ID: 1136068387

View in Genome Browser
Species Human (GRCh38)
Location 16:27773832-27773854
Sequence TCCTCCCATTGTTATCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136068381_1136068387 -9 Left 1136068381 16:27773818-27773840 CCTTAGCCCCCCACTCCTCCCAT 0: 1
1: 0
2: 3
3: 63
4: 601
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1136068378_1136068387 14 Left 1136068378 16:27773795-27773817 CCCAAGCATATCCTTCTGGTCTA 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1136068377_1136068387 15 Left 1136068377 16:27773794-27773816 CCCCAAGCATATCCTTCTGGTCT 0: 1
1: 0
2: 0
3: 21
4: 138
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1136068379_1136068387 13 Left 1136068379 16:27773796-27773818 CCAAGCATATCCTTCTGGTCTAC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1136068380_1136068387 3 Left 1136068380 16:27773806-27773828 CCTTCTGGTCTACCTTAGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119
1136068375_1136068387 23 Left 1136068375 16:27773786-27773808 CCATTTCTCCCCAAGCATATCCT 0: 1
1: 0
2: 0
3: 24
4: 306
Right 1136068387 16:27773832-27773854 TCCTCCCATTGTTATCTACCAGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136068387 Original CRISPR TCCTCCCATTGTTATCTACC AGG Intronic