTTGGG + Intergenic
967046238 3:185739846-185739868 TGGGGGGTAGGGGGGGTGGGGGG - Intronic
967054755 3:185822836-185822858 TGGGGGTAGGGGCGGGAGGTGGG + Intronic
967336207 3:188347582-188347604 GGGGGGGTAGGCCGGGAGGAGGG - Intronic
967806617 3:193719727-193719749 AGGTGGGTGGGGCAGCAGGTAGG + Intergenic
967882657 3:194312959-194312981 TGGTGGGAAGGGAAGGAGGGAGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967899982 3:194440058-194440080 GGGTAGGGAGGGAGGGAGGTGGG + Intronic
967943548 3:194784682-194784704 GGGTGGGAAGGGTGGGGGGTGGG - Intergenic
968024911 3:195433094-195433116 TAGTGGGTAGTGCAGGGGGTGGG - Intronic
968095995 3:195931266-195931288 GGGTGGGTGGGGCCGGGGGTTGG - Intergenic
968227661 3:196985274-196985296 TGGTGGGGTGAGGGGGAGGTGGG + Intergenic
968558857 4:1265704-1265726 TGGTGGGTGGGGGTGGGGGTCGG - Intergenic
968616643 4:1580555-1580577 CGGGGCCTAGGGCGGGAGGTGGG - Intergenic
968647817 4:1749042-1749064 TGGTGGGGAGGGGGTGCGGTGGG - Intergenic
968948092 4:3676041-3676063 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
968948096 4:3676049-3676071 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
968948100 4:3676057-3676079 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
969330031 4:6469270-6469292 TGGTGAGAAAGGCAGGAGGTGGG + Intronic
969647959 4:8444285-8444307 TGGAGGGTTGGGGGAGAGGTGGG + Intronic
969879117 4:10158263-10158285 TGGTGGGTGGGGGTGGGGGTGGG - Intergenic
969906675 4:10403539-10403561 TGGGAGGTAGGGCGGAAGGCTGG + Intergenic
970597737 4:17615296-17615318 TGGAGGTTAGGGAGGGAGGGAGG + Intronic
970614186 4:17752324-17752346 GGATGGGTAGGACGGGAGATAGG + Intronic
971146922 4:23987574-23987596 TGGTGGGTAGGGTGGGAGTTAGG - Intergenic
971231869 4:24806695-24806717 TGGTGGGGAGGGCGATAGGCTGG + Exonic
971232198 4:24808886-24808908 TGGTAGGCTGGGCAGGAGGTTGG - Intronic
971920778 4:32936746-32936768 TGGTGGGGAGGGGGGGAGGGGGG - Intergenic
972366985 4:38385387-38385409 TTGTGGGTAGGGCCGGCAGTAGG - Intergenic
972960755 4:44448852-44448874 CCGTGGGGAGGGCGGGAGGAGGG + Intergenic
973841275 4:54863568-54863590 TGGTGGGTGGGGGTGGGGGTTGG - Intergenic
973882217 4:55284977-55284999 TGGTTGGTGGGGTGGGGGGTGGG + Intergenic
974346913 4:60693983-60694005 TGGAGGGTGGGGGGTGAGGTTGG + Intergenic
975530437 4:75394567-75394589 TGGTGGGTAGGGATGGAGAACGG + Intergenic
975612822 4:76218330-76218352 TGATGGGTAGGGGAGGAGGGAGG - Intronic
975623812 4:76321999-76322021 TTGGGGGAAGGGTGGGAGGTGGG + Intronic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
976070828 4:81237603-81237625 TGGAGGGTAGTGAGGCAGGTGGG - Intergenic
976114255 4:81710194-81710216 TGGGGGGTGAGGGGGGAGGTGGG - Intronic
976971608 4:91109336-91109358 TGGTGGGTAGGTAGAAAGGTAGG - Intronic
978572063 4:110148490-110148512 TGCGGGGGAGGGGGGGAGGTAGG + Intronic
978585144 4:110269082-110269104 TGGTGGGTGGGGTGGGGTGTGGG + Intergenic
979045062 4:115852270-115852292 TGGTGGGCAGGGGGAGGGGTAGG - Intergenic
979887559 4:126048262-126048284 TGGGGGATTGGGTGGGAGGTGGG + Intergenic
980021465 4:127714894-127714916 TGGTGGGTTGGGTGGGCAGTGGG + Intronic
981669959 4:147275392-147275414 CGGTGGGGAGGGTGGGTGGTGGG - Intergenic
982220021 4:153116297-153116319 TGGAGGGAAGTGGGGGAGGTGGG - Intergenic
982778638 4:159467264-159467286 TGTTGGGTAGGTATGGAGGTTGG - Intergenic
983383318 4:167024693-167024715 TGGCGGGAAGGGTGGGAGGTGGG + Intronic
983616892 4:169716734-169716756 TGATGGCTGGGGTGGGAGGTGGG - Intronic
983893919 4:173061152-173061174 TGGGGGGAAGGGTGGGAGGGAGG - Intergenic
984291113 4:177795722-177795744 TGGTGGTGGGGGCGGGAGGAAGG + Intronic
984345687 4:178521847-178521869 TGGGGGGAAGTGCGGGAGGGAGG - Intergenic
984401583 4:179272303-179272325 TGGTGGGGAGGCAGGGAGGCAGG + Intergenic
984675555 4:182543236-182543258 TGGAGGGAAGGGAGGGAGGAAGG + Intronic
984769759 4:183427194-183427216 TGGGGGGGGGGGCGGGGGGTGGG + Intergenic
985141633 4:186845956-186845978 TGGTGGGGAGGTAGGGGGGTGGG - Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985452968 4:190070931-190070953 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985453957 4:190074224-190074246 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985454945 4:190077517-190077539 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985456916 4:190084108-190084130 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985457904 4:190087404-190087426 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985458892 4:190090701-190090723 TGGTGGGGGGGGGGGGTGGTGGG - Intergenic
985621643 5:959270-959292 TGGGGGGCAGGGCTGGGGGTGGG - Intergenic
985629968 5:1009092-1009114 GGGCCGGTAGGGCGGGAGGGCGG + Intronic
985764523 5:1769706-1769728 TTGTGGATAGGCCTGGAGGTGGG - Intergenic
985843270 5:2325640-2325662 CGATGGGGAGGGCGGGAAGTGGG + Intergenic
986441061 5:7782210-7782232 TGGTGGGTGGAGGGGGAGCTTGG - Intronic
987302157 5:16606646-16606668 TGGTGGGTAGGGGGAGAGAAAGG - Intronic
987373469 5:17214140-17214162 TGGTGGGTGATGTGGGAGGTGGG + Intronic
987962989 5:24834473-24834495 TGGTTGGTAGGTAGGTAGGTAGG - Intergenic
988495545 5:31742527-31742549 GGGTGGGGAGGGGGGGAGTTGGG - Intronic
989559097 5:42830525-42830547 AGGTAGGTAGGGAGGGAAGTAGG - Intronic
990527045 5:56638414-56638436 TGGTGGGCAGAGCGGGAAGGTGG - Intergenic
990903332 5:60777105-60777127 AGGGGGGTTGGGGGGGAGGTGGG + Intronic
992887267 5:81170951-81170973 TGGTAGGAAGGGTGGGAGGAAGG - Intronic
993384693 5:87251048-87251070 TGGGGGGTGGCGCGGGGGGTGGG - Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
993902266 5:93592667-93592689 GGGGGGGTAGGGGGGGATGTGGG - Intronic
996399613 5:123047132-123047154 GGCTGGGAAGGGTGGGAGGTGGG + Intergenic
996919837 5:128754920-128754942 TGAAGGGTAGGGCTGCAGGTTGG - Intronic
997425641 5:133800936-133800958 AGGTGGGGAGGTGGGGAGGTGGG + Intergenic
997524666 5:134544537-134544559 AGGTGAGTGGGGCAGGAGGTGGG + Intronic
997625918 5:135330497-135330519 TGGAGGGCAGGGCGGGGGCTGGG + Intronic
997975340 5:138438788-138438810 GTGTGGGCAGGGCAGGAGGTGGG + Intergenic
998026409 5:138820024-138820046 TGGGGGGCAGGGCGGGGGGTGGG - Intronic
998141427 5:139701647-139701669 TGGTGGGTAGGAGGTGAGGGTGG - Intergenic
998167703 5:139853781-139853803 TGGGGGGTTGGGAGGGAGGTGGG + Intronic
998350657 5:141498489-141498511 TGGTGGGGAGGGAGTGAGGCAGG - Intronic
998887008 5:146705445-146705467 GGGTGGGTGGTGGGGGAGGTAGG + Intronic
999231572 5:150065144-150065166 TGGTGGGGAGGATGGGAGGAAGG - Intronic
999751671 5:154632235-154632257 TGGAGGGAAGGGAGGGAGGGAGG - Intergenic
999924347 5:156358890-156358912 TGGTGGGTGGGGAGACAGGTGGG + Intronic
1001286863 5:170430193-170430215 TGGTGTGGTGGGCGGAAGGTAGG + Intronic
1001292348 5:170472575-170472597 TGGGGGGGAGGGTGGGAGGGGGG - Intronic
1001783110 5:174387324-174387346 TGGTGGGTAAGGCATGTGGTGGG - Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002105028 5:176875812-176875834 TGGTGGGAGGGGCAGGGGGTCGG - Intronic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002466604 5:179411880-179411902 TGGTGGGGAGGGTGGAAGGTCGG - Intergenic
1002466756 5:179412229-179412251 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466767 5:179412252-179412274 TGGAGGGGAGGGTGGAAGGTCGG - Intergenic
1002466776 5:179412275-179412297 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466787 5:179412298-179412320 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466845 5:179412434-179412456 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466906 5:179412572-179412594 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1002466917 5:179412595-179412617 TGGAGGGGAGGGTGGAAGGTCGG - Intergenic
1002467026 5:179412849-179412871 TGGGGGGGAGGGTGGAAGGTCGG - Intergenic
1003105019 6:3208762-3208784 TACTGGGTAGGGCTAGAGGTAGG + Intergenic
1003301758 6:4890125-4890147 AGGTGGGTTGGGCAGGAGGCAGG + Intronic
1003348256 6:5291397-5291419 TGGAGAGTTAGGCGGGAGGTGGG + Intronic
1003362166 6:5438236-5438258 TGGGGGGGGGGGCGGGGGGTGGG - Intronic
1003821886 6:9907251-9907273 TGGTGTGTGCTGCGGGAGGTGGG - Intronic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1004015449 6:11727972-11727994 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1004594864 6:17089887-17089909 TGGGGGCAAGGGCAGGAGGTGGG - Intergenic
1004662342 6:17721550-17721572 TGGTGGGTGGGGCGGGGGCTGGG + Intergenic
1005825213 6:29628103-29628125 TGGGGGGGCGGGCGGGAGCTGGG + Intronic
1006642571 6:35496689-35496711 GGGTGGGGAGGGCGGGGGGCGGG + Intronic
1006722569 6:36167115-36167137 TGGGGGGAAGAGCGGGAGGGAGG + Intergenic
1007210410 6:40189347-40189369 GGGTGGGCAGGGTGGGTGGTGGG + Intergenic
1007400023 6:41598145-41598167 AGGTGGGAAGGTGGGGAGGTGGG - Intronic
1007957418 6:45930137-45930159 TGGGGGGTAGGTGGGGAGGAGGG - Intronic
1008944713 6:57085318-57085340 TGGTCTGTAGTGCGGTAGGTAGG - Intergenic
1008983305 6:57512048-57512070 TGATGGGCAGTGCGGGAGTTGGG + Intronic
1009171364 6:60404915-60404937 TGATGGGCAGTGCGGGAGTTGGG + Intergenic
1010259777 6:73802345-73802367 TGGTGGGTAGGCAGGCAAGTTGG + Intronic
1010378831 6:75204815-75204837 TGGTGGGTGGGAGAGGAGGTAGG - Intronic
1011212322 6:84967818-84967840 TGGTGGTTAGGGGTGGGGGTTGG - Intergenic
1011664743 6:89623019-89623041 GGGTGGGGGGGGCGGGAGGGGGG + Intronic
1013073300 6:106748678-106748700 TGGAGGGCAAGGCAGGAGGTAGG - Intergenic
1013206166 6:107947848-107947870 TGGTGGGTGGAGGGGGAGGTTGG - Intronic
1014093047 6:117427166-117427188 TGGTGGGTGGGGTGGGGGATGGG - Intronic
1015636342 6:135278733-135278755 TGGTGGGGAGGGCGAGAGGAGGG + Intergenic
1015994174 6:138980673-138980695 TTGTGGGTGGGGCGGGGGGGGGG + Intronic
1016332949 6:142972975-142972997 TGGTGGGGAGGTTGGGAGGAAGG + Intergenic
1016460014 6:144272162-144272184 GGGTGGGTATGGGGAGAGGTAGG + Intergenic
1016510983 6:144842801-144842823 GGGTGGGGAGGTGGGGAGGTGGG - Intronic
1017041106 6:150309201-150309223 AGGTAGGGAGGGAGGGAGGTAGG + Intergenic
1017708640 6:157147352-157147374 TGGCGGGCAGGGCCGGAGGCGGG - Intronic
1017708827 6:157147832-157147854 TGGCGGGCAGGGCCGGAGGCGGG - Intronic
1018621689 6:165735110-165735132 TGGTAGGTAGGTAGGTAGGTTGG + Intronic
1018621734 6:165735364-165735386 GGGTGGGTAGGTAGGTAGGTAGG + Intronic
1018834609 6:167473563-167473585 TGGTGGGGAAGGCGACAGGTGGG + Intergenic
1019059082 6:169242794-169242816 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059105 6:169242860-169242882 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059164 6:169243041-169243063 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019059181 6:169243091-169243113 TGGTGGGAAGGTGGGAAGGTGGG - Intronic
1019283339 7:211368-211390 TTGGGGGCAGGCCGGGAGGTTGG - Intronic
1019335731 7:481644-481666 GGGTGGGGAGGGGAGGAGGTTGG - Intergenic
1019477041 7:1249204-1249226 GGGTGGGCGGGGCGGGAGGGGGG + Intergenic
1019514546 7:1433998-1434020 TGGTGGCCAGGGCGGGATGTGGG - Intronic
1019668068 7:2262492-2262514 TTGTGTGTGGAGCGGGAGGTGGG + Intronic
1019713886 7:2529673-2529695 TGATGGGGATGGCGGGAGGATGG + Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020384403 7:7582005-7582027 TGGTTGGCGGGGCGGGAGGGCGG + Intronic
1020702803 7:11504308-11504330 TGATGGGAAGGGTGGGAGGAAGG + Intronic
1020865114 7:13550366-13550388 AGGTGGGTAGGGAAGAAGGTGGG + Intergenic
1021083613 7:16392810-16392832 TGTTGGGTAGGGGAGGAGGCTGG - Intronic
1021204842 7:17767682-17767704 TGGGGGGAAGGGTGGGAGGGGGG + Intergenic
1021491802 7:21227145-21227167 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1022175189 7:27865681-27865703 TGGTGGGGAGGGCTGGTGGGTGG - Intronic
1022271502 7:28812115-28812137 TGGTGGTTGGGAAGGGAGGTTGG + Intronic
1022506316 7:30910411-30910433 TGGTGGGGCAGGCAGGAGGTGGG + Intergenic
1022522842 7:31019144-31019166 GTGTGGGTAGGGCAGGAGGGAGG + Intergenic
1022624031 7:32015521-32015543 TGGTGGGTGGGGTGGGGGGCAGG - Intronic
1023159208 7:37281225-37281247 TGGGGGGAAGAGCGGGAGGGGGG + Intronic
1023413149 7:39908092-39908114 TTGTGTATAGGGTGGGAGGTGGG - Intergenic
1023596010 7:41829982-41830004 TGGTGGCCAGGAAGGGAGGTAGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1024529051 7:50375703-50375725 TGGTGGGTGGGGGGGGGGGGTGG - Intronic
1024608282 7:51040695-51040717 TGGTGGGGAGGGAGGGAGTTCGG - Intronic
1026010095 7:66629363-66629385 GGGTGGGTAGGGGTGCAGGTGGG - Intronic
1026045177 7:66902093-66902115 TGTTGGGGTGGGCGGGAGCTGGG - Intergenic
1026632958 7:72053784-72053806 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
1026882701 7:73917663-73917685 TGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1027421261 7:78019847-78019869 TGGTGGGAAGGGTCGGAGGGTGG + Exonic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1027912168 7:84264691-84264713 GGGTGGGTAGGGCGAGGGTTTGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028984557 7:96999307-96999329 GTGGGGGTAGGGCTGGAGGTGGG - Intergenic
1029410798 7:100409121-100409143 TGGTGGATAGGGAGGGATATAGG - Intronic
1029456724 7:100675512-100675534 TTCTGGGGAGGGCGGGAGGCTGG + Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030633064 7:111916956-111916978 TGGGGGAAAGGGTGGGAGGTGGG - Intronic
1030656509 7:112174013-112174035 AGGTGGGGAGGTGGGGAGGTGGG - Intronic
1030656513 7:112174021-112174043 AGGTGGGGAGGTGGGGAGGTGGG - Intronic
1031522706 7:122785836-122785858 TGGTGTGTGGGGCTTGAGGTGGG - Intronic
1032013287 7:128360497-128360519 TTCTGGCTGGGGCGGGAGGTGGG - Intronic
1032789503 7:135232112-135232134 CAGTGGTTGGGGCGGGAGGTGGG + Intronic
1032810170 7:135406294-135406316 TGGGGGGGAGGGTGGGGGGTGGG - Intronic
1033227430 7:139572900-139572922 TGGAGGGGAGGGAGGGAGGGAGG - Exonic
1033327755 7:140393466-140393488 TGTTGGTGAGGGTGGGAGGTAGG - Intronic
1033705568 7:143882636-143882658 GGGAGGGCAGGGCGGGAGGCCGG - Intronic
1034071233 7:148187930-148187952 TGATGGGTAGGGGGTGAAGTTGG - Intronic
1034264021 7:149772858-149772880 TGGAGGGAAGGGCGGGGGCTGGG - Intronic
1034381980 7:150705159-150705181 GGGTGGGAAGGGGGAGAGGTTGG + Intergenic
1034459843 7:151192209-151192231 TGGGGTATGGGGCGGGAGGTGGG + Intronic
1035270186 7:157715199-157715221 AGGTGGGGAGGGCTGGAGGCGGG + Intronic
1035299991 7:157890988-157891010 AGGTGGGGAGGTGGGGAGGTGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036213764 8:6863150-6863172 TGGTGGGGAGTGGGGGAGGCTGG + Intergenic
1037301114 8:17452969-17452991 TGGTGGGAAGTCAGGGAGGTGGG + Intergenic
1037674845 8:21043598-21043620 TGGGAGGTGGGGGGGGAGGTGGG - Intergenic
1037737803 8:21581197-21581219 TGGAGGGTAGAGCAGGAGGCAGG - Intergenic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1037895038 8:22646381-22646403 TGGAGGGAAGGGTGGGATGTGGG - Intronic
1038176267 8:25184459-25184481 GGGTGGGGAGGGCGGGAGAAAGG + Intergenic
1038240556 8:25804229-25804251 GGGTGGGTAGGTAGGTAGGTAGG - Intergenic
1038240558 8:25804237-25804259 TGGTGGGTGGGTGGGTAGGTAGG - Intergenic
1038587243 8:28801026-28801048 TGGGGGCTAGGGTGGCAGGTAGG - Intronic
1038642277 8:29338106-29338128 TGTTGGGTTGGGAGGGAGGAGGG - Intronic
1038701783 8:29855767-29855789 GGGTGGGGAGGGCTGGAGCTGGG - Intergenic
1038954363 8:32451291-32451313 TGGTGACTAGGGCAGGAGGGAGG - Intronic
1039352975 8:36782373-36782395 AGGGAGGTAGGGAGGGAGGTAGG - Intergenic
1039470912 8:37813548-37813570 TGATGGGTAGGGGGGTAGGTTGG - Intronic
1039615966 8:38955204-38955226 GGGTGGGAAGGGCAGGAGGGGGG - Intronic
1039635982 8:39166193-39166215 TGGGGGGAAGAGTGGGAGGTGGG - Intronic
1041007325 8:53508046-53508068 TGGTGGGTGGGGTGAGGGGTGGG - Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041839237 8:62249247-62249269 CGGTGGGGAGGGTGGGAGGCGGG - Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042224990 8:66508334-66508356 TGGTGGGAGGGGCTGGAGGCTGG - Intronic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1042659473 8:71137849-71137871 TGGTGGGTAGGGCAGAAAGAAGG + Intergenic
1042854050 8:73247184-73247206 GGGTGTGGAGGGTGGGAGGTGGG - Intronic
1042896883 8:73680135-73680157 TGGGGGGTGGGGGAGGAGGTGGG + Intronic
1042921680 8:73926195-73926217 TGGTGGGTAGGGTGGCAAGCTGG - Intergenic
1044298802 8:90559156-90559178 TGGTTGTTAGGGCTGGAGGAAGG + Intergenic
1044394137 8:91689551-91689573 TGGTGGGAAGAGTGGGAGGGAGG + Intergenic
1044648956 8:94474781-94474803 TGGAGCGAAGGGCGGGCGGTGGG - Intronic
1044667077 8:94641779-94641801 TGGGGGGTGGGGCGGGGGGCAGG + Intronic
1044732238 8:95238700-95238722 TGCAGGGCAGGGAGGGAGGTGGG - Intergenic
1044735663 8:95275645-95275667 TGGTGGGGAGGGAGGTAGGGAGG - Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1047832272 8:128647760-128647782 AGGTGGGCAGGGAGGGAGGCAGG - Intergenic
1048060359 8:130913320-130913342 TGGGGGGTTAGGAGGGAGGTGGG - Intronic
1048528470 8:135226247-135226269 TGGTGGGTGGGGTAGAAGGTGGG - Intergenic
1048538960 8:135324904-135324926 TGGTGGGAAGGCCTGAAGGTTGG + Intergenic
1048952884 8:139510737-139510759 GGGTGGGTAGAGGGGGTGGTAGG - Intergenic
1049009415 8:139877396-139877418 AGGTGGGAAGAGCAGGAGGTAGG - Intronic
1049055521 8:140233603-140233625 TGGTGGGGAGAGAGGGAGGGAGG - Intronic
1049222424 8:141434138-141434160 TGGGGGGTGGGGTGGGTGGTGGG + Intergenic
1049252719 8:141597747-141597769 TGGTGGCTGGGGCGGGGGGTGGG + Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050091075 9:2016679-2016701 GGGTGGCGAGGGCGGGAGGCGGG + Intronic
1050345449 9:4681414-4681436 TGGTGGGCAGTGCAGTAGGTGGG - Intronic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1050765001 9:9121666-9121688 TGGTGGGAAGTGTGGGAGGGGGG + Intronic
1051679437 9:19592477-19592499 AGGTGGGTAGGTAGGTAGGTAGG - Intronic
1051696567 9:19774188-19774210 TGGTGGGTTGGGGAGGAGGAGGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1051911947 9:22162919-22162941 TGGCGGGTAGGGGAAGAGGTTGG - Intergenic
1052306938 9:27020918-27020940 TGGTGGGAAGAGTGAGAGGTGGG - Intronic
1052685164 9:31746156-31746178 TGGGTGGTAGGGAGGGGGGTAGG - Intergenic
1052798844 9:32948834-32948856 TGGAGGGTGGGGCTGGAAGTTGG + Intergenic
1052880195 9:33597167-33597189 GGGTGGGTAGTGTGGGAAGTAGG + Intergenic
1053432634 9:38053153-38053175 TAGTGGGTAGAGCTGGAGCTGGG - Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1054962036 9:70979868-70979890 TGGTGGGGAGGGGGAGAGGAAGG + Intronic
1055107672 9:72529157-72529179 TGGCGGGTGGGGCGGTGGGTGGG + Intronic
1055113401 9:72582377-72582399 TGGTGGGCTGGGGGGAAGGTAGG - Intronic
1055420004 9:76129544-76129566 TGGTGGGTTGAGCGGGAGGTTGG + Intronic
1055520548 9:77076545-77076567 TGGTGGGGGGGTGGGGAGGTCGG - Intergenic
1055578014 9:77679264-77679286 TGTTGGGTAAGGCAGGAGATTGG + Intergenic
1056069295 9:82969274-82969296 TGGTGGGTACAGAGGGACGTGGG - Intergenic
1056170324 9:83979676-83979698 TGGTGGGTGGGGGAGGGGGTCGG - Intronic
1057207149 9:93180490-93180512 CCGTGGGTAGGGCCTGAGGTAGG - Intergenic
1057445026 9:95107712-95107734 TGGGGGTCAGGGCGGGGGGTCGG + Intronic
1057544275 9:96005659-96005681 TGGAGGGTAGGGACGCAGGTGGG + Intronic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057935932 9:99238954-99238976 TGGTGGGCAGAGCGGGGGGAGGG - Intergenic
1058220545 9:102295028-102295050 TGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220546 9:102295032-102295054 TGGTTGGTAGGTAGGTAGGTAGG - Intergenic
1058756171 9:108084820-108084842 TGGGTGGTAAGGCAGGAGGTGGG + Intergenic
1059398674 9:114054939-114054961 TGGTGGGTGGGCGGGGGGGTGGG - Exonic
1059734705 9:117089674-117089696 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
1060110378 9:120902492-120902514 CTGTGGGCAGGGCGGGGGGTGGG + Exonic
1060155154 9:121314387-121314409 TGGTGTGTATGTGGGGAGGTTGG + Intronic
1060228396 9:121809824-121809846 TGTTGGTTGGGGAGGGAGGTTGG + Intergenic
1060493268 9:124100342-124100364 TGGTGGCTTGGGAGGGAGCTGGG - Intergenic
1060722914 9:125990240-125990262 TGGAGGGTAGGCCAGGCGGTAGG - Intergenic
1060892171 9:127195834-127195856 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1061012941 9:127966059-127966081 TGGCGGGTGGGCCGGGAGGGAGG + Intronic
1061230276 9:129311934-129311956 TGGTGGGTGGGGCGGGGGGTCGG + Intergenic
1061389531 9:130309844-130309866 TGGAGGCCAGGGTGGGAGGTGGG - Intronic
1061594794 9:131621810-131621832 TGGGGGGTAGGGCGGGCGGCGGG + Exonic
1061647749 9:132019601-132019623 TTGTGGGTAGGGGGGAAGATTGG - Intronic
1062127372 9:134870803-134870825 AGGTGGGGTGGGAGGGAGGTGGG + Intergenic
1062208166 9:135348631-135348653 GGGAGGGGGGGGCGGGAGGTGGG - Intergenic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1062498734 9:136843428-136843450 GGGTGGGCAGGGCGGAGGGTGGG - Intronic
1062519788 9:136952857-136952879 TGGTGGGCAGGGGCGGCGGTGGG - Intronic
1062565933 9:137163999-137164021 TGGTGGGCAGGACTGGAGCTAGG + Intronic
1185496949 X:561882-561904 TGGTAGATAGGTCGGTAGGTAGG - Intergenic
1186099909 X:6144914-6144936 TGGGGGGTAGGGGTGGAGGGCGG + Intronic
1186137035 X:6532819-6532841 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137058 X:6532882-6532904 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137108 X:6533033-6533055 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137131 X:6533096-6533118 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137166 X:6533192-6533214 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137200 X:6533285-6533307 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137220 X:6533347-6533369 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137242 X:6533409-6533431 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137265 X:6533472-6533494 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137277 X:6533505-6533527 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137289 X:6533538-6533560 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267153 X:7844201-7844223 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267165 X:7844234-7844256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267187 X:7844296-7844318 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267197 X:7844325-7844347 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267209 X:7844358-7844380 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267232 X:7844421-7844443 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297754 X:8169208-8169230 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297766 X:8169241-8169263 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297778 X:8169274-8169296 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297790 X:8169307-8169329 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297802 X:8169340-8169362 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297814 X:8169373-8169395 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297826 X:8169406-8169428 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297838 X:8169439-8169461 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297848 X:8169468-8169490 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297860 X:8169501-8169523 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297872 X:8169534-8169556 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297884 X:8169567-8169589 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297894 X:8169596-8169618 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297906 X:8169629-8169651 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297916 X:8169658-8169680 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297928 X:8169691-8169713 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297942 X:8169728-8169750 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297954 X:8169761-8169783 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297966 X:8169794-8169816 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297980 X:8169831-8169853 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324860 X:8466568-8466590 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324894 X:8466663-8466685 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324904 X:8466692-8466714 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324953 X:8466834-8466856 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324999 X:8466960-8466982 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325012 X:8466993-8467015 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325024 X:8467026-8467048 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325056 X:8467117-8467139 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325066 X:8467146-8467168 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325095 X:8467234-8467256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325105 X:8467263-8467285 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186335251 X:8579910-8579932 TGGTAGGTAGGAAGGGAAGTAGG - Intronic
1186809511 X:13174478-13174500 TGGGGAGTAGGGTGGGAGTTGGG - Intergenic
1187147537 X:16651180-16651202 TGGTGGGAGGGGAGGGAGGGAGG + Intronic
1187223941 X:17357811-17357833 TGGGGGGTTGAGGGGGAGGTGGG - Intergenic
1187430549 X:19220271-19220293 TGGGGGGAAGAGTGGGAGGTGGG - Intergenic
1187453809 X:19423312-19423334 GGGTGGGATGGGAGGGAGGTAGG - Intronic
1187998133 X:24951340-24951362 TGGTGGGGGGGGGGGGGGGTAGG - Intronic
1188395705 X:29680549-29680571 TGGTGGGTGGGTGGGGAGGCTGG + Intronic
1188525576 X:31084339-31084361 TGGAGGGGAGGGTGGGAGGTGGG + Intergenic
1188530900 X:31139700-31139722 TGGGGGGAAGGGTGGGAGGGGGG + Intronic
1188742595 X:33804594-33804616 TGGGGGGTTGAGGGGGAGGTGGG - Intergenic
1189391503 X:40580723-40580745 TGGAGCGTAGGGCGGGTAGTCGG - Intergenic
1189689987 X:43606667-43606689 TGGATGGTGGGGAGGGAGGTGGG - Intergenic
1189988098 X:46571587-46571609 TGGAGCGGAGGGCGGGGGGTGGG + Intergenic
1190059869 X:47203695-47203717 CGGTGAGTAGGGTAGGAGGTTGG + Exonic
1190060310 X:47206571-47206593 TGGTGGGAAGTGAGGGAGGGAGG - Intronic
1190064071 X:47228679-47228701 TGGTGGGTAAGCAGGTAGGTGGG - Intronic
1190070389 X:47274433-47274455 TGGCAGGAAGGGCTGGAGGTCGG - Intergenic
1190228102 X:48561048-48561070 TGGCAGGCAGGGAGGGAGGTGGG - Exonic
1190682696 X:52841638-52841660 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1191136529 X:57070355-57070377 AGGTGGGCGGCGCGGGAGGTGGG - Intergenic
1192146016 X:68683194-68683216 TGGTGGGAAGTGGTGGAGGTAGG + Intronic
1192855534 X:75006506-75006528 TGGGGAGTTGGGCGGGAGGCGGG - Intergenic
1193253039 X:79315638-79315660 TGGGGGGTAGAGTGGGAGGGGGG - Intergenic
1193998985 X:88403496-88403518 GGGTGTGGAGGGTGGGAGGTGGG - Intergenic
1194129450 X:90062540-90062562 TGGGGGGAAGGGAGGGAGGGAGG + Intergenic
1194242572 X:91470087-91470109 TGGTGGGGAGGTGGGCAGGTGGG + Intergenic
1195018893 X:100806371-100806393 TGGAGGGAAGAGTGGGAGGTGGG - Intergenic
1195252568 X:103063494-103063516 TGGTGGGTTTGGGGGCAGGTAGG - Intronic
1195505844 X:105656094-105656116 TGGGGGGTTGGGAGGGAGGTAGG - Intronic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196767609 X:119262393-119262415 TTGGAGGTAGGGAGGGAGGTAGG + Intergenic
1196934983 X:120720754-120720776 TGGGAGGAAGGGTGGGAGGTGGG - Intergenic
1197128784 X:122979567-122979589 TGGGGGGAAGGGTGGGAGGGGGG - Intergenic
1197455197 X:126670468-126670490 GGGTGGGTAGGTGGGGAGGGAGG + Intergenic
1197774127 X:130109273-130109295 TGCTGGGGAGGTGGGGAGGTAGG - Intronic
1198436434 X:136621342-136621364 TGGTGGGTAGAGGGGGAGGTGGG - Intergenic
1198668597 X:139053000-139053022 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199827718 X:151516295-151516317 TGGTGGGGAGGGAAGGAGGGAGG + Intergenic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200165022 X:154029907-154029929 TGGTTGGGAGTGGGGGAGGTGGG + Intronic
1200258506 X:154599000-154599022 TGGGGGGTGGGGGCGGAGGTGGG - Intergenic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438475 Y:13985100-13985122 TGGTGGGTCGGGAGGCAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438543 Y:13985333-13985355 TGGTGTGTGGGGTGGGAGGGAGG - Intergenic
1201438553 Y:13985362-13985384 TGGTGGGTGGGGAGGGAGTGAGG - Intergenic
1201438598 Y:13985491-13985513 TGGTGGGTGGGCAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438636 Y:13985609-13985631 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201438657 Y:13985667-13985689 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438678 Y:13985725-13985747 TGGTGAGGAGGGAGGGAGGGGGG - Intergenic
1201445895 Y:14056983-14057005 TGGTGAGGAGGGAGGGAGGGGGG + Intergenic
1201445916 Y:14057041-14057063 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201445937 Y:14057099-14057121 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201445975 Y:14057217-14057239 TGGTGGGTGGGCAGGGAGGGAGG + Intergenic
1201446020 Y:14057346-14057368 TGGTGGGTGGGGAGGGAGTGAGG + Intergenic
1201446030 Y:14057375-14057397 TGGTGTGTGGGGTGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446098 Y:14057608-14057630 TGGTGGGTCGGGAGGCAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201774147 Y:17645917-17645939 TGGAGGCTAGGGCTGGAGGTGGG - Intergenic
1201827410 Y:18260072-18260094 TGGAGGCTAGGGCTGGAGGTGGG + Intergenic