ID: 1136070723

View in Genome Browser
Species Human (GRCh38)
Location 16:27785351-27785373
Sequence GGCCTTCAGGATGAAGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136070715_1136070723 27 Left 1136070715 16:27785301-27785323 CCATCATGTCTGCCTTTTAAAAC No data
Right 1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG No data
1136070717_1136070723 5 Left 1136070717 16:27785323-27785345 CCCTGCCTTTTAAATCAGTGTCT No data
Right 1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG No data
1136070719_1136070723 0 Left 1136070719 16:27785328-27785350 CCTTTTAAATCAGTGTCTCCTGT No data
Right 1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG No data
1136070716_1136070723 15 Left 1136070716 16:27785313-27785335 CCTTTTAAAACCCTGCCTTTTAA No data
Right 1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG No data
1136070714_1136070723 28 Left 1136070714 16:27785300-27785322 CCCATCATGTCTGCCTTTTAAAA No data
Right 1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG No data
1136070718_1136070723 4 Left 1136070718 16:27785324-27785346 CCTGCCTTTTAAATCAGTGTCTC No data
Right 1136070723 16:27785351-27785373 GGCCTTCAGGATGAAGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136070723 Original CRISPR GGCCTTCAGGATGAAGATGA CGG Intergenic
No off target data available for this crispr