ID: 1136068380

View in Genome Browser
Species Human (GRCh38)
Location 16:27773806-27773828
Sequence GGGGGCTAAGGTAGACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136068380_1136068387 3 Left 1136068380 16:27773806-27773828 CCTTCTGGTCTACCTTAGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136068380 Original CRISPR GGGGGCTAAGGTAGACCAGA AGG (reversed) Intronic
902229932 1:15021509-15021531 GGAGGCCAAGGTATACCAGCAGG - Intronic
907290230 1:53408700-53408722 GGGGGCTAAGGGACCCCACAAGG + Intergenic
909907204 1:81211964-81211986 GGAGGCAAAGGAAGAGCAGATGG + Intergenic
910178561 1:84457214-84457236 GGTGGCTAAGGGAGAAGAGAAGG + Intergenic
916052875 1:161048470-161048492 AGAGGCTGAGGGAGACCAGAGGG - Exonic
916490610 1:165299110-165299132 TGGGGCTGAGATATACCAGAAGG - Intronic
916898551 1:169194212-169194234 GGGGGCTAAGGTGGCACACATGG + Intronic
920035346 1:203061578-203061600 GGGGCCTAGGGTAGAGCTGATGG + Intronic
920509672 1:206541638-206541660 GGGGTCTAGGGTAGACTTGAAGG - Intronic
921622088 1:217336425-217336447 AGGGCCTAATGTAGAGCAGAGGG + Intergenic
923246502 1:232137429-232137451 AGGGTCTAAGGAAGACAAGAGGG + Intergenic
1066181000 10:32960330-32960352 CGTGTCTAAGGTCGACCAGATGG + Intronic
1069702181 10:70435001-70435023 GGGGGTGGGGGTAGACCAGAGGG - Intronic
1070319585 10:75344382-75344404 TGCAGCTAAGGAAGACCAGATGG + Intergenic
1070657995 10:78284356-78284378 GGGGGCTTAGCTAGGGCAGAAGG - Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1076747184 10:132520232-132520254 GGGAGCCAAGGAAGGCCAGAGGG + Intergenic
1077010672 11:377833-377855 GGGGCCTCAGGGAGACCAGAGGG - Intronic
1077938807 11:6818200-6818222 GGGGACTGAGGTAGGCCTGAGGG + Intergenic
1079310587 11:19361976-19361998 GGGGGATAAGGTAGAGGGGATGG + Intronic
1083140768 11:60719413-60719435 GGGGGAGAAGGTTGACCAAAGGG - Intergenic
1089359173 11:117874979-117875001 GGAGGCTCAGGAAGCCCAGAAGG - Intronic
1090202590 11:124866792-124866814 GGGGGAAAAGGCCGACCAGAAGG + Intronic
1096526134 12:52211439-52211461 GGGGGCTACGGGAGCCCTGAGGG + Intergenic
1098910412 12:76203296-76203318 TGGGGATGAAGTAGACCAGAAGG + Intergenic
1101227560 12:102705099-102705121 GGGAGCCAAAGTAGACCAGGAGG + Intergenic
1102219664 12:111186074-111186096 GGGGGCGAGGGCAGAACAGAGGG - Intronic
1104613611 12:130250507-130250529 GGGGGCCAGGTTAGACCAGATGG - Intergenic
1106353403 13:28956405-28956427 GGTGGAGCAGGTAGACCAGAAGG - Intronic
1108501345 13:51072409-51072431 GGGGATTAATGGAGACCAGAAGG - Intergenic
1112435511 13:99388911-99388933 GGGGGCTAACAGAGAGCAGATGG + Intergenic
1117473859 14:56074067-56074089 GGGGGCTGAGGCTGACCAGATGG - Intergenic
1120359251 14:83476083-83476105 TGGGGCTGAGGTAGACAAAATGG + Intergenic
1122793299 14:104193453-104193475 GGGGGCCAAGGTGGCCCAGGGGG - Intergenic
1124374561 15:29122018-29122040 GGGGGCGCAGGGGGACCAGAGGG - Exonic
1127167170 15:56256940-56256962 GGGGCCTATGGGAGAGCAGAGGG - Intronic
1128432287 15:67608538-67608560 GGGGGCTGAGGAAGAACTGATGG + Intronic
1132350559 15:101137225-101137247 TGGGACTGAGGTAGACCACATGG + Intergenic
1134062677 16:11208510-11208532 GGAGGAAAAGCTAGACCAGATGG + Intergenic
1134349485 16:13423395-13423417 GGGGGATAAGGTAGATTACAGGG - Intergenic
1136009051 16:27350560-27350582 GGGGGCTGAGGAAGAGGAGAGGG + Intronic
1136068380 16:27773806-27773828 GGGGGCTAAGGTAGACCAGAAGG - Intronic
1138329368 16:56201167-56201189 GTGTGCTATGGTAGAACAGAAGG + Intronic
1143274024 17:5696624-5696646 GGGGGCGGGGGTAGGCCAGAAGG - Intergenic
1143327499 17:6109055-6109077 GCTGGCCAAGGAAGACCAGAGGG + Intronic
1143580850 17:7824761-7824783 AGGAGGTAAGGTGGACCAGATGG - Intronic
1147442979 17:40458665-40458687 GGTGCCTCAGGGAGACCAGATGG - Intergenic
1149769013 17:59305316-59305338 GAGGGCTGAGGTAGAACACATGG - Intergenic
1152486162 17:80595014-80595036 GGGGGCTAAGGGGAACAAGAAGG + Intronic
1153697252 18:7656631-7656653 GGGATATAAGGTAGAACAGAAGG + Intronic
1157026726 18:43853536-43853558 TGGGTCATAGGTAGACCAGATGG + Intergenic
1158801940 18:60922140-60922162 GGGGGCTGAGGGAGACCAAGAGG - Intergenic
1163253984 19:16143817-16143839 GGGGGCTGGGCTAGGCCAGAAGG + Intronic
1164245942 19:23428982-23429004 TGGTGATAAGGTTGACCAGATGG - Intergenic
1165309589 19:35022241-35022263 GGGGGCTATGGGAGATCAGAGGG + Intronic
1165730767 19:38143271-38143293 GGGGGCAGAGGAAGAACAGAGGG - Intronic
1165925404 19:39323063-39323085 TGGGGTTAAGGTTCACCAGAAGG - Intergenic
1166868164 19:45853735-45853757 GGGGGCTCTGGGAGCCCAGAGGG - Intronic
1167000251 19:46741561-46741583 GAGGGCCAAGGTAGGCCTGAGGG + Intronic
1167528915 19:50002694-50002716 GGGAGCCAAGGGAGGCCAGAAGG + Intronic
925982306 2:9186784-9186806 GTGGGCTAAGAGAGACCAGATGG - Intergenic
927504067 2:23601991-23602013 GGGGGCTGAGGCAGGGCAGAGGG + Intronic
931752838 2:65346246-65346268 GGGGGCCAAGGGAGATCAGTTGG - Intronic
935016992 2:99192407-99192429 GGGGGCAAAGGGAGACCATTAGG - Intronic
948201600 2:236133430-236133452 GGGAGCCATGGTTGACCAGACGG - Intergenic
1168856632 20:1013516-1013538 AGGGGCTGAGGAAGGCCAGAAGG - Intergenic
1169206265 20:3741991-3742013 TGGGGCTAAGGCAGTCCAGAGGG + Intronic
1174087864 20:48022002-48022024 AGGGACTGAGGTAGACCAGGAGG - Intergenic
1181615298 22:24050076-24050098 CAGGGCCAAGGAAGACCAGAGGG - Intronic
1183038496 22:35158484-35158506 GGAGGCTTCGGCAGACCAGATGG + Intergenic
1183684505 22:39353807-39353829 GGGGGCTAAGATGGACTATAGGG + Intronic
952153784 3:30621022-30621044 GGGGACTATGGTGGACGAGAAGG - Intronic
952812542 3:37417413-37417435 GCGGGCTAATGCAGAGCAGATGG + Exonic
955054021 3:55440219-55440241 GGGTGGTTAGGTAGACAAGAGGG + Intergenic
961615904 3:128180874-128180896 GGGGGCTAATGAAGTCCTGAAGG + Intronic
962872510 3:139509863-139509885 GTGAGCTGAGGGAGACCAGATGG + Intergenic
962918813 3:139933624-139933646 GTGGGCTAAAGGAGACCTGAAGG + Intergenic
966611108 3:181868683-181868705 GGCAGCAAAGGTAGATCAGAGGG - Intergenic
967863448 3:194170650-194170672 GGGGTCTAAGGTAGCCCTGCTGG - Intergenic
968516315 4:1017099-1017121 GGGGGCTCACCTTGACCAGAAGG - Intronic
968873586 4:3253863-3253885 GTGGGCTAAGGGAGGCCAGGGGG - Intronic
969571754 4:8012908-8012930 AGGGGCTAAGGGTGAACAGAGGG - Intronic
969840650 4:9879193-9879215 GGGGGCTGTGGGAGCCCAGAGGG + Intronic
982613622 4:157611940-157611962 GGAGTCTAAGGAAGACAAGAGGG - Intergenic
982921484 4:161278694-161278716 AGGCGCTAAAGTAGACAAGATGG - Intergenic
984757264 4:183336585-183336607 GGGTGCTATGGGAGCCCAGAAGG + Intergenic
986315571 5:6584309-6584331 GAGGGCTGTGGTAGACTAGAGGG + Intergenic
986683143 5:10251342-10251364 AGGGAATAAGGAAGACCAGAGGG + Intronic
996548288 5:124704457-124704479 GGGGCCTATGGTAGACCACACGG - Intronic
998953855 5:147418203-147418225 TGCTGCTAAGGTAGACAAGAGGG + Intronic
999242560 5:150136318-150136340 AGGGGCTTAGGTAGCTCAGAGGG + Intronic
1000107356 5:158072904-158072926 GGGGGGTAAGGCAGACCACTGGG + Intergenic
1001776064 5:174329953-174329975 GGGAGCTAATGAAAACCAGATGG - Intergenic
1002000828 5:176195463-176195485 GGTGGCTGAGGCAGTCCAGAGGG + Intergenic
1002253508 5:177943507-177943529 GGTGGCTGAGGCAGTCCAGAGGG - Intergenic
1002390974 5:178911424-178911446 GGTGGCGAAGGTAGAGCAGGTGG - Intronic
1002762611 6:213824-213846 GGGGGCCATGGTGGGCCAGAAGG - Intergenic
1003422474 6:5970739-5970761 GTAGGCTAAGGTTGACCAGTGGG - Intergenic
1005087632 6:22023004-22023026 GAGTGCTAAGGAAGAACAGAGGG - Intergenic
1006742414 6:36318921-36318943 GGTGGCTGAGATAGACAAGAAGG - Intronic
1007271881 6:40643991-40644013 GAGGGCTACGGTAGGCCTGAGGG - Intergenic
1010926818 6:81753849-81753871 GGGGGCTGAGGTGGGGCAGAGGG + Intergenic
1013731505 6:113173526-113173548 GGGGGATAAGGTAGGGGAGAGGG + Intergenic
1017870008 6:158479165-158479187 TGGTGATGAGGTAGACCAGATGG - Intronic
1023049222 7:36236519-36236541 GGGCACTAAGGCAGCCCAGAGGG - Intronic
1025610582 7:63072826-63072848 GGGGGCTTAGGTATAACTGAGGG - Intergenic
1032585829 7:133145396-133145418 GGGAGATAAGGGAGACCAGTTGG + Intergenic
1033262492 7:139855765-139855787 GGGGGCTCTGGTTGACCACAGGG - Intronic
1038023561 8:23570109-23570131 GGGTGCTGAGGTTGACCCGATGG + Intronic
1041537122 8:58939252-58939274 GGGGGCTGAGGGATACCATAAGG - Intronic
1047499595 8:125431067-125431089 GGGGGCTGAGGTAGTCCGGGGGG - Exonic
1047926621 8:129688787-129688809 GGGGACAAAGCTAGTCCAGAGGG + Intergenic
1049233340 8:141495479-141495501 GGTGGCTAAGGTTGGCAAGAAGG + Intergenic
1051437586 9:17049270-17049292 GGGGTCTATGTTAGACCTGAAGG + Intergenic
1056765218 9:89440880-89440902 GGAGGCTAAGTTGGACCTGAAGG + Intronic
1057216591 9:93232021-93232043 CGGGGCTCAGGAAGCCCAGATGG + Intronic
1062335134 9:136061618-136061640 GGGGGCTGGGGTAGACCTGCTGG - Intronic
1187099013 X:16172818-16172840 TGGGGATGAGGTAGACCAGAGGG + Intergenic
1189214887 X:39314384-39314406 GGGGGCAAAGGAAGGACAGAGGG + Intergenic
1190484318 X:50909830-50909852 GGGAGCTAACCTAGCCCAGATGG - Intergenic
1194689568 X:96967197-96967219 GGGGGCTAATAGAGAACAGAGGG - Intronic
1195094244 X:101490323-101490345 CGGGACTAAGGCAGACCAGAGGG + Exonic
1197166293 X:123381301-123381323 GTGGGCTAAGGTAGAGGAGCTGG - Intronic
1197753595 X:129980967-129980989 GGGGGCGAAGGTAGATCGGCGGG + Intergenic
1198949935 X:142058781-142058803 CATGGCTGAGGTAGACCAGATGG - Intergenic