ID: 1136067905

View in Genome Browser
Species Human (GRCh38)
Location 16:27771054-27771076
Sequence CCTTCCCAGAGCACTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136067901_1136067905 -9 Left 1136067901 16:27771040-27771062 CCTCCTCCTGGAGGCCTTCCCAG 0: 1
1: 3
2: 78
3: 415
4: 1693
Right 1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG 0: 1
1: 0
2: 2
3: 42
4: 283
1136067898_1136067905 1 Left 1136067898 16:27771030-27771052 CCCAAGGCTGCCTCCTCCTGGAG 0: 1
1: 1
2: 3
3: 52
4: 358
Right 1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG 0: 1
1: 0
2: 2
3: 42
4: 283
1136067899_1136067905 0 Left 1136067899 16:27771031-27771053 CCAAGGCTGCCTCCTCCTGGAGG 0: 1
1: 3
2: 7
3: 70
4: 507
Right 1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG 0: 1
1: 0
2: 2
3: 42
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136067905 Original CRISPR CCTTCCCAGAGCACTCCCTG AGG Intronic
900119460 1:1042283-1042305 CCTCCCCAGAGCCTTCCCAGAGG - Intronic
900380421 1:2381428-2381450 ACTGCCCAGAGCACCCCGTGGGG + Intronic
900399433 1:2467017-2467039 CCTTCCCAGAGGCCCTCCTGGGG + Intronic
900405928 1:2492992-2493014 CCTTCCCTGAGCACCCCCTCGGG + Intronic
901028884 1:6294578-6294600 CCTTCCCAGAGCTCTGTCTGTGG + Intronic
903232015 1:21927673-21927695 CTTTCCCAGGCCACACCCTGGGG + Intronic
903323010 1:22553767-22553789 CTTGGCCAGAGAACTCCCTGGGG - Intergenic
903380028 1:22890261-22890283 CAGTCCCAGAGCACTTGCTGTGG - Intronic
903406547 1:23102104-23102126 CCTTCCCAGACCCCACCCTTAGG - Intronic
903571493 1:24308846-24308868 CCTTCCCTGAGGCCTCCTTGTGG + Intergenic
905451866 1:38062200-38062222 CAGTCCCCGAACACTCCCTGTGG + Intergenic
906647272 1:47484099-47484121 CAGTCCCAGAGCACACCGTGTGG + Intergenic
906663122 1:47596602-47596624 CCCTCTCAGATCACTCACTGAGG + Intergenic
907937415 1:59055153-59055175 CCTTCCCTGACCACTCCATTTGG - Intergenic
909853968 1:80504939-80504961 TCTTGGCAGAGCACTCCTTGAGG + Intergenic
910226710 1:84943376-84943398 CCTTCCCAGTGGTCTCTCTGAGG - Intronic
913451904 1:118998320-118998342 GTTTCCCAGAGCACGCCCTGTGG + Intergenic
915030791 1:152879021-152879043 CCTTGCCAGAGCCCTCCTGGTGG + Intronic
915331441 1:155115200-155115222 CTTTCCCAAACCAATCCCTGTGG + Intergenic
915826337 1:159081826-159081848 CCTTCCCAGCCAAGTCCCTGGGG + Intronic
918504631 1:185238345-185238367 CCTTCCCAGAGCATTTCATGGGG + Intronic
921054678 1:211534920-211534942 CCAGCTCAGAGCACTCCCTCTGG - Intergenic
921850217 1:219926523-219926545 CCTCACCAGAACACTCCCTTTGG + Intronic
922765190 1:228152783-228152805 ACTTCCCACAGCCTTCCCTGAGG + Intronic
922816072 1:228450344-228450366 CCTTCCCAGAGCTCGGCTTGTGG + Intergenic
924945370 1:248842920-248842942 CGCACACAGAGCACTCCCTGGGG + Intronic
1062798458 10:361790-361812 CCCTTTCAGAGCACTCCCTGAGG + Intronic
1063059139 10:2532769-2532791 TATGCCCAGAGCACACCCTGGGG - Intergenic
1064736549 10:18387426-18387448 CAATCCCAGAGCACTCCCAGTGG - Intronic
1066473916 10:35725918-35725940 CTTTCCCAGAGATCTCCCAGTGG - Intergenic
1070732220 10:78838379-78838401 CCTCCCCAGAGCAATCCCCAAGG + Intergenic
1070871292 10:79755788-79755810 TCTTCTGAGAGCACTCCCTCAGG - Intergenic
1071088612 10:81893827-81893849 CCTTACCACATCACTGCCTGCGG - Intronic
1071638228 10:87277996-87278018 TCTTCTGAGAGCACTCCCTCAGG - Intergenic
1071657016 10:87459956-87459978 TCTTCTGAGAGCACTCCCTCAGG + Intergenic
1071725816 10:88197373-88197395 CCTTCCTGGGGCACTTCCTGGGG + Intergenic
1071795409 10:88999576-88999598 TCTTCCCAGAGCAGTCTCTATGG + Intronic
1073687374 10:105770041-105770063 CCTACTCAGAGGACTGCCTGAGG - Intergenic
1074183270 10:111081198-111081220 CCTTCTCAGAACACTCCCAGTGG + Intergenic
1074657990 10:115616940-115616962 CCTACACAGAGCCCTCACTGGGG + Intronic
1075404156 10:122183465-122183487 CCTTCCCATGTCACTCCCTGCGG + Intronic
1075766441 10:124896999-124897021 CATTTCCAGTGCATTCCCTGAGG - Intergenic
1075835563 10:125449845-125449867 CCTTCCCAGGCCACGGCCTGTGG - Intergenic
1076361888 10:129895320-129895342 CCTTCCCCGTCCACTCCCTCTGG - Intronic
1076783119 10:132735413-132735435 CATTCCCAGAACACTCCATCAGG - Intronic
1078182944 11:9027702-9027724 CCTTCCCAGAGGGCCCCCTGTGG + Intronic
1078451744 11:11445691-11445713 CTTTCACAGAGCCCTCCCTGAGG + Intronic
1079979055 11:27129840-27129862 TCTTCCCAGATCATTCCCTGAGG + Intergenic
1082092095 11:48098416-48098438 CCTTCTCAAAGCAGGCCCTGTGG - Intronic
1084267674 11:68013180-68013202 CCTGCCCTGGGCACTCCCTGGGG + Intronic
1084478495 11:69402397-69402419 CCTTGCCTGAGGTCTCCCTGTGG + Intergenic
1084504048 11:69554077-69554099 CCTGCCCAGGGCCCTCCCAGGGG + Intergenic
1087538970 11:99490858-99490880 CCTGCCCAGAGGATTCCCTAAGG - Intronic
1089305435 11:117523500-117523522 CCATCCCAGAGCATTTCTTGGGG + Intronic
1090310642 11:125733977-125733999 TCTTCCCAGAGTTTTCCCTGAGG - Intergenic
1090469112 11:126963752-126963774 ACTTCCCTGACTACTCCCTGAGG + Intronic
1090837572 11:130464496-130464518 TCTTCCCAGATTACTCCCTCTGG + Intronic
1091390108 12:121043-121065 CCTTCCCAGAGCACTGGAGGGGG - Intronic
1091392061 12:131695-131717 CCTGCTCAGAGCTCTCGCTGCGG - Intronic
1091517071 12:1195537-1195559 CATTCCCAGAAGCCTCCCTGTGG - Intronic
1091769268 12:3140750-3140772 CCCTCCCTGAGCCTTCCCTGTGG - Intronic
1091813939 12:3421968-3421990 CCTCCTCAGTGCACTCCCAGGGG + Intronic
1091847540 12:3669043-3669065 CCCTCCCAGAGCACAGCCTAGGG + Intronic
1092163259 12:6327704-6327726 CCTCCCCTGAGGACTCCCAGGGG - Exonic
1094265962 12:28560177-28560199 CCAACCCAGAGCTCTCCCTCTGG + Intronic
1096417304 12:51425128-51425150 GCTTCCCAGGCCGCTCCCTGAGG + Intronic
1096603665 12:52748665-52748687 CTTTCCCTGAGTAGTCCCTGCGG + Intergenic
1096652826 12:53070314-53070336 CCTTCCCAGAGAACTCAGAGGGG + Intronic
1097191840 12:57223049-57223071 CCTACCCACAGCACAGCCTGTGG + Intronic
1097417536 12:59330399-59330421 AGTTCCAAGAGCACTCCCTCAGG - Intergenic
1102037598 12:109781154-109781176 CCTTCCCAGAGCCTGACCTGAGG + Intergenic
1102057138 12:109905160-109905182 GCTTCCCAGAGGAGTTCCTGGGG + Intronic
1102455329 12:113067270-113067292 CCTTCCCAGGGCCCTCCCCCTGG + Intronic
1102944495 12:116974126-116974148 GCTTCCCTGAGCCCTCACTGGGG - Intronic
1103921027 12:124399249-124399271 CCTCCCCACAGGACTCCCAGAGG + Intronic
1103966841 12:124645561-124645583 CCTCCCCAGGCCACTCCCTCTGG - Intergenic
1104072741 12:125360638-125360660 CCTACCCACAGCACTTCCTCAGG - Intronic
1104802933 12:131566957-131566979 CCTTCCCAAAGCTGCCCCTGTGG + Intergenic
1107438291 13:40401596-40401618 CCTTCTCACACCACACCCTGAGG - Intergenic
1107992161 13:45828194-45828216 CCTTCACAGAGCACTCCCATAGG - Intronic
1108602980 13:52011182-52011204 CCTTCCCTGCGCACCCCCTGGGG + Intronic
1111792890 13:92881177-92881199 CCTTCCCAGCACAATCTCTGGGG + Intergenic
1113877841 13:113605854-113605876 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877866 13:113605960-113605982 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877877 13:113606001-113606023 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877887 13:113606042-113606064 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877917 13:113606165-113606187 CCTTCCCACAGGATCCCCTGCGG - Intronic
1114528457 14:23380566-23380588 CCTTCCCATAGCATTCACTGTGG - Intergenic
1117003542 14:51395490-51395512 CCCTCCCAGAGAATCCCCTGTGG + Intergenic
1117481584 14:56151133-56151155 CCTGCCCACAGCACCCCGTGTGG + Intronic
1118991932 14:70804937-70804959 CCTTCCCTGCTCAGTCCCTGTGG + Intronic
1120919614 14:89743003-89743025 CATTCCCTGAGCACTTCCTGGGG + Intergenic
1120957636 14:90097028-90097050 CCTTCCCTGAGTACTTCGTGTGG - Intronic
1121081508 14:91112468-91112490 CCTTCGCAGAGCGTTGCCTGAGG + Intronic
1121099556 14:91241188-91241210 TATTCCCTGTGCACTCCCTGTGG + Intronic
1121302754 14:92885142-92885164 CCTCCCCAGAGCTTTCCATGGGG + Intergenic
1121513774 14:94535270-94535292 TGTTCCCAGAGCACTGCATGTGG + Intergenic
1122195134 14:100079056-100079078 CCTTCCCAGAGGCCTCCCTCTGG + Intronic
1122781739 14:104146666-104146688 CCTTCCCAGGGCCCTCCCCATGG - Intronic
1122930448 14:104931002-104931024 CCAGCCCAGAGGGCTCCCTGTGG - Intronic
1123625341 15:22223368-22223390 TCATCCCAGAGCACACCCTCCGG + Intergenic
1123805638 15:23869540-23869562 CCTTCCCACAGCACACCGCGAGG - Intergenic
1124204277 15:27703928-27703950 CCTTCCCAGAACATTCTCTGAGG - Intergenic
1124701190 15:31913984-31914006 CCCTCCCACAGCACTTCCTTTGG + Intergenic
1124896019 15:33778252-33778274 CTTTCCCAATGCTCTCCCTGTGG + Intronic
1124954051 15:34348301-34348323 ACTGCCCCGGGCACTCCCTGTGG + Exonic
1125539161 15:40459743-40459765 CCTTTCCAGCACCCTCCCTGGGG + Exonic
1129513991 15:76145371-76145393 CCTTCCAAGAGGGCTGCCTGTGG + Intronic
1130406718 15:83609304-83609326 CCTTCCCGAAGCAGTCCCTTGGG - Intronic
1130688703 15:86061629-86061651 CCTTCACAAAGCATTCCCAGAGG - Intergenic
1132214749 15:100054267-100054289 CAATCCCACAGCTCTCCCTGGGG - Intronic
1132496183 16:264560-264582 CCTTCACTGAGCACTCCCACAGG - Intronic
1133021940 16:2970550-2970572 TCTCCCCAGACCTCTCCCTGGGG - Intronic
1133969770 16:10559208-10559230 ACTGCCCAGAGCACTCCGAGGGG + Intronic
1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG + Intronic
1137585128 16:49659756-49659778 CCTTCCCAGACCCCTCTATGAGG - Intronic
1137586758 16:49668456-49668478 CTTTTTCTGAGCACTCCCTGGGG - Intronic
1139909867 16:70391142-70391164 CCTTCCCAGTCCCGTCCCTGAGG - Intronic
1140808194 16:78552912-78552934 CTTTCCCAGGTAACTCCCTGTGG - Intronic
1141166065 16:81661764-81661786 CATACACAGAGGACTCCCTGGGG - Intronic
1141491650 16:84377951-84377973 CCTTCCCTAAGACCTCCCTGTGG + Intronic
1141803858 16:86329741-86329763 TCTTCCCAGCCCCCTCCCTGTGG + Intergenic
1142274905 16:89113285-89113307 GCTTCCCTGTGCACTTCCTGGGG - Intronic
1143028246 17:3953416-3953438 CGTTCCCAGGGAAGTCCCTGTGG - Exonic
1143037222 17:4006302-4006324 CCCTCCCAGAGAACTCCTTGAGG - Exonic
1143765378 17:9134368-9134390 TCCCCCCAGAGCACTCCCTCCGG + Intronic
1144653808 17:17022715-17022737 CCTTCCCTGAGCACTGCCTCTGG + Intergenic
1144776651 17:17788177-17788199 CCCCTCCAGACCACTCCCTGTGG - Intronic
1144875784 17:18396469-18396491 CCTTCCCAAAGCGCTGACTGTGG + Intergenic
1145156444 17:20547952-20547974 CCTTCCCAAAGCGCTGACTGTGG - Intergenic
1145906723 17:28520470-28520492 CCTGCCCAGAGGAATCCCAGAGG + Intronic
1147264970 17:39229118-39229140 CCTTCCCAGTGCTTTCTCTGAGG + Intergenic
1147907629 17:43833176-43833198 CCTTCCCGGACCCCTCCCTGCGG + Intergenic
1148199430 17:45740120-45740142 CCAGGCCAGAGCAGTCCCTGTGG - Intergenic
1148242507 17:46009852-46009874 CATTCCCAGAGAACTCCCTGCGG - Intronic
1148908434 17:50926561-50926583 CCTTCCCAGCCCACATCCTGGGG - Intergenic
1150343733 17:64388288-64388310 CCCTCCCAGACCACACCCTTTGG - Intronic
1151284069 17:73097099-73097121 CCTTTCCAGAGGAGTCACTGTGG + Intergenic
1152193529 17:78902918-78902940 CCTTCCCATCACACTGCCTGTGG + Intronic
1152566672 17:81103406-81103428 CCCTCCCTGAGCACTCTCTGGGG - Intronic
1154497428 18:14972559-14972581 GCTTCCATGAGCTCTCCCTGGGG + Intergenic
1156899455 18:42284349-42284371 CCTTCCTGGAGCAATCCCTTTGG + Intergenic
1157451949 18:47795530-47795552 CCTCCAAAGACCACTCCCTGGGG - Intergenic
1159070813 18:63622065-63622087 CCTTTCCAGCTCACTCTCTGGGG + Intergenic
1160498081 18:79386746-79386768 ACTGGACAGAGCACTCCCTGTGG - Intergenic
1161856255 19:6767494-6767516 CCTTCCCAGACCACACCTAGTGG + Exonic
1162380268 19:10327777-10327799 CATTCCCCCAGCACTCGCTGTGG - Intronic
1162612730 19:11768638-11768660 TCCTCCCAGAGGACACCCTGAGG + Intronic
1162675126 19:12293261-12293283 TCTTCCCAGAGGACAGCCTGAGG - Exonic
1163290938 19:16378499-16378521 CTCTCCCAGGGCTCTCCCTGGGG + Intronic
1163437045 19:17302184-17302206 CCTTCCCTGTGGACACCCTGTGG - Intronic
1163682055 19:18688392-18688414 GCTTCCCAGACCCCTCCCTCAGG - Intronic
1165138409 19:33685083-33685105 GCTGCCCAGAGGATTCCCTGTGG - Exonic
1165654315 19:37520122-37520144 CCTTCCCCAAACACTGCCTGGGG - Intronic
1165844608 19:38810070-38810092 CCTTCCCTCAGCTGTCCCTGGGG + Intronic
1167036728 19:46999228-46999250 CCATCACAGAGCACGCCCTGGGG + Intronic
1167231965 19:48290615-48290637 CCTCCGCACAGCGCTCCCTGGGG - Intergenic
1167854518 19:52226909-52226931 CATTGCCAGAGAACCCCCTGTGG + Exonic
1168518260 19:57026771-57026793 ACTTTCCAGAGCTCTCTCTGAGG - Intergenic
925386720 2:3467082-3467104 CATTGCCAGAGCCCTCGCTGTGG - Intronic
926253338 2:11168819-11168841 CTGCCCAAGAGCACTCCCTGCGG + Intronic
926996370 2:18740485-18740507 TGTTCCCAGAGCATTCCCTGTGG + Intergenic
927035950 2:19176581-19176603 CCTTCCCTGACCACTCCATCAGG - Intergenic
927939811 2:27096359-27096381 CTTTCCCAGGGCTCTGCCTGTGG + Intronic
927959955 2:27234971-27234993 CCTTCCCAGATCACCCCTTTTGG - Intronic
928312127 2:30219923-30219945 CCATCCCAGAAAACTCCCTATGG - Intergenic
929299094 2:40281573-40281595 CCTTTCCCCAGCACTGCCTGGGG + Intronic
929906569 2:46051235-46051257 CCTTCCCAGAGCACCACAAGTGG + Intronic
932723414 2:74157140-74157162 CCTTCCCAGATCACAGCCTCTGG + Intronic
932830260 2:74982520-74982542 CCTTCCTATATCACTTCCTGTGG - Intergenic
934860374 2:97759517-97759539 CCTTCCCAGGGAGCTTCCTGCGG + Intronic
935328617 2:101960408-101960430 GCTTCCCAGAGCCCCCACTGAGG + Intergenic
936075006 2:109396192-109396214 CCCTCCCACAGCCCTCCGTGGGG - Intronic
938021109 2:127906406-127906428 GCTTCCCAGCCCTCTCCCTGTGG - Intergenic
938248660 2:129797464-129797486 GCTTCCCAGAGCACACCCTTGGG + Intergenic
946195487 2:218030338-218030360 CCTTCCCGGTGCAATCCCTCTGG + Intergenic
946851186 2:223908713-223908735 CCTGCCCAGACCAAACCCTGAGG + Intronic
947745097 2:232503316-232503338 CCCGCCCAGACCCCTCCCTGGGG - Intergenic
948439590 2:237978238-237978260 CCTGCCCACAGCCCTCACTGAGG + Intronic
948464011 2:238143583-238143605 CCTTTCCAGAGCACCTCTTGGGG - Intronic
948532354 2:238617511-238617533 CCTTGCCAGAGCTCACCCAGAGG - Intergenic
948946659 2:241223979-241224001 CCTGCCCCGTGCACTCCCTGAGG + Intronic
1169292605 20:4365402-4365424 CCTTGCCAGAGAACCCCATGTGG - Intergenic
1170868743 20:20184978-20185000 CCTTCCCCGTGCCCTCCCTCTGG - Intronic
1172245309 20:33441999-33442021 ACTTCCCTGAGCACTCTCTGAGG + Intronic
1172412798 20:34738659-34738681 CCTTTCCAGAGCTCTGCGTGAGG + Intronic
1172428183 20:34870322-34870344 ACTTCCCAAAATACTCCCTGAGG + Intronic
1172590402 20:36113637-36113659 CCTGCCCAGAGATCTCCATGGGG - Intronic
1172725278 20:37035435-37035457 TCTTCTCTTAGCACTCCCTGCGG + Exonic
1173843990 20:46176719-46176741 CCTTCCCTGTGCCCTCCCTCCGG - Intronic
1174047370 20:47743030-47743052 CCCTCCCAGACAAATCCCTGCGG + Intronic
1174427145 20:50439762-50439784 CCATCTCAGACCAATCCCTGGGG - Intergenic
1175735841 20:61386445-61386467 CCTTCCCCCAGCCTTCCCTGCGG + Intronic
1175915414 20:62423655-62423677 CCTTCCCAGTGAAGTCACTGTGG + Intronic
1176038102 20:63050101-63050123 CCTTCCCGGGGCTGTCCCTGAGG - Intergenic
1176070579 20:63224252-63224274 CCTCTCCAGAGTCCTCCCTGTGG + Intergenic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1178188236 21:30249437-30249459 CCTTCCCTGAGCACTCTTTCTGG - Intergenic
1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG + Intronic
1179148227 21:38787734-38787756 CCTTCCCTGAGCTCTCCAGGTGG - Intergenic
1179791688 21:43759580-43759602 CCTTCACACACCCCTCCCTGTGG + Exonic
1180056889 21:45363584-45363606 CCTACCCAGAACACACACTGAGG - Intergenic
1180231816 21:46430901-46430923 CCGTCCCTGAGCACTTGCTGTGG + Intronic
1181149735 22:20874639-20874661 CCTCCCCAGGGCACTCACTGAGG - Intronic
1181168444 22:20995375-20995397 CATTCCCCCAGCTCTCCCTGGGG + Intronic
1182552926 22:31111013-31111035 ACTTCCCAGAGCACACATTGTGG + Intronic
1183711078 22:39503802-39503824 CCCTCCTAGATCACCCCCTGTGG + Intronic
1184656233 22:45943527-45943549 CTTTGCCAGAGCACTCCCGAGGG - Intronic
1184689183 22:46109771-46109793 CCTGCCTCGAGCACTCCCTGGGG + Intronic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
1185162945 22:49240458-49240480 CCTTCCGAGTGCAGGCCCTGGGG - Intergenic
949113305 3:288738-288760 CCTTCACAGACAATTCCCTGTGG - Intronic
949395146 3:3606912-3606934 CCTTCCCAGACCTATCACTGAGG - Intergenic
950541436 3:13615550-13615572 CCTTCTCAGAGCCTTCACTGTGG + Intronic
950770561 3:15307517-15307539 CCTTCTAAGAGCCCTCCCTATGG - Intronic
951055877 3:18145810-18145832 CATTCCCAGGGCTCTACCTGGGG + Intronic
951588144 3:24235987-24236009 CCTTCCCACAGCTCTGTCTGTGG + Intronic
954294851 3:49668578-49668600 CCTCCCCAGACCTCGCCCTGGGG - Exonic
954368898 3:50160108-50160130 CCTGCCCTGAGCAGCCCCTGGGG + Intronic
954414946 3:50388716-50388738 CCTTTCCAGAGTCCTGCCTGGGG - Intronic
954420315 3:50415539-50415561 CCTGCCCAGACCCCTCCTTGGGG + Intronic
955231473 3:57102576-57102598 ATTTCCCAGTGCACTCCCCGTGG - Exonic
956377576 3:68632042-68632064 CCTTTTCAGATCACTCCATGGGG + Intergenic
956852949 3:73247972-73247994 ACTTCCCCGAGCACTCCTAGGGG + Intergenic
958860625 3:99441156-99441178 CCTTCCATAAGCACTCCCTAGGG + Intergenic
959836021 3:110919069-110919091 ACTTCCCCCAACACTCCCTGAGG + Intergenic
960457221 3:117887158-117887180 CATTGCCAGATAACTCCCTGGGG - Intergenic
960905999 3:122602216-122602238 CTTTCCCAGGGCACTGCCTTTGG + Intronic
962385019 3:134925954-134925976 ACTACCCAGAGCAGTACCTGTGG + Intronic
962404135 3:135085820-135085842 CAAACCCACAGCACTCCCTGGGG - Intronic
962482032 3:135806305-135806327 CATTCCAAGCGGACTCCCTGGGG + Intergenic
963912013 3:150823108-150823130 CCATCCCAGAGCACCCTCAGAGG + Intergenic
966689153 3:182725681-182725703 CCTAACCATAGCACTTCCTGGGG - Intergenic
966703115 3:182877996-182878018 CCTGTCCAAAGCACTACCTGAGG - Intronic
967769688 3:193321146-193321168 CCTTCCCAGATGCCTCACTGTGG + Intronic
967774876 3:193376003-193376025 CCTTCCCCGAAGATTCCCTGTGG - Intronic
967892446 3:194372765-194372787 CCTTCACAGAGAACTCTCTCTGG + Intergenic
968481834 4:836736-836758 CCCTCCCAGCACACTGCCTGGGG + Intergenic
968684377 4:1947164-1947186 CCTCCCCAGCACACTCCCTGTGG + Intronic
968903871 4:3443039-3443061 CCTCCCCACAGCACTCACCGAGG + Exonic
969485961 4:7472548-7472570 CCTGCCCAGGGCCCTCCCGGAGG - Intronic
969685438 4:8671526-8671548 CCTTTCCAGAGCAGTCTCTGGGG + Intergenic
969712334 4:8851297-8851319 CCATCCCTGAGCACAGCCTGTGG - Intronic
969860469 4:10031857-10031879 CATTCCCAGTGCATTCCCAGGGG - Intronic
970929058 4:21487510-21487532 CCTTTCCATAGTGCTCCCTGTGG + Intronic
971245406 4:24922709-24922731 CCTTCCTATAGCACTCACTGGGG - Intronic
972602763 4:40587309-40587331 TCCTCCCTGAGCACTACCTGTGG - Intronic
975712311 4:77173096-77173118 CCTGCCAAGGGCACTCCCAGAGG - Intronic
975984932 4:80193695-80193717 CCCTTCCAGAGACCTCCCTGTGG + Intronic
978342550 4:107733953-107733975 CTTTCCCAGAGGGCTCCCTGGGG - Intergenic
978482908 4:109214803-109214825 CTTTCACAGAGCACTTCCTCAGG - Intronic
978555771 4:109979081-109979103 CCTTCTCAGAGCAGTTCCAGTGG + Intronic
982715352 4:158801443-158801465 CCTTCCCAGATCTGTCCCAGTGG + Intronic
984773725 4:183461888-183461910 CCTTCACAGAGCACTCACCATGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986130028 5:4921222-4921244 CTTTCCCAGAGCACTCTATGGGG - Intergenic
986559438 5:9046141-9046163 CCTGCTCAGAGCACATCCTGAGG + Intronic
989262051 5:39429462-39429484 CCTTTCCAGAGAAGTCTCTGAGG - Intronic
991477281 5:67035974-67035996 CTTACCCATTGCACTCCCTGTGG + Intronic
994578299 5:101609190-101609212 CCTTCCCAGAACCCTGCCAGAGG + Intergenic
994732583 5:103510726-103510748 CATTCCTAAAGCACTCACTGTGG + Intergenic
998684167 5:144505242-144505264 CCTTCCTAGAGCGATCCCTGGGG + Intergenic
999263694 5:150253148-150253170 CCTCCCCAAAGGGCTCCCTGTGG - Intronic
1000126947 5:158254634-158254656 TCTACCCTGAGCATTCCCTGAGG - Intergenic
1001221517 5:169904509-169904531 CCTTCCCACCTCACTCCCTCAGG - Intronic
1001476302 5:172053489-172053511 CCTTGCCACAGATCTCCCTGAGG - Intronic
1001827508 5:174757526-174757548 CATTCCCAGAACACTACATGAGG + Intergenic
1002176866 5:177405578-177405600 CCTTCCCAGAACTCTCCCTCTGG + Intronic
1002346516 5:178551745-178551767 CCTGCCCTGAGCACCCCCTCAGG + Intronic
1003277447 6:4664662-4664684 CCTTCCCAAAGCACGGCCTAAGG - Intergenic
1006030522 6:31173779-31173801 CCTTCACAGAGCACTGCCAGGGG + Intronic
1006454886 6:34125975-34125997 CCTCCCCTGAGCACCTCCTGAGG + Intronic
1010172152 6:72986960-72986982 CCTTCCCACTGTGCTCCCTGGGG - Intronic
1013250883 6:108332026-108332048 CCTTCCAAGAGCAATGCATGAGG + Intronic
1015620402 6:135126252-135126274 GCTTCCGAAAGCACCCCCTGTGG - Intergenic
1016053931 6:139558671-139558693 CCTGCCCAGAGCACTGGCTATGG - Intergenic
1018557656 6:165065310-165065332 CCTTCCCAGTGGACTATCTGGGG + Intergenic
1018768899 6:166955793-166955815 CCTTCCCAGAGGTCACCCCGGGG + Intronic
1018939825 6:168301743-168301765 CCTGCCCAGCCCACTCACTGCGG + Intronic
1020005849 7:4783499-4783521 CCTTCCCAGGTCCTTCCCTGAGG + Intronic
1020756585 7:12211202-12211224 CCTGCGCAGAGCGCTCCCGGAGG - Intergenic
1020940384 7:14526373-14526395 CATTGCCAGAGATCTCCCTGGGG + Intronic
1025610342 7:63071854-63071876 CCTTCCATGGGCACTACCTGAGG + Intergenic
1025858356 7:65304058-65304080 TTTTCCCAGAGGGCTCCCTGAGG - Intergenic
1026868796 7:73838493-73838515 CCTTCCCAGACCAGTCACTTGGG - Intronic
1030372325 7:108714560-108714582 CTTTCCCACAGCACTCCCAATGG - Intergenic
1033443253 7:141398705-141398727 CCCTCCCACAGTACCCCCTGTGG - Intronic
1033531756 7:142271198-142271220 CCTTCCCAGAACCCTGCGTGGGG - Intergenic
1034172319 7:149071867-149071889 CCTGCCCAGTGCACCCCATGCGG - Exonic
1034544241 7:151779427-151779449 CCTGCACAGAGCCCTCCATGGGG - Intronic
1034842558 7:154412798-154412820 CCTGCCCAGGGCACACACTGTGG + Intronic
1035046272 7:155969323-155969345 CCATCACAGAGCTCTCGCTGAGG + Intergenic
1035240698 7:157527415-157527437 CCAGCCCAGGGCACCCCCTGGGG - Intergenic
1037396950 8:18453317-18453339 CCTTCCCAGATTGCTCCTTGGGG + Intergenic
1038317572 8:26500886-26500908 CCTTCCCCCAACACTCACTGTGG - Intronic
1039844318 8:41315320-41315342 CCATCCCAGAGCTGACCCTGTGG + Intergenic
1040017358 8:42710538-42710560 CCTTCCCACAAATCTCCCTGAGG - Intronic
1041168141 8:55112004-55112026 CCTTCCCTGAGAACTCCCTGGGG + Intronic
1041644858 8:60240833-60240855 CCTTCTCAGAGCACTCAGAGGGG + Intronic
1041793547 8:61722724-61722746 CCTGCCCAGGGCACTGCCAGTGG + Intergenic
1045303243 8:100933410-100933432 CCTCCCCAAAGGACTCCCAGTGG + Intronic
1047411563 8:124628528-124628550 CCTTCCCAGAGCACCTGCTGTGG - Intronic
1048964578 8:139606271-139606293 GCCTGCCACAGCACTCCCTGTGG - Intronic
1049072241 8:140365073-140365095 GCTTCCCATAGCATCCCCTGAGG - Intronic
1049464778 8:142745993-142746015 CCCACCCAGAGCACCCTCTGAGG - Intergenic
1049542952 8:143216613-143216635 CCCTGCCAGAGGACACCCTGGGG - Intergenic
1049725382 8:144143307-144143329 CCTCCCCAGAGGCCTCCCCGGGG - Intergenic
1053422925 9:37991803-37991825 CCTTCACAGAGCACAGCCTGTGG - Intronic
1056731218 9:89168054-89168076 CCTACCTACAGCTCTCCCTGTGG + Intronic
1057239988 9:93399773-93399795 CCTTCCCACAGTCTTCCCTGGGG + Intergenic
1058177723 9:101756743-101756765 CCTGACCACAGCATTCCCTGTGG + Intergenic
1058637188 9:107048309-107048331 CCTGCCCAAAGCACTTCCTGAGG + Intergenic
1058985067 9:110202489-110202511 TCCTCCCAGAGCAGTGCCTGTGG - Intronic
1060347131 9:122827316-122827338 ACTTCCCAGACAACACCCTGAGG + Intronic
1060747945 9:126149957-126149979 CATTCCAAGAGCCCTCCCTGAGG + Intergenic
1061232021 9:129320708-129320730 CCTGCCCAGAGCAACCCCCGGGG - Intergenic
1061763594 9:132867753-132867775 GCCTCCCAGGGCCCTCCCTGTGG + Intronic
1061779516 9:132987446-132987468 CCTCCCCTTGGCACTCCCTGGGG - Intronic
1062050087 9:134442702-134442724 CCTGCCCAGGGCAGTCCCTCTGG + Intergenic
1062399186 9:136365047-136365069 CCTGCCCTGGGCACCCCCTGCGG - Intronic
1062461243 9:136663399-136663421 CCTCCGCAGAGCAGCCCCTGTGG + Intronic
1062548015 9:137072384-137072406 CATTCACAGAGCACCCACTGTGG - Intergenic
1062707756 9:137954600-137954622 CCCACCCAGACCAATCCCTGTGG - Intronic
1187871401 X:23767661-23767683 ACTGTCAAGAGCACTCCCTGTGG + Intergenic
1191190167 X:57658085-57658107 CTGGCCCAAAGCACTCCCTGCGG - Intergenic
1192578709 X:72263217-72263239 CCTTCCCAGAGGTTTCCCAGGGG + Intronic
1193087322 X:77458419-77458441 CTTCCCCAGAGCAGCCCCTGAGG + Intergenic
1194448718 X:94016408-94016430 TCTTCCCAGAGGGCTCCCAGCGG + Intergenic