ID: 1136068380

View in Genome Browser
Species Human (GRCh38)
Location 16:27773806-27773828
Sequence GGGGGCTAAGGTAGACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136068380_1136068387 3 Left 1136068380 16:27773806-27773828 CCTTCTGGTCTACCTTAGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136068380 Original CRISPR GGGGGCTAAGGTAGACCAGA AGG (reversed) Intronic