ID: 1136066142

View in Genome Browser
Species Human (GRCh38)
Location 16:27760175-27760197
Sequence CAGAGCAGGCAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 838}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136066142 Original CRISPR CAGAGCAGGCAGAAGGAAGC AGG (reversed) Intronic
900327962 1:2119705-2119727 TACTTCAGGCAGAAGGAAGCTGG - Intronic
900371462 1:2334039-2334061 CAGAGCAGACAGAAGGCATGGGG + Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900484441 1:2914750-2914772 CAGAGCAGGATGGGGGAAGCTGG + Intergenic
900523568 1:3117558-3117580 CAAATCAAGCAGAAGGAAACCGG - Intronic
900583396 1:3420475-3420497 CCGCGCAAGCAGGAGGAAGCAGG + Intronic
900615850 1:3565372-3565394 CAGAGCAGGCACCAGGACCCGGG - Intronic
900667969 1:3828356-3828378 CACAGGAGGCGGAAGGAGGCAGG - Intronic
900853202 1:5159962-5159984 TAAAGCAGGCAGAAGAAAGTGGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
900927131 1:5712769-5712791 CACAGCAGGAAGTAAGAAGCAGG - Intergenic
901240408 1:7689760-7689782 GAGAGCATGCAGAAGGAGTCAGG - Intronic
901633168 1:10657711-10657733 CAGAGCGGGCGGGAGGAACCTGG + Intronic
901684221 1:10934809-10934831 CAGAGACGGTAGCAGGAAGCAGG - Intergenic
901880216 1:12189342-12189364 CAGTGGAGGCAACAGGAAGCAGG - Intronic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902754638 1:18541005-18541027 CAGAGCTCGAAGAAGGAAGAAGG + Intergenic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903782429 1:25829669-25829691 CAGGGCTGGCAGAACAAAGCAGG - Exonic
903857139 1:26344100-26344122 CAGCGCAGGCAGGAGAAAGCTGG - Exonic
903930474 1:26859191-26859213 CAGAGCGGGCAGGAGGTATCAGG + Intergenic
903938929 1:26915335-26915357 CAAAGCAGGCAGCAGCAAGGTGG - Intronic
904455320 1:30644281-30644303 CAGAGGAGGCTCAAGGGAGCAGG - Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
905015669 1:34776975-34776997 CAGATCAGGCAGAGGGATGGGGG - Intronic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
905249534 1:36639002-36639024 AAGAGGAGCCAGAAGCAAGCTGG - Intergenic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905417774 1:37816105-37816127 CTGGGCAGGCAGAACCAAGCAGG - Intronic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905802090 1:40850843-40850865 AAGAGCAGGCTGTAGGGAGCAGG - Intergenic
905888467 1:41504605-41504627 CTGAGCAGACAGAGGGCAGCCGG + Intergenic
906056886 1:42924633-42924655 CAGCGCAGGCGCAGGGAAGCCGG - Intergenic
906267851 1:44447835-44447857 CAGCACAGGCAGCATGAAGCAGG - Intronic
907328920 1:53658857-53658879 CAGAGTAGGCACAAAGAAGCTGG + Intronic
907364470 1:53946835-53946857 GAGAGCGGGAAGAAGGAAGGGGG + Intronic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
908346375 1:63237722-63237744 CAGTGCAGCCAGAATAAAGCAGG + Intergenic
908837841 1:68245826-68245848 CAGAGCAGTCAGTAGAATGCTGG - Intergenic
909503523 1:76362173-76362195 CAGAGCAGGAAGAAGAGAGGCGG + Intronic
910283659 1:85529669-85529691 CACAGGAGGCAGAAGTCAGCAGG - Intronic
912390350 1:109298310-109298332 CACAGCAGGCAGCTGGATGCAGG - Intronic
912959282 1:114181000-114181022 CAGACCAGGCAAAAGGGAGCAGG + Intergenic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913120651 1:115737580-115737602 AAGAGCAGGCAGAAGGGACCAGG - Intronic
913227307 1:116711478-116711500 CAAAGCAGGCAGAAAAAAGCAGG + Intergenic
913227308 1:116711492-116711514 AAAAGCAGGCAGAAGAAAGCAGG + Intergenic
913227309 1:116711506-116711528 GAAAGCAGGCAGAAGAAAGCAGG + Intergenic
913256229 1:116956549-116956571 CAGAGCAGCAGGAAGGAAGGCGG + Intronic
913332507 1:117679132-117679154 TAGAGAAGGAAGAAGAAAGCAGG - Intergenic
914206356 1:145533321-145533343 CACAGGAGGCAGAAGTCAGCAGG + Intergenic
914758549 1:150580267-150580289 CAGAGATGGGAGAAGCAAGCAGG - Intergenic
914873172 1:151492401-151492423 CAGAGAAGGAAGACTGAAGCAGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915564820 1:156707451-156707473 CAGAGATGGTGGAAGGAAGCGGG + Intergenic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
916193676 1:162203393-162203415 CAGAGCTGGGATTAGGAAGCAGG + Intronic
916354692 1:163891686-163891708 CAGAGCAAGCTAATGGAAGCTGG + Intergenic
916501307 1:165389674-165389696 GAGATCAGGCAGAAGTAAGAAGG + Intergenic
916529481 1:165642379-165642401 AGAAGCAGCCAGAAGGAAGCAGG - Intronic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918657504 1:187046481-187046503 CAAAGCAGGCAGAAGAAGGTAGG - Intergenic
919425272 1:197422026-197422048 CATAGCAGGCAGAAGCAGTCTGG - Intronic
919862944 1:201754328-201754350 CAGAGGAGGAAGAAGGAATCTGG + Intronic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920261982 1:204694548-204694570 GAGAGCAGGAAGTAGGCAGCAGG - Intergenic
920455638 1:206099098-206099120 TGGAGCAGGCAGAGAGAAGCAGG + Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921080692 1:211736641-211736663 CACTGCTGGCAGAAGGATGCTGG - Intergenic
921099506 1:211916252-211916274 AAGAGCTGGAAGAAGGAACCTGG - Intergenic
921365247 1:214367628-214367650 CAGAGCAGGCACAAGGCTACAGG + Intronic
922156915 1:223047764-223047786 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
922201200 1:223402980-223403002 CATACCAGGCAGAAGGGATCTGG - Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922935667 1:229420297-229420319 CAAGGCAGGCAGGTGGAAGCAGG - Intergenic
923073896 1:230592091-230592113 CTGAGCTGGCAGAAAGCAGCAGG + Intergenic
923116011 1:230938525-230938547 CAGAGGAGGTAGAGGGAAACAGG - Intronic
924131859 1:240917673-240917695 CAGAGAAGGCAGAAAGAGACAGG + Intronic
924615306 1:245607369-245607391 TAGAGCAGGCAGGAGCAGGCTGG - Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062903105 10:1160549-1160571 CAGGACACGCAGAACGAAGCTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063022797 10:2146551-2146573 CACAGCAGACATCAGGAAGCAGG - Intergenic
1063451762 10:6154787-6154809 CAGATCAGACAGAAGGCAGCTGG - Intronic
1064192785 10:13222181-13222203 CAGAGCAGGAAGAGAGGAGCCGG - Exonic
1066264525 10:33763042-33763064 CAGAGAAGGCATAAGGAACATGG - Intergenic
1067131574 10:43570132-43570154 CAGGGCAGGCCCAAGGAAGGAGG - Intronic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067516081 10:46945946-46945968 TAGAGGAGGCAGAAGGAATCTGG + Intronic
1067562102 10:47311357-47311379 CAGAGCAGGCTGCAGGGAGAGGG - Intronic
1067646167 10:48105864-48105886 TAGAGGAGGCAGAAGGAATCTGG - Intergenic
1067734709 10:48840586-48840608 CACACCAGTGAGAAGGAAGCGGG + Intronic
1067762546 10:49058953-49058975 CAGAGCAGGCAGACAGATGAGGG + Intronic
1068375260 10:56170067-56170089 GAAAGCAGGCACAAGGCAGCAGG + Intergenic
1068648877 10:59499701-59499723 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070737529 10:78874176-78874198 CAGCGCAGCCAGAATAAAGCAGG + Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070797933 10:79227944-79227966 GAGAGCTGGCAGAGGGAGGCTGG + Intronic
1070827977 10:79402127-79402149 CAGAGGAGGCAGAAGGTCCCTGG + Intronic
1070961856 10:80505156-80505178 AAGAGCAGGCAGCAGGGAGCGGG + Intronic
1071249374 10:83801384-83801406 CAGAGCAGCCAGAATAAAGTAGG - Intergenic
1071602356 10:86964557-86964579 CTGAGGAGGCAGAACGGAGCAGG + Intronic
1071729652 10:88234742-88234764 CAAAGCAGGCAGAACAAAGTCGG + Intergenic
1071804731 10:89105602-89105624 CAGCGCAGCTAGAATGAAGCAGG - Intergenic
1071861436 10:89677411-89677433 CAGAGCAGGAAGATAAAAGCAGG - Intergenic
1072166172 10:92815078-92815100 CAGTCCAGGCAGCAGGAAGGAGG - Intergenic
1072526902 10:96279953-96279975 CATGGGAGGCAGAAGGGAGCTGG + Intergenic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073633017 10:105167581-105167603 CAGATAAGGCAGAAGACAGCAGG + Intronic
1074018232 10:109557494-109557516 CAGAGCTTGCAGGAGGAAGTAGG - Intergenic
1074104786 10:110381242-110381264 CAGAGCATGCAGTAGGCACCTGG + Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075165736 10:120066768-120066790 CAAAGCAGGCAGAAGAAGGTCGG - Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075603241 10:123786396-123786418 CAGGGAAGGCAGCTGGAAGCAGG - Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076164099 10:128268263-128268285 CAGAGCAGGCGGGAAGAGGCAGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076525829 10:131112022-131112044 CAGGGGAGGCAGAAAGAAACAGG - Intronic
1076768883 10:132652073-132652095 CAGAGCTGAGAGAAAGAAGCTGG - Intronic
1076910188 10:133384008-133384030 CTGAGAAGGCAGAAGCAATCAGG + Exonic
1077148136 11:1054995-1055017 CGGAGCAGGCAGGTGGGAGCTGG - Intergenic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077363770 11:2153100-2153122 CAGAGAAGGCAGAAATTAGCAGG - Intronic
1077364036 11:2154385-2154407 CAGAGGAGGCAGGAGCCAGCAGG - Intronic
1077449861 11:2634025-2634047 CTGAGCAGGCAGAATGAAGCTGG - Intronic
1077455984 11:2681214-2681236 AAGAGTGGGTAGAAGGAAGCAGG + Intronic
1077551436 11:3202243-3202265 CTGAGCTGGCAGGAGGGAGCTGG + Intergenic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078280987 11:9900965-9900987 AGGTGGAGGCAGAAGGAAGCAGG - Intronic
1078535746 11:12172141-12172163 CAAAGCAGGAAGAAGGTAGATGG + Intronic
1078582026 11:12546163-12546185 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1079791972 11:24749570-24749592 CAAAGCAGGCAGAAGAAGGTAGG + Intronic
1080098919 11:28436958-28436980 TAAAGCAGGCAGAAGAAGGCGGG + Intergenic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1083712785 11:64559342-64559364 CAGAGGAGGCAGGAGGGAGACGG - Intronic
1083731522 11:64654943-64654965 CTGAGCAGGAAGTAGGCAGCAGG + Intronic
1083778080 11:64903813-64903835 GACAGCAGGCAGTGGGAAGCGGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084717434 11:70882905-70882927 CAGGGCAGGCAGGAGGCAGGTGG + Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085247605 11:75116247-75116269 CAAAGCAGGCAGAAGGTGGGTGG + Intronic
1085248928 11:75128735-75128757 GAGAGCACACAGCAGGAAGCTGG - Intronic
1085297751 11:75440441-75440463 CTGAGCATGCAGAAGGCAGGTGG - Intronic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1086612250 11:88771552-88771574 CAAAGCAGGCAGAAGAAGGTGGG - Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087625594 11:100592518-100592540 AAGAACATGCAGAAGGCAGCCGG + Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1088846310 11:113671269-113671291 GAGACCAGACAGAAGGAAGGTGG - Intergenic
1089008024 11:115108777-115108799 CAGAGCAGACACAGGGTAGCGGG - Intergenic
1089127237 11:116185177-116185199 CCTATCAGGCAGAAGCAAGCTGG - Intergenic
1089286908 11:117413159-117413181 CAGAGCCTGCTGATGGAAGCGGG - Exonic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1089887945 11:121846854-121846876 CAGAGAAGGCACAAAGAAGGTGG + Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091175705 11:133555655-133555677 CAGAGCAGGCAGATTGTTGCTGG - Intergenic
1091217904 11:133914733-133914755 CAGAACAGGAGGGAGGAAGCAGG + Intronic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092857307 12:12686216-12686238 AAGAGGTGGCACAAGGAAGCTGG + Intronic
1093090912 12:14919345-14919367 CAGATCAGGCATAAGAAACCAGG + Intronic
1093740429 12:22679384-22679406 CAAAGCAGGCAGAAGAAGGTAGG - Intronic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1094472068 12:30812133-30812155 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1094526087 12:31232159-31232181 CACTGAAGGCAGCAGGAAGCTGG + Intergenic
1094569196 12:31627003-31627025 CAGCGCAGGCAGGGGCAAGCGGG + Intergenic
1095178271 12:39118017-39118039 TAGAGGAGGCAGAAGGCAGAAGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096395481 12:51262927-51262949 AAGAGAAGGCAGAAGAAAGGGGG - Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096747632 12:53738893-53738915 GAGAGCAGGCAGAGGGCAGGAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097298637 12:57994845-57994867 CAGAGCTGGCAGAAGCACACTGG - Intergenic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1100329809 12:93572102-93572124 CAGAGCGGGCACCAGGAAGCGGG + Exonic
1100764277 12:97846212-97846234 AAGAGCAGGCAGAAGGGCTCTGG - Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101645855 12:106630372-106630394 CAGAGGAGGCGAGAGGAAGCAGG + Intronic
1101835092 12:108289429-108289451 CAGAGCAGCCAGAAAGAGGGAGG + Exonic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102587199 12:113931714-113931736 CAGAACAGGCAGAGGCCAGCAGG - Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103965393 12:124635880-124635902 CACAGAAGGCAGAAAGCAGCAGG - Intergenic
1103986583 12:124771630-124771652 CAGAGCAGGGAGTAGCACGCAGG + Intergenic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104384862 12:128341927-128341949 GAGAGAAGACAGCAGGAAGCAGG - Intronic
1104628158 12:130376936-130376958 CACAGCAGGCAGAGGAAACCAGG - Intergenic
1104700331 12:130898243-130898265 CACAGGAGAAAGAAGGAAGCCGG + Intergenic
1105356635 13:19665006-19665028 CACAGCAGGCAGAAGGCAGGCGG + Intronic
1105680832 13:22725681-22725703 CCAAGCAGGCAGCAGGCAGCAGG - Intergenic
1106355162 13:28975308-28975330 CAGGCCAGGCAGAAGCAAGTCGG - Intronic
1106901332 13:34357517-34357539 CCGAGCTGGCAGAAGACAGCCGG - Intergenic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107121502 13:36801361-36801383 CTGAGCTGGCAGAATGAGGCTGG + Intergenic
1107882283 13:44843245-44843267 CAGAGCAGGAAGGAGCCAGCGGG + Intergenic
1107965947 13:45598440-45598462 CAAAGCAAGCAGAAGGATTCTGG - Intronic
1108071787 13:46635907-46635929 CAGAGCAGATAAATGGAAGCTGG - Intronic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1109220915 13:59640021-59640043 CAGAGCAGGAGGAAGAGAGCAGG - Intergenic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1110594793 13:77308350-77308372 CATAGCAGGCTGAAGGAAAAGGG - Intronic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1111956360 13:94763046-94763068 CAAAGCAGGAAGAAAGAAGAGGG - Intergenic
1112169539 13:96956326-96956348 CAGAGCAGGAGGAAGAAAGAAGG + Intergenic
1112342536 13:98564529-98564551 AAGAGCAGAGAGGAGGAAGCTGG + Intronic
1112744538 13:102511861-102511883 ATGGCCAGGCAGAAGGAAGCTGG - Intergenic
1113096233 13:106666884-106666906 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1113350260 13:109522537-109522559 CACAGTAGGCAGAAGTGAGCTGG - Intergenic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114666511 14:24380465-24380487 CAGAGCAGTCACAAAGAAGCAGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116529150 14:45946179-45946201 TAGAGCAGAAAGAAGGAAACTGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117315821 14:54569269-54569291 CAGAGCAGCAAGAAGCGAGCCGG + Intronic
1117659087 14:57985642-57985664 GAGAGCAGGCAGGAGCAAGCTGG - Intergenic
1117991362 14:61436898-61436920 TAGAGCAGGGAGAAGGTACCAGG - Intronic
1118153129 14:63211155-63211177 CAGAGCAGGGAGTGGGAAACAGG + Intronic
1118884853 14:69858099-69858121 CAGAGCAGGCACCAGGACTCAGG + Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119934340 14:78577096-78577118 TAAAGCAGGCAGAAGAAATCAGG - Intronic
1120770038 14:88369693-88369715 GAGAGCAAGCAGAAGAAAGATGG + Intergenic
1120858271 14:89231808-89231830 AAGACCAAGCAGATGGAAGCAGG + Intronic
1120971733 14:90213593-90213615 CAGGGCAGCCACAAGGCAGCCGG - Intergenic
1121148986 14:91613536-91613558 TAGAGTAGGCAGAAGTGAGCAGG + Intronic
1121184565 14:91955135-91955157 CAGAGATGGCAGGTGGAAGCAGG - Intergenic
1121436708 14:93925437-93925459 CACAGTAGGCAGCAGGGAGCTGG + Intronic
1121780048 14:96616427-96616449 CAGAGCAGGGAGAGGCAAGGAGG + Intergenic
1121910704 14:97789825-97789847 GGGAGCAGGCAGAAAGAAACAGG + Intergenic
1122102445 14:99424329-99424351 AAGAGCAGGAAGAACGAAGCAGG + Intronic
1122751034 14:103933310-103933332 AACACAAGGCAGAAGGAAGCTGG - Intronic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123109948 14:105862224-105862246 CACAGCAGGTGGCAGGAAGCAGG - Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1124605494 15:31167565-31167587 GAGAGCAGCCAGATAGAAGCAGG - Intergenic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126192691 15:45895183-45895205 CAGAGCAGGGAGATAGAACCAGG - Intergenic
1126278832 15:46918747-46918769 CCTAGCAGGCAGACAGAAGCAGG + Intergenic
1126313897 15:47347493-47347515 CAGTGCAGGCACTAGAAAGCTGG + Intronic
1126702060 15:51377405-51377427 CAGAGCAGACAGTGGGCAGCAGG - Intronic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127797708 15:62452792-62452814 AAGGACAGGCAGAAGGGAGCAGG - Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128084451 15:64876194-64876216 CAGAGCAGTAAGAGGGAAGGAGG - Intronic
1128119254 15:65133602-65133624 CAGCGGAGGCTGAAGGAAGGGGG + Exonic
1128523021 15:68387935-68387957 TTCAGCAGGGAGAAGGAAGCGGG - Intronic
1128535371 15:68486210-68486232 CAGAGCAGGGAGGAGAAAGGTGG + Intergenic
1128716792 15:69914400-69914422 CAGAGCAGGTAGAAAGAAAAGGG - Intergenic
1129205874 15:74036707-74036729 CTGAGCAGGGAGAAGAAATCTGG - Intronic
1129275605 15:74443269-74443291 GAGGGCAGGCATGAGGAAGCCGG - Intergenic
1129599606 15:76990925-76990947 CAGGGGAGGCAGTTGGAAGCAGG - Intergenic
1129845265 15:78765208-78765230 CTGAGCTGCCAGAAAGAAGCTGG - Intronic
1130011769 15:80157881-80157903 CAGAGATGGCACAAGGGAGCTGG + Intronic
1130888700 15:88115276-88115298 CAAAGCAGGCACAAAGCAGCGGG + Intronic
1131021395 15:89102246-89102268 CAAAGGAGGCAGAAAGAAGAAGG - Intronic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131254454 15:90852830-90852852 CAGGGCAGGCAAAAGGATGTGGG + Intergenic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131602711 15:93865759-93865781 TGGAGGAGGCAGAAGGAAGTGGG + Intergenic
1132394995 15:101465889-101465911 CAGAGAAGGCAGAAAGGAGTGGG + Intronic
1132858123 16:2056546-2056568 CAGCGCAGGCTGAAGGAGGTGGG + Intronic
1132868164 16:2104018-2104040 AGGTGCAGGCAGAAGGAAGGGGG + Intronic
1133147275 16:3798123-3798145 CAGCCCAGGCAGAAGGATGCAGG + Intronic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1134022399 16:10930100-10930122 CAGAGAAGGCAGTGGGAAACGGG - Exonic
1134395220 16:13856270-13856292 GAGAGGAGGCTGAAAGAAGCTGG - Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134523610 16:14929106-14929128 AGGTGCAGGCAGAAGGAAGGGGG - Intronic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134719056 16:16370893-16370915 AGGTGCAGGCAGAAGGAAGGGGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135532695 16:23268027-23268049 CAGGACAGGCAAAAGGGAGCAGG + Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135914018 16:26587417-26587439 CAGAGGGGGCAGTAGGAATCAGG + Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1137073741 16:35935252-35935274 TTGAGCAGGCTGAAGGCAGCCGG - Intergenic
1137628895 16:49928249-49928271 CACAGCAGGTAGAAGGGAGATGG - Intergenic
1137783067 16:51114076-51114098 GAGAGCCGGGAGAAGGAAGGGGG + Intergenic
1137966567 16:52940030-52940052 GAGAGAAGGCAGAAAGAACCCGG - Intergenic
1138197244 16:55060694-55060716 CAAAGCAGGCACAGGGCAGCAGG - Intergenic
1138370862 16:56525257-56525279 CAGAGCAGGCGGAACGGGGCTGG + Intergenic
1138667984 16:58588557-58588579 CAGACCTGCCTGAAGGAAGCAGG - Intronic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1138970573 16:62138156-62138178 CAGAGGAGGCTAAGGGAAGCTGG - Intergenic
1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG + Intergenic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1141127920 16:81414388-81414410 GAGACCAGGCAGAAGGAGGTTGG - Intergenic
1141661331 16:85443203-85443225 CGGAGCAGGCAGCAGCACGCTGG - Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142140362 16:88470074-88470096 CAAAGCAAGCAGAAGGAAAAAGG + Intronic
1142157495 16:88539291-88539313 CAGCTCAGGTAGAAGGGAGCAGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142199620 16:88754855-88754877 CAGAGCAGGCAGAGACGAGCTGG + Intronic
1142253200 16:89002212-89002234 CAGAGCAGCCGGAGGGACGCAGG + Intergenic
1142324909 16:89408485-89408507 CAGAGCAGGGTGAGGGAATCTGG - Intronic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143098555 17:4491753-4491775 CAAAGCTGGCAGCAGGCAGCTGG + Intergenic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1145107202 17:20128460-20128482 GGGAGCAGGAAGCAGGAAGCAGG + Intronic
1145246340 17:21272310-21272332 GAGAGCAGCCAGAGGCAAGCAGG + Intergenic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145763166 17:27439350-27439372 CAGAGAAGGGATGAGGAAGCAGG - Intergenic
1145839609 17:27983549-27983571 CAGTTCAGGAAGAAAGAAGCAGG + Intergenic
1146138249 17:30342060-30342082 CAGAGCAGGGAGATCCAAGCTGG - Intergenic
1146891746 17:36510819-36510841 CAGGGCAGGCAGACAGCAGCAGG - Exonic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147418633 17:40311085-40311107 CAGGGATGGCAGAAGGAAGGTGG - Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147606452 17:41776418-41776440 CAGAGGAGGCGGAAGCCAGCTGG + Intronic
1147632265 17:41939739-41939761 AAGAGGAGGCTGAAGGAAGTGGG + Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147747289 17:42702599-42702621 CAGAGCAGGGAAGAGGAACCAGG + Intronic
1147894123 17:43739412-43739434 TGGAGCAGGCAGAAGAATGCAGG + Intergenic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148133148 17:45274324-45274346 CAGGGCAGGCAGTGGAAAGCAGG + Intronic
1148746701 17:49922363-49922385 GGGAGCAGGGAGTAGGAAGCAGG - Intergenic
1148995822 17:51708711-51708733 CAGTGCAGGTAGAATAAAGCAGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150375355 17:64676813-64676835 CTGAGAAGGCAGAAGGCAACTGG + Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150575482 17:66426868-66426890 GAAAGCTGGCAGAAGGAAACAGG + Intronic
1151045984 17:70919865-70919887 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
1151236907 17:72727349-72727371 CAGAACAGAAAGAAGCAAGCTGG + Intronic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151499795 17:74481442-74481464 CAGAGCAGGACGAATGATGCTGG + Intronic
1151887652 17:76932615-76932637 CCGAGCACGCAGAAGGAATGGGG - Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152520685 17:80854402-80854424 CAGCTCAGGCAGCAGGAAGCTGG + Intronic
1152805113 17:82352059-82352081 CAGAGCAGCCCGGAGGCAGCAGG - Intergenic
1153340559 18:3969748-3969770 AATAGTTGGCAGAAGGAAGCTGG - Intronic
1153759097 18:8312940-8312962 CAGCACAGGCAGAAGGAAATCGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1154982808 18:21517807-21517829 CAGCGAGGGCAGAAGAAAGCAGG - Intronic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1155108450 18:22689907-22689929 GGGAGCAGGAAGCAGGAAGCAGG + Intergenic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1156204814 18:34873850-34873872 TTGAGCAGGCCGAGGGAAGCAGG + Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156746009 18:40392167-40392189 CAGATCAGGCAGAAGGGAGAGGG - Intergenic
1157180809 18:45496458-45496480 CAAAGCAGGCAGAAGAAGGTGGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157602369 18:48902039-48902061 CTGAGCTGGCAGGAGGACGCAGG + Intergenic
1157799010 18:50603273-50603295 CACACCAGGGAGATGGAAGCTGG - Intronic
1158408182 18:57179124-57179146 AACAGAAGGCAGAAAGAAGCAGG + Intergenic
1159151601 18:64530163-64530185 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1160019922 18:75172495-75172517 GAGAGTAGGAGGAAGGAAGCGGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160301365 18:77683089-77683111 CACAGCTGCCAAAAGGAAGCGGG - Intergenic
1160381875 18:78464347-78464369 CTGAGCAGACAGAACAAAGCTGG - Intergenic
1160965609 19:1745856-1745878 GGGAGCAGGGAGAAGGAAGAAGG + Intergenic
1161531979 19:4795202-4795224 CAGCCCAGGCAGACGGGAGCAGG + Exonic
1161796837 19:6392203-6392225 CAAAACAGGCTGAATGAAGCTGG - Intronic
1162071003 19:8151963-8151985 AAGAGAGGGGAGAAGGAAGCCGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162425316 19:10591666-10591688 CAAAGCAGGCGGAAGCAGGCTGG - Intergenic
1162498680 19:11038436-11038458 CACAGCAGGCAGGAGGCACCAGG - Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1162647796 19:12062851-12062873 CAGAACCAGCAGAAGGGAGCCGG - Intergenic
1163096564 19:15062196-15062218 TGGAGCAGGCAGAAGGGAGGTGG + Intergenic
1163817276 19:19474504-19474526 CAAAACACTCAGAAGGAAGCCGG - Intronic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1164064760 19:21706389-21706411 AGGAGGAGGCAGCAGGAAGCTGG - Intergenic
1164169164 19:22709286-22709308 CCGAGGTGGCAGCAGGAAGCTGG - Intergenic
1164962531 19:32446304-32446326 GAAGGCAGGAAGAAGGAAGCAGG + Intronic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165327300 19:35121599-35121621 CAGAGCGGGGAGTAGGGAGCAGG - Intronic
1165421364 19:35723652-35723674 GAGAGAAGCCAGAAAGAAGCGGG - Intronic
1165492889 19:36135355-36135377 GGGAGCAGACAGAAGGGAGCAGG + Intergenic
1165673561 19:37701412-37701434 CAGAGCAGGTAGTAGGTAACTGG - Intronic
1165731856 19:38151036-38151058 GAGAGGAGGCAGAAGGAATCTGG - Intronic
1166103624 19:40586700-40586722 CAGGGCAGGGAGAAAGAAACAGG - Intronic
1166224864 19:41388598-41388620 TAGAGGAGGAAAAAGGAAGCAGG - Intronic
1166356166 19:42228895-42228917 CAGGGCAGGCAGAATGCAGTTGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925033612 2:670764-670786 CAGAGCTGGCAGGAGGCCGCAGG + Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
925304888 2:2841018-2841040 CAGAGAAGGCATATGGAAGAGGG + Intergenic
925474706 2:4200172-4200194 TAGAGCAGGCAGAGGACAGCAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925798315 2:7570510-7570532 CAGGGCAGGCAGCAGCAAGAAGG + Intergenic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
927229249 2:20803612-20803634 GAGAGCATGCAGAGGGAATCAGG - Intronic
927266537 2:21159190-21159212 GGGAGCAGGAAGAAGGCAGCAGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927640314 2:24841615-24841637 CACTGCAGGCAGAAGACAGCTGG + Exonic
927654335 2:24932782-24932804 CAGAGGTGGCAGATGGAAGGAGG + Intergenic
927705755 2:25295354-25295376 CAGAGCCGGCAACAGGAAACAGG - Intronic
927843981 2:26461997-26462019 GAGAGGAGGCAGAGGGAAGGTGG - Intronic
927946338 2:27137365-27137387 GAGAAAAGGCCGAAGGAAGCAGG - Exonic
928298288 2:30104430-30104452 CAGAGCAGGCAGGTGGGAACTGG - Intergenic
928845728 2:35669524-35669546 CAGAGCGGACAGAATAAAGCAGG - Intergenic
929168125 2:38904255-38904277 CAGACCAGGCAGCAGGGAGAAGG + Intronic
929570913 2:43022318-43022340 CAGGGCAGTCAGAATGAAGGCGG + Intergenic
929578037 2:43064895-43064917 CAGAGCAGGAATAAAGCAGCAGG - Intergenic
929811582 2:45193368-45193390 AAAGGAAGGCAGAAGGAAGCAGG + Intergenic
930058756 2:47272018-47272040 CAGAGCCTGCAGAAGTAAACAGG + Intergenic
930068665 2:47347703-47347725 GAGAGGAGGTACAAGGAAGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
930715456 2:54589775-54589797 CAGAGCAGGAAGCCGGAAACAGG - Intronic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931392417 2:61855171-61855193 AAGAGCAGCCTGAAGGAAGTGGG - Intergenic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
931982287 2:67706902-67706924 CAGAGAGGGAAGAAGAAAGCAGG - Intergenic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
933599961 2:84318887-84318909 GAGAGCAGGCAAAGGGGAGCAGG + Intergenic
933654663 2:84877848-84877870 CAGACCAGCCACAATGAAGCTGG + Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933969904 2:87461933-87461955 CAGAGCAGGCAGATGGTCACAGG + Intergenic
934095325 2:88596712-88596734 GAGAGCAGGCAGAAGGTAAGAGG + Intronic
934653140 2:96103782-96103804 GAGTGCAGGCAAAAGGAACCAGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934913541 2:98279756-98279778 CTCAGAAGGCAGGAGGAAGCCGG - Intronic
934977817 2:98817592-98817614 CAGAGAAGGCAGGTGGTAGCTGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935978769 2:108606017-108606039 CAGAGCTGGCAGCAGGAACCTGG - Intronic
936024119 2:109018277-109018299 CAAAGCAGGATGGAGGAAGCAGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936323877 2:111488563-111488585 CAGAGCAGGCAGATGGTCACAGG - Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936514684 2:113174226-113174248 CAGAGCAGGAAGGGGGAAGGAGG - Intronic
936760726 2:115778019-115778041 CAGAGCAGGAAGGAGCAAGCAGG - Intronic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939470582 2:142615562-142615584 CAGAGCAAGCAGAAGCAATGTGG + Intergenic
941036657 2:160576094-160576116 CAGCACAGGCAGAGGCAAGCTGG + Intergenic
941043503 2:160648588-160648610 CAGAGCTGGCAGGAGCAGGCAGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941430523 2:165408808-165408830 CAGACCAAGCAGAAATAAGCAGG + Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941672008 2:168304248-168304270 CAGAGCAGCTAGAATAAAGCAGG + Intergenic
941751461 2:169139265-169139287 CAGAGCAGGCAAAAGGGAGCCGG + Exonic
941822979 2:169861084-169861106 CAGAGCAGCTAGAAAAAAGCAGG - Intronic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
942244764 2:173997435-173997457 CTGAGCAGCCAGAAGCATGCAGG - Intergenic
942462718 2:176179373-176179395 GAGAGAAGGCTGAAGGAAGAGGG - Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944886942 2:204072661-204072683 CTGATCAGGGAGAAGCAAGCAGG + Intergenic
945111242 2:206361862-206361884 CAGAGGATGCAGAAGGTAGTGGG - Intergenic
945203775 2:207310509-207310531 CAGAGCAGCCAGAGCCAAGCAGG + Intergenic
945743381 2:213690650-213690672 CAGTGCAGGTAGAACAAAGCAGG + Intronic
946026238 2:216673443-216673465 CAGGGCAGGCTGGAGGAAGGAGG + Exonic
946209842 2:218138693-218138715 CAGATCAGGCAGAAAGGTGCTGG - Intergenic
946537951 2:220651746-220651768 CTGAGAGGGAAGAAGGAAGCCGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
947316352 2:228863546-228863568 CAGAGAAGGCTGAAGGGAACAGG - Intronic
947432426 2:230042849-230042871 TATAGCAGGGAGAAGGAAGTGGG - Intronic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947576956 2:231283151-231283173 CAGAGCAGGGAGAAAAAAGACGG + Intronic
947927659 2:233935776-233935798 TGGGGCAGGCAGAAGGAAGCTGG + Intronic
948348528 2:237319519-237319541 CAGTGCAGCCAGAAAAAAGCAGG + Intergenic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948914415 2:241025095-241025117 CACAGCAGGCAGCAAGCAGCAGG + Intronic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168840189 20:905089-905111 CCTAGAAGTCAGAAGGAAGCTGG - Intronic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169707263 20:8519493-8519515 GAGAGCAGGCAGGATGAAGAGGG - Intronic
1169928272 20:10805759-10805781 AAGAGCAGCCAGAAGCAGGCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170601183 20:17842974-17842996 GAAAGCAGGCAGAGGGATGCTGG - Intergenic
1170757936 20:19221293-19221315 CAGAGCAGGCCAGAGGAATCTGG - Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171120731 20:22567299-22567321 CATAGAAGGCTGAAGAAAGCGGG - Intergenic
1171299166 20:24044205-24044227 CATAGCAGGCATAAGAAAACAGG + Intergenic
1171307677 20:24120072-24120094 CTGAGCAGGCTGAAGGATCCTGG + Intergenic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172161473 20:32871783-32871805 CAGAACAGGAAGAAGGACACTGG - Intronic
1172447807 20:35002281-35002303 CAGGGAAGGCTGAAGGCAGCAGG - Exonic
1172842660 20:37911445-37911467 CAGAGCAGCCAGAACACAGCGGG + Intronic
1173141814 20:40491371-40491393 CAAAGCAGGAAGTAGGAAACGGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173916740 20:46713659-46713681 CACAGCAGCCAGAAGGATTCTGG - Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174288397 20:49488860-49488882 TAGAGCAGGCAGAAGAAGGTGGG + Intergenic
1174402766 20:50284825-50284847 CTGTGCAGGCAGCAGGAAGCTGG - Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175255856 20:57646830-57646852 CAGTGCAGCCAGTAGGAAACAGG - Intergenic
1175411944 20:58776300-58776322 CCGAGCAGGCAGAGAGAAGGTGG - Intergenic
1175529702 20:59666069-59666091 CACAACAGGCAGATGGAAGCTGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1176024177 20:62977472-62977494 CAGTCCAGCCAGGAGGAAGCTGG + Intergenic
1176511117 21:7748876-7748898 CTGGGCAGGAAGAAAGAAGCAGG - Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176678486 21:9803595-9803617 CAGAGCAGGCCCTAGAAAGCTGG + Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1178480829 21:32978168-32978190 CAAAGCAGGCAGAAAGAAACAGG - Intergenic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1178645231 21:34379405-34379427 CTGGGCAGGAAGAAAGAAGCAGG - Intronic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179732381 21:43374989-43375011 CATAGCAGAAAGAAGGGAGCCGG - Intergenic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1180060483 21:45382526-45382548 CTGAGGAGGAAGAAGGAAACAGG + Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181376711 22:22464526-22464548 CAGAGCAGGCCGTTGGAGGCTGG + Intergenic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1181911000 22:26238154-26238176 CAGAGCAGGCAGAAGGGCAAAGG + Intronic
1182296707 22:29314498-29314520 AAGAGCAGGCAGGATTAAGCAGG - Intronic
1182321142 22:29479325-29479347 CTGAACAGGCAGGAGAAAGCTGG - Intergenic
1182426913 22:30278441-30278463 CAGGGCAGGAAGATGGAAGGTGG + Intergenic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182771794 22:32801704-32801726 CAGAGCGGGCAGCAGGCAGGCGG + Exonic
1183301713 22:37062056-37062078 CAGAGCAGGCAGAAAAGAGTGGG - Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184153772 22:42653616-42653638 CAGAGCAGGTTGAGGGAAGTTGG + Intergenic
1184334405 22:43844869-43844891 TGGTGCAGGCAGGAGGAAGCGGG + Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184606968 22:45579805-45579827 AAGAGGAGGGAGAAGGAAGTAGG - Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1184885368 22:47341822-47341844 GGGAGCAGGCAGGAGGGAGCTGG + Intergenic
1184921971 22:47612429-47612451 CACAGCAGGTAGAAAGAGGCAGG + Intergenic
1185381832 22:50512410-50512432 AAGAGCAGACATAAGAAAGCAGG - Intronic
1185416337 22:50712396-50712418 CAGAGGAGGCTGCCGGAAGCCGG - Intergenic
949980378 3:9499024-9499046 CAGATCAGGCAGAGAAAAGCGGG + Exonic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950617175 3:14169883-14169905 CAGGCCAGACAGAAGGAATCAGG + Intronic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950703355 3:14765673-14765695 CAGAGCAGGTGCAGGGAAGCTGG + Intronic
950786697 3:15442948-15442970 CATTCCAGGCAGAAGGAATCTGG - Intronic
951079032 3:18429295-18429317 AAGAGCAGGGAGGAAGAAGCTGG + Intronic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952858434 3:37792558-37792580 AAGACCAGGTAGCAGGAAGCTGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953315777 3:41925248-41925270 GAGGGCAGGCAGAAGCAAGGTGG + Intronic
953723038 3:45372991-45373013 CAGAGCAAGCAGCAAGAAGTAGG + Intergenic
953820269 3:46202321-46202343 AATAACAGGCAAAAGGAAGCAGG - Exonic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954596471 3:51829698-51829720 CAGAGGCGGCAGAAGGTAGGTGG + Exonic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955682063 3:61512946-61512968 CAGAGCAGCAAGAAAGAATCTGG + Intergenic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
955788931 3:62568373-62568395 CAGTGCAGCTAGAACGAAGCAGG + Intronic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
957495847 3:80990648-80990670 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960700403 3:120433885-120433907 CAGAGCAGCAAGAGGTAAGCTGG + Intronic
961381739 3:126500042-126500064 GAGAGCAGGTAGGAGGAAGGAGG - Exonic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
961822285 3:129581161-129581183 AACAGCAGGCAGCAGGCAGCGGG - Intronic
961959673 3:130841705-130841727 CTCTGCAGGGAGAAGGAAGCAGG + Intergenic
962646076 3:137441661-137441683 CCCAGCAGGCAGCAGGAAGCAGG - Intergenic
962832510 3:139157157-139157179 CAGACCTGGCAGAAGAGAGCTGG - Intronic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
963666601 3:148196001-148196023 GAGAACTGGCAGAAGCAAGCTGG + Intergenic
963765796 3:149334845-149334867 CAGAGGTGGTAAAAGGAAGCTGG + Intergenic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
965000622 3:162947996-162948018 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965878690 3:173361041-173361063 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
966816926 3:183896990-183897012 CAGACCAAGCAGATGGGAGCAGG + Intergenic
966912755 3:184568680-184568702 CTGGGCAGGCTGAAGGGAGCAGG + Intronic
967442981 3:189530566-189530588 AAAAGAAGGAAGAAGGAAGCGGG - Intergenic
967516142 3:190371494-190371516 TAGTCCAGGCAGAAGGAATCAGG + Intronic
967666377 3:192177588-192177610 CAGAGCAGTAAGGAGGAAACAGG - Intronic
967968879 3:194984930-194984952 CAGAGCAGGCCGTCGTAAGCAGG - Intergenic
968442443 4:630736-630758 CAGAGCAGGCAGCCGGAATTGGG - Intronic
968472823 4:789856-789878 CAGAGGAGGCTGGAGGCAGCAGG + Intronic
968489989 4:884791-884813 CAGAGCAGGCCGGAGGCTGCGGG + Intronic
968552620 4:1231453-1231475 CAGAGCAGGCTGGGGAAAGCTGG + Intronic
968767770 4:2482868-2482890 CAGAGGAGGTTGAAGAAAGCCGG - Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
968836871 4:2971576-2971598 AATAGCAGGAAGAAGAAAGCGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969603464 4:8190203-8190225 CACAGCAGGCAGAGGGGAGGAGG - Intronic
970345578 4:15149428-15149450 CAGAGCAGGCAGTCTGATGCGGG - Intergenic
970517935 4:16851950-16851972 CAGAGTAGGCAGAAGAACACTGG - Intronic
970732554 4:19123910-19123932 CAGAGCTAGCCGAAGGAAGGAGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971824522 4:31604105-31604127 CAAAACAGGCAGAAGAAAGTGGG - Intergenic
972116999 4:35648951-35648973 CAGTGCAGCCAGAATAAAGCAGG + Intergenic
972203812 4:36747605-36747627 CAGAGCAGGCAGGCAGGAGCTGG + Intergenic
972324577 4:38003296-38003318 TAGGGCTGGCAGAAGGAAGGAGG + Intronic
972836429 4:42876127-42876149 CAGAGAAGGAAGAGGGTAGCAGG + Intergenic
972859495 4:43150078-43150100 CAGAGCAGGAGGAAGAAAGTGGG + Intergenic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
974016533 4:56654115-56654137 GACAGCAGCCAGAAGGCAGCAGG - Intronic
975652881 4:76612038-76612060 GAGAGGAGGCAGAGGCAAGCAGG - Intronic
975741898 4:77437319-77437341 CAGGGCAGCCAGAACAAAGCAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976262138 4:83155770-83155792 CAGAGCAGACAAAAGTAATCAGG - Intergenic
977536775 4:98262334-98262356 CAGATTAGACAGGAGGAAGCTGG - Intronic
977736477 4:100422867-100422889 CAGAGCAGGCAGCAGTTAGATGG + Intronic
977775367 4:100913398-100913420 AAAAGCAGCCAGAAGGAAGAGGG - Intergenic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
979417372 4:120460483-120460505 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
981132178 4:141169235-141169257 CAGAGCAGGAAGAAGAAAAAAGG - Intronic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
982098940 4:151949698-151949720 CAGAGCTTCCAGAAGGAACCAGG + Intergenic
982530943 4:156542846-156542868 CAGCGCAGGTAGAATAAAGCAGG - Intergenic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
982868603 4:160548864-160548886 CAGAGCAGTAATAAGAAAGCTGG - Intergenic
983176567 4:164595659-164595681 TAGAACAGGCAGACAGAAGCAGG + Intergenic
984559704 4:181253919-181253941 AAGGGCAGGCAGCAGTAAGCTGG - Intergenic
985397068 4:189555374-189555396 CAGAGCAGGCCCTAGAAAGCTGG - Intergenic
985625067 5:981607-981629 CAGAGTGGGAAGAAGGCAGCTGG + Intergenic
985704853 5:1394401-1394423 CAGAGCCGGGAGCAGGGAGCAGG + Exonic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986236412 5:5914635-5914657 CAGAGCAGGTAGAAGGCATCCGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986742499 5:10716189-10716211 AACAGCGGGCAGAATGAAGCTGG + Intronic
987034420 5:14005880-14005902 CAGGGCTGGCAGAATGAAGGAGG + Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
987929038 5:24379484-24379506 CAAAGCAGGCATAAAGAAGAGGG + Intergenic
988209366 5:28183526-28183548 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
990333249 5:54747764-54747786 AAGAGCAGGTATAAGGAAGGAGG - Intergenic
990738717 5:58890936-58890958 AAGAACAGGCAGAGGAAAGCAGG - Intergenic
990990519 5:61679049-61679071 CACAGAAGGAAGGAGGAAGCAGG + Intronic
991249149 5:64540789-64540811 AAGAACAGGCAGAAGAAAGGAGG + Intronic
992307767 5:75461197-75461219 CACAGCAGGCAGTAAGCAGCAGG + Intronic
992967577 5:82018844-82018866 CAGAGTAGGAAAAGGGAAGCAGG - Intronic
992992259 5:82296181-82296203 CATAGCAGACAGCAGCAAGCAGG + Intronic
994358839 5:98826948-98826970 CGGAGCAGCCAGAATAAAGCAGG - Intergenic
995466434 5:112453784-112453806 AAGAGCAGGTAGAATGAAGAAGG + Intergenic
995801139 5:115996740-115996762 TAGATCAGGCAGCAGGAAGGTGG - Intronic
996647228 5:125830653-125830675 CAGAGAAGCCAGAAGTCAGCAGG + Intergenic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
996706073 5:126499962-126499984 CAGAGGAGGCATAATGAGGCTGG + Intergenic
997593070 5:135087352-135087374 AAGAGCAAGCAGAAGCAAGGAGG + Intronic
997736435 5:136215920-136215942 CAGAGCTGGCAGCAGGCATCAGG - Intronic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999328774 5:150659200-150659222 CACAGGAGGCAGAAGAATGCAGG - Intronic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999640462 5:153667273-153667295 CACACCAGTCAGAAGGAAGAAGG - Intronic
999658768 5:153836301-153836323 CACAAGAGACAGAAGGAAGCTGG - Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1000600905 5:163273581-163273603 CAGAGCAGCCCGAGGGCAGCTGG + Intergenic
1001632680 5:173187593-173187615 CAGAGCAGGCAGCCCGGAGCTGG - Intergenic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1002050011 5:176565372-176565394 GAGGGCAGGAAGGAGGAAGCAGG - Exonic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002902027 6:1417370-1417392 CACAGCAGGCGGGAGGTAGCCGG - Intergenic
1003084300 6:3049260-3049282 CAAAGTAGGCAGAAGGGAGGGGG - Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004314595 6:14574921-14574943 AGGAGCAGGCAGCAGGCAGCAGG - Intergenic
1004546555 6:16603715-16603737 CAGAACAGGCAGGAGGAAGTAGG + Intronic
1004773515 6:18814981-18815003 AAGAGCAGGCAAAAGGAAGAAGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005396942 6:25392566-25392588 CAGTCCAGGAAGAAGCAAGCAGG - Intronic
1006442363 6:34060450-34060472 CAGAGCAGGCTGCGGGAAGTGGG - Intronic
1006486538 6:34347487-34347509 CAGAGCAGGCAGAAATCAACAGG + Intronic
1006630348 6:35426250-35426272 GAGAGCTGGCTGGAGGAAGCGGG - Exonic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007339103 6:41178996-41179018 CAGAGCAGGCATTATGAATCAGG - Intergenic
1007736045 6:43982887-43982909 AAGAGGAGGCACACGGAAGCCGG - Intergenic
1007766648 6:44164613-44164635 CAGAGGAGGCAGCATCAAGCAGG + Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008882910 6:56399674-56399696 CTGAACAGGCTGAAGGCAGCTGG + Intergenic
1009587364 6:65624638-65624660 CAGAGCAGCTAGAATAAAGCAGG + Intronic
1010003279 6:70969476-70969498 CAGAGTAGGCAGAACTAAGAAGG + Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010703857 6:79083978-79084000 GAAAGCAGGAAGAGGGAAGCAGG - Intergenic
1011750420 6:90449617-90449639 CAGAGTTGGCAGAAGACAGCAGG + Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013161010 6:107544862-107544884 CAGAGCAGGCAGAGGCCAGCAGG - Intronic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1014173093 6:118300914-118300936 ATGAGCATCCAGAAGGAAGCGGG - Intronic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015894815 6:138007098-138007120 ACGAGGGGGCAGAAGGAAGCTGG - Intergenic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016708474 6:147141875-147141897 CAGAGCATGCAGAGGAAAGATGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1017547767 6:155469973-155469995 CAGAGCAGGCAAGAGGAGACGGG + Intergenic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018425573 6:163677398-163677420 ATAAGCAGGCAGAAGGAAGGTGG + Intergenic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1018993379 6:168691921-168691943 CATTCCAGGCAGAAGGAAACTGG - Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019462005 7:1164837-1164859 CAAGGCAGGCAGAAGAAAGTAGG - Intergenic
1019463398 7:1173215-1173237 CAGAGAGGGCAGAATGGAGCTGG + Intergenic
1019571956 7:1717028-1717050 CAGAGCATGCAGGAGGGAGGAGG + Intronic
1020182768 7:5934966-5934988 CAGAGCAGGCACTCGGTAGCGGG + Intronic
1020300144 7:6789791-6789813 CAGAGCAGGCACTCGGTAGCGGG - Intronic
1020329446 7:7002802-7002824 CAGAGCAGCTAGAACAAAGCAGG - Intergenic
1020432957 7:8132229-8132251 CAGAGCAGGCTTCAGGAAGGAGG - Intronic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021734178 7:23627046-23627068 CAGAGCAGTCAGTGTGAAGCTGG - Intronic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1022248904 7:28587464-28587486 AAGAGCAGGCCAAAGGTAGCAGG + Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1022384299 7:29887469-29887491 CAGAGAAGGCTGGAGGAAGTAGG + Intronic
1022570737 7:31451138-31451160 CAGAGCAGGAATAAGGGTGCTGG - Intergenic
1022582028 7:31564957-31564979 AAGAACAGGCAAAGGGAAGCAGG + Intronic
1022630245 7:32077911-32077933 CAGACCAGCCGGAGGGAAGCTGG - Intronic
1022829829 7:34054825-34054847 GAGGGCAGGAAGAAGGAAACTGG + Intronic
1023092303 7:36628572-36628594 CGGAGCAGGCACTAGGGAGCTGG + Intronic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023366399 7:39468284-39468306 CGGAGCAGGCAGCAGGAGGGAGG + Intronic
1023444978 7:40222089-40222111 GCAAGCAGGCAGAAGGAAGCTGG + Intronic
1023545406 7:41313091-41313113 CATAGCAGGCAGGAGACAGCAGG - Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024256074 7:47540871-47540893 CAAAGCAGTCACAAGGAAGGAGG + Intronic
1024653718 7:51431413-51431435 CAGAGCAGCCAGGGAGAAGCTGG + Intergenic
1024681398 7:51693367-51693389 TAGAGCAGGCAGGTGGAAGAGGG + Intergenic
1025078395 7:55962847-55962869 GAGGGCAGGAGGAAGGAAGCTGG - Intronic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027692855 7:81369928-81369950 CAAAGCAGGCAGAAGAAGGTAGG + Intergenic
1028273280 7:88819532-88819554 GAGAGCAGGCAGAAAGAAGTTGG - Intronic
1028555911 7:92124821-92124843 CAGAGCAGGTAGAAACAGGCAGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029364283 7:100107249-100107271 CGGAGCAGGCTGAGGGGAGCCGG + Exonic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1029956193 7:104642772-104642794 CAGATCCGTCAGAAGGCAGCTGG + Intronic
1029978100 7:104852824-104852846 AGGAGGAGGCAGCAGGAAGCTGG - Intronic
1030134770 7:106236225-106236247 CCGAGGAGGCAGAAGGAACTGGG - Intergenic
1031135949 7:117884239-117884261 GTGAGCATGCAGCAGGAAGCTGG - Intergenic
1032966369 7:137103246-137103268 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
1033274361 7:139959972-139959994 CCGAGCAGCAGGAAGGAAGCTGG + Intronic
1033278802 7:139991454-139991476 CACAGCAGACAGCAGGCAGCAGG + Intronic
1034174650 7:149090924-149090946 CAGAGCAGGCCGCAGCACGCCGG + Intergenic
1034298259 7:149993090-149993112 CAGTGCAGGCAGAACAAAGCAGG - Intergenic
1034461315 7:151199513-151199535 GAGAGCAGGCCGAAAGAGGCAGG - Intronic
1034670003 7:152850554-152850576 CAGAGCAGGAAGAATGAAACGGG - Intronic
1034807759 7:154103693-154103715 CAGTGCAGGCAGAACAAAGCAGG + Intronic
1034860872 7:154593654-154593676 CAGAGCTGGCAGAAGGACTGGGG - Intronic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035214669 7:157356341-157356363 CAGAGCAGGCAACAAGCAGCAGG - Intronic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035358467 7:158294630-158294652 CAGGCCAGGCAGGAGCAAGCGGG + Intronic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036159065 8:6369711-6369733 CAGAGCAGCCAGAAGGGATCTGG - Intergenic
1036180098 8:6576984-6577006 CACAGCAGGCAGCAGGGAGAAGG - Intronic
1036499232 8:9297944-9297966 CAAAGCAGGCCTAGGGAAGCAGG + Intergenic
1036608224 8:10327015-10327037 AAGAGCTGGCAGAAGGAGCCAGG - Intronic
1036615875 8:10387097-10387119 CCGTGCAGGCAGCAGGCAGCAGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037601149 8:20395274-20395296 CAGAGCAGGTGGCAGGAACCTGG - Intergenic
1037682063 8:21105796-21105818 CAGAGCATCCAGTAGCAAGCAGG - Intergenic
1037817254 8:22118781-22118803 CAGAGAAGGCAGAGGGGACCCGG - Intronic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038922504 8:32100123-32100145 GAGAGGAGGCAGAGGGAAGGAGG - Intronic
1039745258 8:40419840-40419862 CAGGGAAGGAAGAAGGAATCTGG + Intergenic
1039904117 8:41773722-41773744 CAGTGCATGCAGGAGGGAGCGGG - Intronic
1040587614 8:48757963-48757985 CACAGCAGGAACGAGGAAGCCGG - Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1041111749 8:54489418-54489440 CTGAACAGGAAGAAGGAAGGAGG + Intergenic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1042383434 8:68146221-68146243 CATATCAAGCAGAAGGAAGTCGG + Exonic
1042711681 8:71724242-71724264 CAGAGCAGGCAGTAGGGAACTGG - Intergenic
1044731023 8:95228864-95228886 CAGAGCAGGTGGAAGAAGGCTGG - Intergenic
1044826140 8:96199203-96199225 CACAGTAGGAAGCAGGAAGCTGG - Intergenic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1046624576 8:116563001-116563023 CAGAGGAGGCAGATGTGAGCAGG - Intergenic
1048319863 8:133390033-133390055 CACAGCAGGCAGCAGGCAGCAGG + Intergenic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049195498 8:141313561-141313583 CGGAGCAGGCGGAAGGACGCTGG - Intergenic
1049198015 8:141326006-141326028 CAGAGCAGGAACAAAGACGCTGG + Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049589620 8:143451177-143451199 CAGAGCAGAAGGCAGGAAGCAGG + Intronic
1049620474 8:143596151-143596173 CAGAGGAGGCGGGAGGCAGCGGG + Intronic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1049800339 8:144514698-144514720 CAGAGCAGACAGACTGAAGTAGG + Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1051059811 9:13032867-13032889 AACAGCAGGTAGTAGGAAGCTGG - Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051466089 9:17379766-17379788 AAAAGCAGCCAGAAGGAAACAGG - Intronic
1052776775 9:32740497-32740519 CAGACCTGGAAGGAGGAAGCAGG - Intergenic
1053110509 9:35455705-35455727 CAGAGAAGGTAGCAGGTAGCAGG + Intergenic
1053802321 9:41772234-41772256 CAGGACAGGTGGAAGGAAGCTGG - Intergenic
1054142964 9:61543106-61543128 CAGGACAGGTGGAAGGAAGCTGG + Intergenic
1054190554 9:61983220-61983242 CAGGACAGGTGGAAGGAAGCTGG - Intergenic
1054647759 9:67604197-67604219 CAGGACAGGTGGAAGGAAGCTGG + Intergenic
1055401173 9:75925681-75925703 CATTTCAGGCAGAAGGAAGGAGG + Intronic
1055473772 9:76641280-76641302 AAGAGCAGGAAGAAAGTAGCAGG + Intronic
1055738878 9:79363962-79363984 AAGAGTAGGAAGAAGGAAACTGG - Intergenic
1055888680 9:81098471-81098493 CAGACCAGACAAAAGGAAGAGGG + Intergenic
1056031652 9:82559887-82559909 CAGATAAGGCAGAGGAAAGCTGG - Intergenic
1056121398 9:83492532-83492554 CAGGGCAGGCAGGAGGAACGGGG + Intronic
1056526511 9:87447692-87447714 CAGGGCAGGCCGCAGGCAGCTGG - Intergenic
1056886370 9:90447815-90447837 AAGAGCTGGCAGAAGGACTCAGG + Intergenic
1057206056 9:93173315-93173337 CAGAGCAGAAAGAAGGAACCGGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058581224 9:106460024-106460046 CAAAGCAGGAAGAAGGAGGTTGG + Intergenic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059218784 9:112592096-112592118 CAGAGCAGGTAGCAGGTAACTGG + Intronic
1059396838 9:114039851-114039873 CACTGCAGGCAGGAGAAAGCAGG - Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1059985738 9:119818666-119818688 CAGAGCAGGTAGAACAAAGTAGG + Intergenic
1060397285 9:123325139-123325161 CATTGAAGGCAGAAGGAAACAGG - Intergenic
1060477838 9:123999328-123999350 GAGGGGAGGTAGAAGGAAGCCGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060804160 9:126564320-126564342 CAGAGCAGGGAGCAGCAACCAGG + Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1060980278 9:127787862-127787884 TGGAGCAGGAAGAAAGAAGCTGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061203834 9:129151938-129151960 CACAGCAGGCACCCGGAAGCAGG + Intergenic
1061467278 9:130791556-130791578 CAAAGCAGGCAGAAGAAGGTGGG + Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062184142 9:135207664-135207686 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1062561120 9:137142422-137142444 CAGAGCAGGCCAAAGGGAGGGGG + Intronic
1062561373 9:137143554-137143576 CAGAGCAGGCCAAAGGGAGGGGG + Intronic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1203663653 Un_KI270754v1:6134-6156 CAGAGCAGGCCCTAGAAAGCTGG + Intergenic
1185489013 X:506474-506496 AAAAGCAGGCAGAACGCAGCAGG + Intergenic
1185827034 X:3261346-3261368 CAGACCAGGAAGGAGGAAGGAGG + Intergenic
1185835559 X:3343731-3343753 CGTAGCAGGCACAAGGATGCGGG + Exonic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1186501015 X:10050582-10050604 CAGCCCAGCCAGAAGCAAGCTGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187840210 X:23479216-23479238 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1187902125 X:24035042-24035064 CAGAGCCTGCAGACTGAAGCTGG + Intergenic
1188387182 X:29575512-29575534 CAAAGCAGGCAGAAGAAGGTGGG - Intronic
1189307870 X:40000712-40000734 ATGAGAAGGCAGAAGGGAGCTGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190191127 X:48278040-48278062 CTGATCAGGCAGAAGGATGGGGG + Intergenic
1190391155 X:49933122-49933144 TAGAGCAGGAATAAAGAAGCAGG + Intronic
1191017132 X:55820741-55820763 CAGAGCAGGAAGAAGAGAGCAGG + Intergenic
1191738831 X:64416386-64416408 CAGAGCATTCAGAAGGAACATGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192212488 X:69136817-69136839 TAGGGCACCCAGAAGGAAGCAGG + Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195321634 X:103726008-103726030 GACAGCAGGCAGGAGGGAGCAGG - Intronic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1196204390 X:112922794-112922816 CAGAGCAGGAGGAAGAAAGATGG + Intergenic
1198432528 X:136581651-136581673 CAGAGCAGGCAGAGTGTACCTGG - Intergenic
1198666764 X:139032736-139032758 CAGAGCAGGAAGCAGTGAGCTGG - Intronic
1199114123 X:143970027-143970049 CAAAGCAGGCCGAAGAAGGCCGG - Intergenic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199678612 X:150208370-150208392 CAAAGCAGGCACAATGAAGCAGG - Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1200164257 X:154025337-154025359 GTCAGGAGGCAGAAGGAAGCAGG - Intronic
1200164692 X:154027835-154027857 CAGAGCAGGTGGAAGGGATCAGG + Intronic
1201437900 Y:13979192-13979214 CAAATCAGGCAGAAGGAGGTGGG - Intergenic