ID: 1136067675

View in Genome Browser
Species Human (GRCh38)
Location 16:27769777-27769799
Sequence GCTGACGTGACCGGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136067675_1136067677 -2 Left 1136067675 16:27769777-27769799 CCAGCAGCTCCGGTCACGTCAGC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1136067677 16:27769798-27769820 GCACCGCTTCTGTCCCCACATGG 0: 1
1: 0
2: 0
3: 34
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136067675 Original CRISPR GCTGACGTGACCGGAGCTGC TGG (reversed) Intronic
902389444 1:16094589-16094611 GCTGTGGTGAATGGAGCTGCAGG - Intergenic
905515916 1:38561897-38561919 GCTGACCTGCCAGCAGCTGCAGG + Intergenic
914314663 1:146498790-146498812 GCAGACGTGACAGCAGCTGCTGG + Intergenic
915293971 1:154907100-154907122 GCTGAGGTGACAAGAACTGCTGG - Intergenic
922294582 1:224238400-224238422 GCTGAGAGGACTGGAGCTGCCGG + Intronic
924207223 1:241725666-241725688 GAGGACGTGACCTGACCTGCAGG + Intronic
1066020820 10:31299281-31299303 GATGAGGTGAGCAGAGCTGCTGG + Intergenic
1074408588 10:113202423-113202445 GCTGAACTGACTGGAGCTGGGGG - Intergenic
1075512112 10:123081132-123081154 GCTGCCCTGACCTGTGCTGCAGG + Intergenic
1076313019 10:129521648-129521670 GGAGATGTGACCAGAGCTGCTGG + Intronic
1077008653 11:370413-370435 GCTGAAGTGGCCGGTGCAGCTGG + Intronic
1078910204 11:15723987-15724009 GCTGAGGTGACTGAAGCAGCAGG - Intergenic
1081212487 11:40354232-40354254 GCTGAGCTGCCTGGAGCTGCGGG + Intronic
1083995364 11:66268982-66269004 CCTGAAGTGACCGGGACTGCGGG - Intronic
1084046068 11:66568366-66568388 GCCGCCGTCCCCGGAGCTGCTGG - Exonic
1084711764 11:70847955-70847977 GCTGAGGTGACCGTGGCTGGAGG + Intronic
1096464278 12:51839632-51839654 GCTGATGTGACTGGAGGAGCTGG - Intergenic
1102894560 12:116588268-116588290 GCTGATGAGCCTGGAGCTGCTGG + Intergenic
1103998502 12:124845188-124845210 GCTGCCGGGAGCGGTGCTGCTGG - Intronic
1110878026 13:80534907-80534929 GGTGGCTTGACTGGAGCTGCAGG - Intergenic
1113166451 13:107448855-107448877 GCTGATGTGAGAGGAGCTGACGG + Intronic
1113831211 13:113297235-113297257 GCTCACGTGACAAGCGCTGCCGG + Exonic
1116666377 14:47781003-47781025 GCTGCCATAACCGGTGCTGCTGG - Intergenic
1121545309 14:94758738-94758760 GCAGACCAGACAGGAGCTGCTGG - Intergenic
1122554103 14:102567588-102567610 GCTGAGGTGGGCGGATCTGCAGG - Intergenic
1125185447 15:36924668-36924690 GCTTACGGGAGCGGACCTGCTGG + Intronic
1127041123 15:54977954-54977976 GATGACTTGACTGGAGCTGGAGG - Intergenic
1127915434 15:63451220-63451242 TCTGCCCTGACCAGAGCTGCGGG + Intergenic
1129688375 15:77699081-77699103 GCTGCCACGACAGGAGCTGCTGG + Intronic
1136067675 16:27769777-27769799 GCTGACGTGACCGGAGCTGCTGG - Intronic
1139477399 16:67209603-67209625 GGTGATGTGACAGGAGCAGCAGG - Intronic
1141448529 16:84080506-84080528 GCAGAGGAGACCTGAGCTGCTGG - Intronic
1141647219 16:85373925-85373947 GCTGACCTGACAGGGCCTGCGGG - Intergenic
1142668704 17:1477488-1477510 CCTGACGTGAGTGGGGCTGCGGG - Exonic
1143325605 17:6096326-6096348 GCAGATGTGATCGGATCTGCAGG + Intronic
1145284712 17:21496630-21496652 GCTGACGTGAGTGTAGCGGCTGG + Intergenic
1148105950 17:45118956-45118978 GCTGAAGCGGCCGGAGCTGGAGG - Exonic
1153522993 18:5969376-5969398 GATGAGGTGAGTGGAGCTGCTGG - Exonic
1153579883 18:6562265-6562287 GCTGATGAGGCGGGAGCTGCTGG + Intronic
1156525867 18:37766674-37766696 GATGAGCTGACTGGAGCTGCTGG - Intergenic
1159944168 18:74431336-74431358 GCTGACGTGGCCTGTGGTGCTGG - Intergenic
1161263046 19:3348130-3348152 GCTGGCGTGGCTGGATCTGCTGG - Intergenic
1161331766 19:3691984-3692006 GCTGACATGGGCGGGGCTGCTGG - Intronic
1161341952 19:3747843-3747865 GCTGAGGTCAGCGGAGCTGTCGG - Exonic
1163487888 19:17599838-17599860 GCGGACAGGACGGGAGCTGCGGG - Intergenic
1165903551 19:39179802-39179824 GCTGACTGGCCTGGAGCTGCTGG + Intronic
1166256057 19:41605695-41605717 GCTGAACTGACCGCTGCTGCAGG - Intronic
933797138 2:85928655-85928677 GGTGGCGTGTCTGGAGCTGCTGG + Intergenic
937914579 2:127092629-127092651 GGTGACTTGCCCGGGGCTGCGGG - Intronic
1172159807 20:32859274-32859296 GTTGACCTGTCCGGAGCTGACGG - Intronic
1175510243 20:59519264-59519286 GCTGAGGTGTCTGGGGCTGCTGG - Intergenic
1176053638 20:63133744-63133766 GCTGCCGTGACCCGAGGAGCTGG - Intergenic
1178390024 21:32190652-32190674 GCTCACTTGACAGGAGCTGCAGG - Intergenic
1181434547 22:22902753-22902775 GCTGAGTTCACCAGAGCTGCTGG + Intergenic
1184510601 22:44930951-44930973 GCTCACCTCTCCGGAGCTGCTGG - Intronic
950446457 3:13041697-13041719 CCTGAGGTGACAGGGGCTGCAGG - Intronic
952633034 3:35493013-35493035 GATGACGTGACTGCAGCTGCTGG - Intergenic
961198290 3:125022498-125022520 GGTGGGGTGACCAGAGCTGCCGG - Intronic
965706013 3:171508833-171508855 GCTGACTTGACAGTTGCTGCAGG - Intergenic
970915429 4:21328439-21328461 GCTGAGGTGCCTGGAGCTGGGGG + Intronic
985573287 5:662167-662189 GCTGGAGTGGCCGGAGCGGCGGG - Exonic
998690707 5:144584462-144584484 GCTGAAGTGACAGATGCTGCTGG - Intergenic
1003701108 6:8466281-8466303 ACTGACTTGACCAGTGCTGCGGG - Intergenic
1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG + Intergenic
1007790388 6:44305183-44305205 CCTGCCGTGCCCGGTGCTGCAGG + Exonic
1011449072 6:87473398-87473420 GCAGAGGAGACCGGAGCCGCGGG - Intronic
1013025644 6:106269350-106269372 GCTGGCTTCACCGGGGCTGCTGG + Intronic
1015843371 6:137495402-137495424 GCTGACGTGCCCCGAGCTCCGGG + Intergenic
1018381794 6:163264612-163264634 GCTGAGGTGAGGGGAGCTGTGGG + Intronic
1020002212 7:4762414-4762436 GCTGGAGTGATCGCAGCTGCCGG + Exonic
1022209530 7:28195036-28195058 CCTGACGTGCCCTGTGCTGCTGG - Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1027230631 7:76270004-76270026 GCTGACTTGGCAGGAGCTGTTGG - Intronic
1043567454 8:81563054-81563076 GCTGAGCTGCCTGGAGCTGCGGG - Intergenic
1049805747 8:144538037-144538059 GCTGGCGTGAGTGGAGGTGCAGG + Intronic
1057130580 9:92651581-92651603 ACTGAGGTGACCTGAGCTTCAGG - Intronic
1060881612 9:127122010-127122032 TCTGCCGTGCCGGGAGCTGCCGG + Intronic
1060964506 9:127705243-127705265 GCTGATGGGCCCAGAGCTGCTGG - Intronic
1062035899 9:134382403-134382425 GCTGAGGAGACCAGAGCTGGGGG + Intronic
1200151356 X:153952901-153952923 GCTGCCGTGGCGGCAGCTGCTGG + Exonic