ID: 1136071143

View in Genome Browser
Species Human (GRCh38)
Location 16:27787971-27787993
Sequence CGCCTTAAGCCCCACCTAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1683
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 1639}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136071137_1136071143 -9 Left 1136071137 16:27787957-27787979 CCCATTTCCAGCCCCGCCTTAAG 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG 0: 1
1: 0
2: 0
3: 43
4: 1639
1136071138_1136071143 -10 Left 1136071138 16:27787958-27787980 CCATTTCCAGCCCCGCCTTAAGC 0: 1
1: 0
2: 2
3: 4
4: 140
Right 1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG 0: 1
1: 0
2: 0
3: 43
4: 1639
1136071135_1136071143 -3 Left 1136071135 16:27787951-27787973 CCCAGGCCCATTTCCAGCCCCGC 0: 1
1: 0
2: 1
3: 17
4: 295
Right 1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG 0: 1
1: 0
2: 0
3: 43
4: 1639
1136071134_1136071143 10 Left 1136071134 16:27787938-27787960 CCATAATTGCTCTCCCAGGCCCA 0: 1
1: 0
2: 7
3: 10
4: 186
Right 1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG 0: 1
1: 0
2: 0
3: 43
4: 1639
1136071132_1136071143 26 Left 1136071132 16:27787922-27787944 CCTCAGTAGAGCTGGACCATAAT 0: 1
1: 0
2: 1
3: 11
4: 80
Right 1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG 0: 1
1: 0
2: 0
3: 43
4: 1639
1136071136_1136071143 -4 Left 1136071136 16:27787952-27787974 CCAGGCCCATTTCCAGCCCCGCC 0: 1
1: 0
2: 2
3: 22
4: 455
Right 1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG 0: 1
1: 0
2: 0
3: 43
4: 1639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136071143 Original CRISPR CGCCTTAAGCCCCACCTAGT AGG Exonic
900248792 1:1654782-1654804 CGCCTTTAGTCCCAGCTACTCGG - Intronic
900281821 1:1874663-1874685 CGCCTGTAGTCCCACCTACTTGG + Intronic
900324723 1:2102993-2103015 CGCCTGAAGTCCCAGCTAGTTGG - Intronic
900781542 1:4621537-4621559 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
900920430 1:5666809-5666831 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
901016797 1:6236422-6236444 CGCCTTTAACCCCAGCTACTTGG + Intergenic
901092191 1:6649293-6649315 CGCCTTTAGTCCCAGCTACTCGG - Intronic
901319648 1:8331916-8331938 CGCCTGTAGCCCCAGCTACTTGG - Intronic
901330231 1:8401994-8402016 CGCCTGTAGCCCCAGCTACTCGG - Intronic
901450443 1:9333454-9333476 CGCCTGTAGTCCCACCTACTTGG - Intronic
901598920 1:10407322-10407344 CACCTGTAGCCCCACCTACTTGG + Intronic
902347592 1:15829764-15829786 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
902365880 1:15974063-15974085 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
902441349 1:16432245-16432267 CGCCTAAAATCCCAGCTAGTAGG - Intronic
902520923 1:17015868-17015890 CGCCTGTAACCCCAGCTAGTTGG + Intergenic
902780145 1:18699684-18699706 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
902865865 1:19278433-19278455 CGCCTGTAGTCCCACCTACTTGG + Intergenic
903067107 1:20706032-20706054 CGCCTTCAGTCCCAGCTACTCGG - Intronic
903136042 1:21309915-21309937 CGCCTGTAGTCCCACCTACTCGG - Intronic
903160859 1:21488206-21488228 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
903512064 1:23883697-23883719 CGCCTGTAGTCCCACCTACTTGG + Intronic
903783432 1:25838375-25838397 CGCCTGTAGCCCCAGCTACTTGG + Intronic
904110450 1:28121957-28121979 CGCCTGTAGTCCCACCTAATGGG + Intergenic
904150954 1:28440174-28440196 CGCCTGTAGCCCCAGCTACTCGG + Intronic
904181716 1:28670451-28670473 CGCCTGTAGCCCCAGCTACTCGG - Intronic
904432107 1:30470932-30470954 CGCCTGAGGCCCCAGCTACTCGG + Intergenic
904705357 1:32386191-32386213 CGCCTGTAGCCCCAGCTACTTGG + Intronic
904711127 1:32431193-32431215 CACCTGAAGCCCCAGCTACTGGG + Intergenic
904720999 1:32508479-32508501 CGCCTGTAGCCCCAGCTACTTGG + Intronic
904861174 1:33539091-33539113 CGCCTGTAGTCCCACCTACTCGG - Intronic
905104051 1:35552214-35552236 CGCCTGTAGTCCCACCTATTCGG + Intronic
905576887 1:39051896-39051918 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
905583749 1:39101696-39101718 CGCCTGTAGTCCCACCTACTCGG + Intronic
905602293 1:39263897-39263919 CGCCTGTAGCCCCAGCTACTCGG - Intronic
905746760 1:40424843-40424865 CGCCTTTGGCCCCAGCTACTTGG - Intergenic
905767952 1:40618694-40618716 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
905854590 1:41300210-41300232 CGCCTGTAGCCCCACCTACTTGG - Intergenic
906041815 1:42793530-42793552 CACCTTAGCCCCCATCTAGTAGG - Intronic
906111800 1:43328921-43328943 CGCCTGAAGTCCCAGCTACTTGG - Intergenic
906159591 1:43637927-43637949 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
906171689 1:43731508-43731530 CGCCTGTAGCCCCAGCTACTCGG - Intronic
906226262 1:44124618-44124640 CGCCTGTAGTCCCACCTACTCGG - Intronic
906476985 1:46175996-46176018 CGCCTTTAGTCCCAGCTACTTGG - Intronic
906632158 1:47380551-47380573 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
906974835 1:50559123-50559145 CGCCTGTAGCCCCAGCTACTTGG + Intronic
907135207 1:52134081-52134103 CGCCTGTAGTCCCACCTACTCGG - Intergenic
907169694 1:52451138-52451160 CGCCTTTAGTCCCAGCTACTCGG + Intronic
907213689 1:52843810-52843832 CGCCTGTAGTCCCACCTACTCGG - Intronic
907452373 1:54554045-54554067 CGCCTCTAGTCCCAGCTAGTTGG + Intronic
907644200 1:56225198-56225220 CGCCTATAGTCCCAGCTAGTTGG - Intergenic
907689839 1:56652136-56652158 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
908524834 1:64977554-64977576 TGCCTGTAGTCCCACCTAGTCGG - Intergenic
908623911 1:66018292-66018314 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
908721815 1:67134127-67134149 CGCCTGTAGTCCCACCTACTGGG - Intronic
909080677 1:71107836-71107858 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
909396200 1:75173506-75173528 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
909815187 1:79983935-79983957 CACCTGAAGCCCCAGCTACTTGG - Intergenic
909937543 1:81570512-81570534 CGCCTGTAGCCCCAGCTACTTGG - Intronic
910298655 1:85680078-85680100 AGCCTTTAGTCCCACCTACTTGG + Intronic
910553138 1:88499033-88499055 CGCCTGTAGTCCCACCTACTCGG - Intergenic
910582501 1:88844030-88844052 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
911207555 1:95107295-95107317 CGCCTGTAGTCCCACCTACTCGG + Intergenic
911207786 1:95109611-95109633 CGCCTGTAGTCCCACCTACTTGG - Intergenic
911214542 1:95178074-95178096 CGCCTGAAGTCCCAGCTACTCGG - Intronic
911378775 1:97086177-97086199 CGCCTGTAGCCCCAGCTACTTGG - Intronic
911569527 1:99506554-99506576 CGCCTGTAGCCCCAACTACTTGG + Intergenic
911590708 1:99744842-99744864 CGCCTGTAGTCCCACCTACTCGG + Intronic
911625640 1:100120922-100120944 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
912120956 1:106472165-106472187 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
912154198 1:106897117-106897139 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
912371786 1:109179274-109179296 CGCCTTTAGTCCCAGCTACTCGG + Intronic
912479408 1:109968900-109968922 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
912539077 1:110398737-110398759 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
912838790 1:113020512-113020534 CGCCTGTAGTCCCACCTACTCGG + Intergenic
912986094 1:114432658-114432680 CGCCTGTAGCCCCAGCTACTCGG + Intronic
912988889 1:114463892-114463914 CGCCTTTAGTCCCAGCTACTTGG - Intronic
914243109 1:145865804-145865826 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
914705638 1:150167555-150167577 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
914743262 1:150482616-150482638 CGCCTGTAGTCCCACCTACTCGG - Intergenic
914759525 1:150587327-150587349 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
914895806 1:151671361-151671383 GGCCTATAGCCCCAGCTAGTGGG - Intronic
915133599 1:153713712-153713734 CGCCTGTAGTCCCACCTACTCGG - Intergenic
915232765 1:154458090-154458112 CGCCTGTAGTCCCACCTACTCGG - Intronic
915409610 1:155689784-155689806 CGCCTGTAGCCCCAGCTACTCGG + Intronic
915455785 1:156039809-156039831 CGCCTTTAGTCCCAGCTACTCGG + Intronic
915743670 1:158139778-158139800 CGCCTGTAGTCCCACCTACTCGG - Intergenic
915913777 1:159929568-159929590 CTCCTTAAGCCCCTCCTACCTGG - Intronic
915964910 1:160298053-160298075 CGCCTGTAGTCCCACCTACTCGG + Intronic
916062640 1:161110963-161110985 CGCCTGTAGTCCCACCTACTCGG - Intronic
916441609 1:164831512-164831534 CGCCTGTAGTCCCACCTACTTGG - Intronic
916480322 1:165208770-165208792 CGCCTGTAGTCCCACCTACTCGG - Intronic
916569971 1:166016707-166016729 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
916631530 1:166619283-166619305 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
916693462 1:167213448-167213470 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
916857957 1:168770576-168770598 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
917095209 1:171392827-171392849 CGCCTGTAGTCCCACCTACTTGG + Intergenic
917109695 1:171533747-171533769 CGCCTGTAGCCCCAGCTACTTGG - Intronic
917804849 1:178604382-178604404 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
918035348 1:180866084-180866106 CGCCTGTAGCCCCAGCTACTCGG + Intronic
918206701 1:182315862-182315884 CGCCTGTAGTCCCACCTACTTGG - Intergenic
918224032 1:182463166-182463188 CGCCTGTAGTCCCACCTACTTGG + Intronic
918671044 1:187217068-187217090 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
918679023 1:187328130-187328152 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
918742609 1:188154253-188154275 CGCCTGTAGACCCACCTACTCGG - Intergenic
919004690 1:191881654-191881676 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
919059539 1:192614075-192614097 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
919147693 1:193655884-193655906 CGCCTGTAGTCCCACCTACTCGG - Intergenic
919195760 1:194283585-194283607 CGCCTGTAGTCCCACCTACTCGG + Intergenic
919508511 1:198430505-198430527 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
919621454 1:199868570-199868592 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
919663576 1:200271136-200271158 CGCCTGTAGTCCCACCTACTTGG - Intergenic
919667528 1:200306343-200306365 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
919695200 1:200567417-200567439 CGCCTGTAGCCCCAGCTACTCGG + Intronic
919905284 1:202074265-202074287 CGCCTGTAGTCCCACCTACTTGG - Intergenic
919997460 1:202766378-202766400 CGCCTGTAGTCCCACCTACTTGG + Intronic
920269436 1:204752156-204752178 CGCCTGCAGCCCCACCCAGGAGG - Intergenic
920910157 1:210209043-210209065 CGCCTGTAGTCCCACCTACTCGG + Intergenic
921025515 1:211276958-211276980 CGCCTGTAGCCCCAGCTACTTGG + Intronic
921201323 1:212809556-212809578 CGCCTGTAGTCCCACCTACTCGG + Intronic
921564206 1:216697089-216697111 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
921620429 1:217320334-217320356 TGCCTGAAGTCCCACCTACTTGG - Intergenic
922287162 1:224180648-224180670 CGCCTGTAGCCCCAGCTACTTGG - Intronic
922933024 1:229404704-229404726 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
923168411 1:231389820-231389842 CGCCTGTAGCCCCAGCTACTTGG + Intronic
923392967 1:233532090-233532112 CACCTGAAGCCCCACCTACTTGG - Intergenic
923480731 1:234380872-234380894 CGCCTGTAGTCCCACCTACTCGG + Intronic
923603083 1:235420606-235420628 CGCCTGTAGCCCCAGCTACTTGG - Intronic
923758066 1:236812004-236812026 CGCCTGTAGCCCCAGCTACTGGG - Intronic
923872101 1:238006623-238006645 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
924013213 1:239690343-239690365 CGCCTGTAGCCCCAGCTACTCGG - Intronic
924042217 1:239995103-239995125 CGCCTGTAGTCCCACCTACTTGG - Intergenic
924091948 1:240510242-240510264 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
924150887 1:241128149-241128171 CGCCTTTAGTCCCAGCTACTAGG + Intronic
924713801 1:246553540-246553562 CGCCTGTAGTCCCACCTACTGGG + Intronic
1063169914 10:3499653-3499675 CGCCTATAGTCCCAGCTAGTGGG - Intergenic
1063516816 10:6704644-6704666 TGCCTGAAGCCCCAGCTACTTGG - Intergenic
1063595310 10:7429763-7429785 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1063637583 10:7798530-7798552 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1063996784 10:11627204-11627226 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1064059885 10:12129067-12129089 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1064080078 10:12301309-12301331 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1064284825 10:13983084-13983106 CGCCTATAGCCCCAGCTAGTTGG - Intronic
1064762882 10:18639366-18639388 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1065085771 10:22174358-22174380 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1065095658 10:22278287-22278309 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1065264891 10:23964679-23964701 CACCTGAAGCCCCAGCTACTCGG - Intronic
1065479616 10:26178925-26178947 CGCCTGGAGCCCCAGCTACTAGG - Intronic
1065587879 10:27238069-27238091 CGCCTGTAGTCCCACCTACTCGG - Intronic
1065628711 10:27655970-27655992 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1065743834 10:28820746-28820768 CGCCTGAAGTCCCACCTACCTGG - Intergenic
1065802458 10:29365365-29365387 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1065845325 10:29738304-29738326 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1065855171 10:29824328-29824350 CACCTGCAGCCCCAGCTAGTCGG + Intergenic
1065962773 10:30747494-30747516 CGCCTATAGTCCCACCTACTTGG + Intergenic
1066082928 10:31949920-31949942 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1066135237 10:32439183-32439205 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1066150394 10:32610228-32610250 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1066406664 10:35125953-35125975 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1066567673 10:36737344-36737366 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1067341210 10:45405862-45405884 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1067847004 10:49732646-49732668 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1068196570 10:53725126-53725148 CGCCTATAGTCCCAGCTAGTTGG - Intergenic
1068203249 10:53812331-53812353 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1068352687 10:55869347-55869369 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1068518710 10:58055705-58055727 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1068667558 10:59693743-59693765 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1068921956 10:62494083-62494105 TGCCTTTAGCCCCAGCTACTTGG + Intronic
1069019712 10:63472908-63472930 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1069051939 10:63804133-63804155 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1069190100 10:65476943-65476965 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1069428054 10:68307623-68307645 CGCCTGTAGTCCCACCTACTCGG - Intronic
1069470376 10:68683402-68683424 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1069476225 10:68735220-68735242 CGCCTGTAGTCCCACCTACTCGG + Intronic
1069698790 10:70407021-70407043 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1069700440 10:70420918-70420940 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1070033377 10:72698628-72698650 TGCCTTTAGCCCCATCTACTCGG - Intronic
1070167327 10:73908730-73908752 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1070245511 10:74728013-74728035 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1070795707 10:79215104-79215126 AGCCTTAAGCCCCAGCAAATGGG - Intronic
1071541903 10:86492933-86492955 CGCCTATAGTCCCACCTACTTGG + Intronic
1071806314 10:89124828-89124850 CGCCTGTAGCCCCAGCTACTAGG + Intergenic
1072118389 10:92385244-92385266 CGCCTGAAGGCCCAGCTACTCGG - Intergenic
1072339168 10:94429857-94429879 CACCTGAAGCCCCAGCTACTTGG - Intronic
1072582480 10:96751386-96751408 CGCCTGTAGTCCCACCTATTCGG + Intergenic
1072590625 10:96825667-96825689 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1073040032 10:100597515-100597537 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1073054510 10:100690554-100690576 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1073149842 10:101304193-101304215 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1073297971 10:102452489-102452511 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1073410959 10:103341380-103341402 CGCCTTTAGTCCTACCTACTTGG - Intronic
1073412894 10:103357048-103357070 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1073924703 10:108502130-108502152 CACCTTTAGCCCCATCTACTTGG + Intergenic
1074050736 10:109879114-109879136 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1074083436 10:110186503-110186525 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1074152641 10:110771249-110771271 CGCCTGTAGTCCCACCTACTCGG - Intronic
1074617261 10:115081589-115081611 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1074801731 10:117006438-117006460 CGCCTGTAGTCCCACCTACTCGG + Intronic
1075258250 10:120942313-120942335 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1075362679 10:121853236-121853258 CGCCTGTAGTCCCACCTACTCGG + Intronic
1075370291 10:121929224-121929246 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1075561022 10:123468620-123468642 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1076074290 10:127521031-127521053 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1076438240 10:130460898-130460920 CGCCTGTAGTCCCACCTACTAGG + Intergenic
1076724144 10:132405500-132405522 CGCCTGAAGCCCCACCGTCTGGG + Exonic
1076731862 10:132443204-132443226 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1077270741 11:1678471-1678493 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1077336010 11:2004874-2004896 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1077544835 11:3164875-3164897 TCCTTTAAGCCCCACCAAGTGGG + Intronic
1077629855 11:3803914-3803936 CGCCTGAAGTCCCAGCTACTAGG - Intronic
1078175374 11:8965561-8965583 CGCCTGTAGTCCCACCTACTAGG - Intergenic
1078225985 11:9391890-9391912 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1078261067 11:9709248-9709270 TGCCTTTAGCCCCAGCTACTCGG - Intronic
1078627552 11:12971352-12971374 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1078744470 11:14098119-14098141 CGCCTGTAGTCCCAGCTAGTGGG - Intronic
1078784178 11:14471794-14471816 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1079015023 11:16861521-16861543 CGCCTGTAGTCCCACCTACTAGG + Intronic
1079046046 11:17104597-17104619 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1079202603 11:18388304-18388326 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1079564013 11:21858567-21858589 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1079638356 11:22773517-22773539 CGCCTGCAGTCCCACCTACTCGG - Intronic
1080082842 11:28241406-28241428 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1080401017 11:31935494-31935516 CGCCTTTAACCCCAGCTACTTGG - Intronic
1080655642 11:34256026-34256048 GGACTTAATCTCCACCTAGTGGG - Intronic
1081462397 11:43283937-43283959 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1081465661 11:43313961-43313983 CGCCTGAAGTCCCAGCTATTTGG + Intronic
1081980351 11:47262251-47262273 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1082047115 11:47738804-47738826 CACCTGAAGCCCCAGCTACTTGG - Intronic
1082088510 11:48069573-48069595 CGCCTGTAGCCCCATCTACTCGG - Intronic
1082777793 11:57260893-57260915 CACCTGTAGCCCCAGCTAGTTGG + Intergenic
1083007508 11:59361404-59361426 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1083040007 11:59676518-59676540 CGCCTATAGCCCCAGCTACTTGG - Intergenic
1083109662 11:60392993-60393015 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1083166752 11:60893376-60893398 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1083392895 11:62367814-62367836 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1083584756 11:63848674-63848696 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1083620424 11:64046623-64046645 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1083693657 11:64427870-64427892 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1083781846 11:64922747-64922769 CGCCTGAAGTCCCAGCTATTCGG + Intronic
1083858990 11:65409638-65409660 CGCCTGAAGTCCCAGCTAGTTGG + Intronic
1083942459 11:65903810-65903832 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1084046779 11:66573452-66573474 CACCTGAAGTCCCACCTACTCGG + Intergenic
1084094261 11:66900298-66900320 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1084152673 11:67298185-67298207 CGCCTGTAGTCCCACCTACTTGG - Intronic
1084595189 11:70112681-70112703 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1084672109 11:70613327-70613349 CGCCTGTAGTCCCACCTACTTGG - Intronic
1084722887 11:70919506-70919528 CGCCTTTAGTCCCAGCTATTCGG - Intronic
1084960867 11:72715694-72715716 CACCTTGAGACCCACCTACTCGG - Intronic
1085165500 11:74396538-74396560 CGCCTGTAGCCCCAGCTATTCGG - Intronic
1085223279 11:74894679-74894701 CCCCATAATCCCCACCCAGTGGG - Intronic
1085556593 11:77428444-77428466 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1085597712 11:77825104-77825126 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1085632999 11:78135227-78135249 CACCTTAAGTCCCAGCTACTTGG + Intronic
1085647459 11:78235276-78235298 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1085674298 11:78500964-78500986 CGCCTTTAGTCCCAGCTAGCTGG + Intronic
1086396504 11:86421433-86421455 CGCCTGTAGCCCCAGCTAGTCGG - Intronic
1086775006 11:90819648-90819670 CGCCTGAAGCCCCAGCTATTCGG - Intergenic
1087273715 11:96139349-96139371 CGCCTGTAGCCCCAGCTACTGGG + Intronic
1087540000 11:99504413-99504435 GGCCTTTAGCCCCAGCTACTTGG + Intronic
1087636554 11:100708385-100708407 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1087669463 11:101088455-101088477 CGCCTGTAGTCCCACCTACTTGG - Intronic
1087699292 11:101417571-101417593 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1087883728 11:103451456-103451478 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1088332954 11:108671933-108671955 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1088494148 11:110416962-110416984 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1088639417 11:111856979-111857001 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1088665751 11:112091940-112091962 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1089227766 11:116940353-116940375 CGCCTATAGTCCCACCTACTCGG - Intronic
1089813443 11:121150769-121150791 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1089819389 11:121210107-121210129 CGCCTTCAGTCCCAGCTACTCGG + Intergenic
1089873034 11:121693759-121693781 CACCTTTAGCCCCAGCTACTTGG + Intergenic
1089882185 11:121785398-121785420 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1090191374 11:124771640-124771662 CGCCTGTAGTCCCACCTACTCGG + Intronic
1090327561 11:125902486-125902508 CGCCTGCAGTCCCAGCTAGTTGG + Intronic
1090371723 11:126259844-126259866 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1202818994 11_KI270721v1_random:60056-60078 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1091432663 12:449856-449878 CGCCTATAGCCCCAGCTACTTGG + Intergenic
1091472920 12:745621-745643 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1091738421 12:2942243-2942265 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1091815359 12:3433735-3433757 CACCTGTAGCCCCAGCTAGTCGG - Intronic
1092132480 12:6122487-6122509 CGGCAAAAGACCCACCTAGTAGG + Intronic
1092201953 12:6590693-6590715 AGCCTACAGCCCCAGCTAGTTGG + Intronic
1092381745 12:8002294-8002316 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1092695571 12:11167568-11167590 CGCCTGTAGTCCCACCTACTCGG - Intronic
1092732983 12:11551746-11551768 CGCCTGAAGTCCCAGCTACTTGG - Intergenic
1092828721 12:12423125-12423147 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1092873950 12:12832168-12832190 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1093059949 12:14591334-14591356 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1093642228 12:21541140-21541162 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1093654928 12:21683760-21683782 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1094032167 12:26024829-26024851 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1094453863 12:30610518-30610540 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1094611602 12:32000287-32000309 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1095155823 12:38852301-38852323 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1095397645 12:41778643-41778665 CGCCTTTAGACCCAGCTACTCGG + Intergenic
1095571988 12:43693794-43693816 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1095586191 12:43852303-43852325 CGCCTGTAGTCCCAGCTAGTGGG + Intronic
1095596332 12:43962800-43962822 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1095649196 12:44587144-44587166 CGCCTGTAGTCCCACCTACTCGG + Intronic
1095667618 12:44820481-44820503 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1096031679 12:48421653-48421675 CGCCTATAGCCCCAGCTACTTGG - Intergenic
1096083334 12:48848158-48848180 CGCCTGTAGTCCCACCTACTCGG + Intronic
1096138180 12:49220181-49220203 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1096158024 12:49352388-49352410 TGCCTGTAGCCCCAGCTAGTCGG + Exonic
1096270413 12:50161998-50162020 CGCCTTAAGTCCCAGCTACTTGG - Intronic
1096418223 12:51432283-51432305 CGCCTGTAGTCCCACCTACTCGG + Intronic
1096472382 12:51887900-51887922 AGCCTAAAGCCCCTCCTAATTGG - Intergenic
1096510368 12:52124600-52124622 CGCCTGCAGCCCCAGCTACTTGG - Intergenic
1096632742 12:52939376-52939398 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1096695737 12:53347022-53347044 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1096703606 12:53404043-53404065 CGCCTGTAGTCCCACCTACTAGG + Intronic
1096768715 12:53917676-53917698 CGCCTATAGCCCCAGCTACTGGG - Intergenic
1096998898 12:55859174-55859196 CGCCTGTAGTCCCAACTAGTCGG - Intergenic
1097116327 12:56700040-56700062 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1097219144 12:57436790-57436812 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1097299871 12:58006568-58006590 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1097519965 12:60655260-60655282 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1098089536 12:66886138-66886160 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1098252479 12:68584660-68584682 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1098645880 12:72900376-72900398 TGCCTGAAGTCCCACCTACTCGG + Intergenic
1098695995 12:73555663-73555685 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1098786044 12:74756970-74756992 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1098960729 12:76737571-76737593 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1098968682 12:76824715-76824737 CGCCTATAGTCCCAGCTAGTAGG + Intronic
1099248937 12:80228314-80228336 CGCCTATAGCCCCAGCTACTTGG + Intronic
1099373086 12:81862159-81862181 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1099393907 12:82115015-82115037 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1099693200 12:85987260-85987282 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1099962544 12:89410552-89410574 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1100412251 12:94331490-94331512 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1101105058 12:101432456-101432478 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1101127917 12:101658003-101658025 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1101310742 12:103576134-103576156 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1101329306 12:103744590-103744612 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1101369727 12:104115438-104115460 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1102063620 12:109954180-109954202 CGCCTATAGCCCCAGCTACTCGG + Intronic
1102233898 12:111282194-111282216 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1102279561 12:111608244-111608266 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1102312183 12:111854365-111854387 CGCCTCAAGTCCCAGCTACTTGG - Intronic
1102464721 12:113121845-113121867 CGCCTAAAGTCCCAGCTGGTCGG - Intronic
1102706810 12:114888249-114888271 CGCCTGTAGCCCCAACTACTCGG - Intergenic
1102876304 12:116451778-116451800 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1102918125 12:116770681-116770703 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1102967390 12:117138696-117138718 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1103313656 12:120033500-120033522 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1103356698 12:120326843-120326865 CGCCTTTAGTCCCAGCTACTGGG + Intronic
1103380903 12:120493735-120493757 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1103483364 12:121265730-121265752 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1103490636 12:121316605-121316627 CGCCTGTAGTCCCACCTACTCGG + Intronic
1103550258 12:121732009-121732031 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1103596280 12:122026139-122026161 CGCCTATAGTCCCACCTACTTGG + Intronic
1103600935 12:122054208-122054230 CGCCTGTAGTCCCACCTACTCGG - Intronic
1103869974 12:124084455-124084477 CGCCTGTAGTCCCACCTACTGGG - Intronic
1104117553 12:125764301-125764323 TGCCTTTAGCCCCAGCTACTTGG + Intergenic
1104341002 12:127948468-127948490 TGCCTATAGCCCCACCTACTCGG - Intergenic
1104504829 12:129321682-129321704 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1104840141 12:131820036-131820058 CGCCTGCAGTCCCACCTACTTGG - Intergenic
1105360170 13:19705365-19705387 CGCCTGTAGCCCCAACTACTCGG + Intronic
1105495328 13:20925776-20925798 CGCCTGAAATCCCACCTACTCGG + Intergenic
1105596947 13:21847782-21847804 CGCCTAAAGTCCCAGCTACTCGG - Intergenic
1105648092 13:22342935-22342957 TGCCTGAAGACCCACCTATTTGG - Intergenic
1106002539 13:25737806-25737828 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1106050830 13:26187847-26187869 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1106171220 13:27290218-27290240 TGCCTTTAGTCCCACCTACTTGG - Intergenic
1106261385 13:28069987-28070009 TGCCTTTAGTCCCAGCTAGTTGG + Intronic
1106471776 13:30062371-30062393 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1106534676 13:30629359-30629381 CGCCTTTAGCACCAGCTACTTGG + Intronic
1106873614 13:34048317-34048339 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1107531860 13:41290221-41290243 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1107853940 13:44596327-44596349 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1107913338 13:45125443-45125465 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1107952267 13:45474281-45474303 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1108193889 13:47972127-47972149 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1108367390 13:49729652-49729674 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1109012647 13:56970889-56970911 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1109063504 13:57652150-57652172 CGCCTGTAGTCCCACCTACTCGG + Intronic
1109106022 13:58252205-58252227 CGCCTGCAGTCCCACCTACTCGG - Intergenic
1110025923 13:70538957-70538979 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1110536725 13:76659163-76659185 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1110800402 13:79687358-79687380 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1110869279 13:80431813-80431835 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1110912278 13:80979999-80980021 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1111137244 13:84063944-84063966 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1111216325 13:85147161-85147183 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1111340413 13:86878480-86878502 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1111689391 13:91542980-91543002 CGCCTGTAGTCCCACCTACTCGG - Intronic
1112147660 13:96719146-96719168 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1112294860 13:98177519-98177541 CGCCTGAAGTCCCAGCTACTAGG + Intronic
1112433410 13:99372992-99373014 CGCCTGTAGTCCCACCTACTTGG + Intronic
1112473444 13:99710048-99710070 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1112801359 13:103113250-103113272 CGCCTGAAGTCCCAGCTATTCGG + Intergenic
1112879184 13:104084999-104085021 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1113046277 13:106158673-106158695 CGCCTGTAGTCCCACCTATTCGG + Intergenic
1113110910 13:106822547-106822569 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1113273167 13:108697846-108697868 CGCCTGTAGCCCCAGCTACTGGG - Intronic
1113489938 13:110683382-110683404 CTCCTATAGCCCCACCTACTGGG - Intronic
1113824908 13:113244713-113244735 CGCCTGTAGTCCCACCTACTTGG + Intronic
1113832458 13:113306963-113306985 CGCCTGTAGCCCCAGCTACTGGG - Intronic
1113833948 13:113316546-113316568 CGCCTACAGTCCCACCTACTTGG - Intronic
1114028342 14:18551061-18551083 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1114029212 14:18561142-18561164 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1114478872 14:23018694-23018716 CGCCTGTAGCCCCAGCTACTGGG + Intronic
1114722494 14:24897282-24897304 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1114864970 14:26579181-26579203 CGCCTGTAGTCCCACCTACTCGG - Intronic
1115242720 14:31265487-31265509 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1115297058 14:31840446-31840468 CGCCTGTAGTCCCACCTACTGGG + Intronic
1115332221 14:32210921-32210943 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1115550956 14:34504718-34504740 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1115567244 14:34635454-34635476 TGCCTTTAGCCCCAGCTACTTGG + Intergenic
1115568815 14:34648180-34648202 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1115604369 14:34985204-34985226 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1115983207 14:39076799-39076821 CGCCTATAGTCCCACCTACTCGG + Intronic
1116015522 14:39402806-39402828 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1116172550 14:41421651-41421673 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1116205677 14:41862988-41863010 CGCCTGTAGTCCCACCTACTCGG - Intronic
1116215132 14:42006899-42006921 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1116257944 14:42581783-42581805 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1116300946 14:43182368-43182390 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1116835298 14:49764356-49764378 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1116954899 14:50913495-50913517 CGCCTGTAGCCCCAGCTACTGGG - Intronic
1116974994 14:51106020-51106042 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1117317189 14:54583067-54583089 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1117424252 14:55579527-55579549 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1117551351 14:56839820-56839842 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1117577954 14:57119087-57119109 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1117660633 14:58000719-58000741 CGCCTGTAGTCCCACCTACTCGG - Intronic
1117881648 14:60318629-60318651 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1118189598 14:63568510-63568532 CGCCTTTAGTCCCAGCTAGTTGG - Intergenic
1118238080 14:64029008-64029030 CGCCTGTAGTCCCACCTACTGGG + Intronic
1118244345 14:64094206-64094228 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1118271346 14:64345271-64345293 CGCCTATAGCCCCAGCTACTCGG + Intergenic
1118372869 14:65152532-65152554 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1118389122 14:65281414-65281436 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1118424444 14:65644414-65644436 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1118445552 14:65848168-65848190 CACCTATAGCCCCACCTACTCGG - Intergenic
1118585522 14:67348645-67348667 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1118695553 14:68381548-68381570 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1118967960 14:70605864-70605886 CGCCTTTAGTCCCAGCTACTGGG - Intergenic
1119224346 14:72933431-72933453 CGCCTGTAGCCCCAGCTATTCGG + Intronic
1119491762 14:75040322-75040344 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1119847395 14:77840720-77840742 CGCCTGAAGTCCCAACTACTTGG + Intronic
1120027662 14:79604358-79604380 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1120172410 14:81258943-81258965 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1120320217 14:82950225-82950247 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1120389286 14:83885351-83885373 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1120711456 14:87797655-87797677 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1120757717 14:88259580-88259602 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1120772551 14:88397007-88397029 CGCCTGTAGTCCCACCTACTTGG - Intronic
1120861859 14:89261800-89261822 CGCCTATAGTCCCAGCTAGTCGG + Intronic
1120962689 14:90139834-90139856 CGCCTGTAGTCCCACCTACTCGG + Intronic
1121056713 14:90861394-90861416 CGCCTGTAGCCCCAGCTACTTGG + Exonic
1121200423 14:92112333-92112355 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1121665056 14:95665907-95665929 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1121770375 14:96530511-96530533 CGCCTGTAGTCCCACCTACTTGG - Intronic
1122524814 14:102373953-102373975 CGCCTGTAGTCCCACCTACTCGG + Intronic
1122572270 14:102713406-102713428 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1122730882 14:103796830-103796852 CGCCTATAGCCCCAGCTACTGGG + Intronic
1123003528 14:105309909-105309931 CGCCTGTAGTCCCAGCTAGTCGG - Exonic
1123438643 15:20273811-20273833 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1123737026 15:23195499-23195521 CGCCTTAAGTCCCAGCTACTCGG + Intergenic
1123763826 15:23455191-23455213 CGCCTGAAGTCCCAGCTACTTGG - Intergenic
1123821630 15:24036295-24036317 CGCCTGTAGCCCCAGGTAGTTGG + Intergenic
1124272832 15:28298668-28298690 CGCCTGTAGTCCCACCTACTTGG + Intronic
1124287724 15:28418475-28418497 CGCCTTAAGTCCCAGCTACTCGG + Intergenic
1124288245 15:28424176-28424198 CGCCTTAAGTCCCAGCTACTCGG + Intergenic
1124294980 15:28493151-28493173 CGCCTTAAGTCCCAGCTACTCGG - Intergenic
1124326940 15:28774265-28774287 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1124343983 15:28909110-28909132 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1124462684 15:29907281-29907303 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1124466239 15:29942337-29942359 GGCCTTCATCTCCACCTAGTGGG - Intronic
1124572067 15:30873545-30873567 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1125295659 15:38200311-38200333 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1125295924 15:38203156-38203178 TGCCTGTAGCCCCAGCTAGTTGG + Intergenic
1125341223 15:38677500-38677522 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1125496656 15:40201790-40201812 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1125689759 15:41586462-41586484 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1125696548 15:41642607-41642629 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1125890390 15:43261213-43261235 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1126032179 15:44509798-44509820 CGCCTATAGCCCCAGCTACTTGG + Intronic
1126042210 15:44602602-44602624 CGCCTGTAGTCCCACCTACTTGG - Intronic
1126114520 15:45196771-45196793 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1126646846 15:50883362-50883384 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1126745576 15:51823059-51823081 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1126788461 15:52198705-52198727 CGCCTGTAGTCCCACCTACTCGG - Intronic
1127086474 15:55428618-55428640 CGCCTGTAGTCCCACCTACTCGG - Intronic
1127110116 15:55659791-55659813 CGCCTGAAGTCCCAGCTACTTGG + Intronic
1127471812 15:59296963-59296985 CGCCTGTAGTCCCACCTACTCGG - Intronic
1127746540 15:61981735-61981757 CGCCTGCAGCCCCAGCTACTTGG + Intronic
1128010594 15:64292082-64292104 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1128140323 15:65295599-65295621 CGCCTGTAATCCCACCTAGTTGG + Intronic
1128165870 15:65464235-65464257 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1128423578 15:67518397-67518419 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1128495501 15:68196172-68196194 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1128585572 15:68846660-68846682 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1129347318 15:74930889-74930911 CGCCTGTGGTCCCACCTAGTTGG + Intronic
1129349194 15:74944592-74944614 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1129427197 15:75472331-75472353 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1129454339 15:75668577-75668599 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1129594641 15:76952744-76952766 CGCCTGTAATCCCACCTAGTCGG - Intronic
1129803535 15:78435851-78435873 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1129860432 15:78856426-78856448 CGCCTGTAGTCCCACCTACTCGG + Intronic
1129985183 15:79912672-79912694 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1130518518 15:84644702-84644724 CGCCTGTAGTCCCACCTACTTGG - Intronic
1130927841 15:88398517-88398539 CTCCTTAAGCTCCCCCTAGCTGG + Intergenic
1131010343 15:89012217-89012239 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1131153358 15:90060426-90060448 TGCCTTTAGTCCCACCTACTTGG + Intronic
1131161962 15:90111493-90111515 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1131207405 15:90462040-90462062 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1131267699 15:90927524-90927546 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1131483307 15:92800257-92800279 CACCTGTAGCCCCACCTACTTGG - Intronic
1131594285 15:93781211-93781233 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1132170213 15:99643715-99643737 CGCCTGTAGTCCCACCTACTCGG - Intronic
1132528849 16:433728-433750 CGCCTGTAGACCCACCTACTTGG + Intronic
1132600866 16:772360-772382 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1132818149 16:1845392-1845414 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1132821543 16:1874392-1874414 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1132874322 16:2129283-2129305 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1132979598 16:2729860-2729882 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1133098572 16:3465139-3465161 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1133136409 16:3715310-3715332 CGCCTAAAGTCCCAGCTACTCGG + Intronic
1133193199 16:4149818-4149840 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1133218022 16:4305225-4305247 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1133279740 16:4658408-4658430 CGCCTGTAGTCCCACCTACTGGG + Intronic
1133372870 16:5258788-5258810 CGCCTATAGTCCCACCTACTCGG + Intergenic
1133376151 16:5288997-5289019 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1133437026 16:5788501-5788523 TGCCTGAAGTCCCAGCTAGTTGG + Intergenic
1133503305 16:6386059-6386081 CGCCTGTAGTCCCACCTACTGGG - Intronic
1133585207 16:7187561-7187583 CGCCTGTAGTCCCACCTACTCGG + Intronic
1133789429 16:8998035-8998057 CGCCTGCAGTCCCACCTACTCGG - Intergenic
1133863847 16:9622998-9623020 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1134153232 16:11821451-11821473 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1134165883 16:11929046-11929068 CACCTTCATCCCCACCCAGTGGG - Intronic
1134166573 16:11934731-11934753 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1134167653 16:11943191-11943213 CGCCTGTAGTCCCACCTACTTGG + Intronic
1134397535 16:13878781-13878803 AGCCTTTAGCCCCAGCTACTTGG + Intergenic
1134434559 16:14244001-14244023 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1134493046 16:14710532-14710554 CGCCTGTAGTCCCACCTACTTGG - Intronic
1134494837 16:14724695-14724717 CACCTTCATCCCCACCCAGTGGG + Intronic
1134498427 16:14749656-14749678 CGCCTGTAGTCCCACCTACTTGG - Intronic
1134500220 16:14763815-14763837 CACCTTCATCCCCACCCAGTGGG + Intronic
1134524977 16:14936279-14936301 CGCCTGTAGTCCCACCTACTTGG - Intronic
1134526762 16:14950427-14950449 CACCTTCATCCCCACCCAGTGGG + Intronic
1134545644 16:15105921-15105943 CACCTTCATCCCCACCCAGTGGG - Intronic
1134547917 16:15124644-15124666 CGCCTGTAGTCCCACCTACTTGG + Intronic
1134553267 16:15148112-15148134 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1134580359 16:15365235-15365257 CACCTTCATCCCCACCCAGTGGG - Intronic
1134712567 16:16334766-16334788 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1134714339 16:16348904-16348926 CACCTTCATCCCCACCCAGTGGG + Intergenic
1134722214 16:16392268-16392290 CACCTTCATCCCCACCCAGTGGG + Intronic
1134936127 16:18247510-18247532 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1134945213 16:18319601-18319623 CACCTTCATCCCCACCCAGTGGG - Intronic
1134952477 16:18359754-18359776 CACCTTCATCCCCACCCAGTGGG - Intergenic
1134954260 16:18373927-18373949 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1135014036 16:18908752-18908774 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1135078354 16:19413102-19413124 CGCCTAAAGCCCTAGCTACTTGG - Intronic
1135287665 16:21208089-21208111 TGCCTGTAGCCCCAACTAGTTGG + Intronic
1135311276 16:21406460-21406482 CACCTTCATCCCCACCCAGTGGG - Intronic
1135313082 16:21420843-21420865 CGCCTGTAGTCCCACCTACTTGG + Intronic
1135324687 16:21518943-21518965 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1135364228 16:21838911-21838933 CACCTTCATCCCCACCCAGTGGG - Intronic
1135366006 16:21853123-21853145 CGCCTGTAGTCCCACCTACTTGG + Intronic
1135445809 16:22518039-22518061 CGCCTGTAGTCCCACCTACTTGG - Intronic
1135447615 16:22532437-22532459 CACCTTCATCCCCACCCAGTGGG + Intronic
1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG + Exonic
1136150430 16:28344354-28344376 CACCTTCATCCCCACCCAGTGGG - Intronic
1136166667 16:28458192-28458214 CACCTTCATCCCCACCCAGTGGG - Intronic
1136196308 16:28656840-28656862 CACCTTCATCCCCACCCAGTGGG + Intronic
1136212649 16:28770965-28770987 CACCTTCATCCCCACCCAGTGGG + Intronic
1136257370 16:29050879-29050901 CACCTTCATCCCCACCCAGTGGG + Intronic
1136307980 16:29385456-29385478 CACCTTCATCCCCACCCAGTGGG - Intronic
1136321396 16:29487000-29487022 CACCTTCATCCCCACCCAGTGGG - Intronic
1136323193 16:29501349-29501371 CGCCTGTAGTCCCACCTACTTGG + Intronic
1136331200 16:29578046-29578068 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1136336174 16:29612213-29612235 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1136401200 16:30020032-30020054 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1136436076 16:30226970-30226992 CACCTTCATCCCCACCCAGTGGG - Intronic
1136437878 16:30241319-30241341 CGCCTGTAGTCCCACCTACTTGG + Intronic
1136507474 16:30714188-30714210 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1136565359 16:31066429-31066451 CGCCTTAAGTCCCAGCTACGTGG + Intronic
1136628375 16:31475550-31475572 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1136798015 16:33041774-33041796 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1137276819 16:46940194-46940216 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1137306631 16:47207206-47207228 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1137314427 16:47301520-47301542 CGCCTGTAGTCCCACCTACTCGG - Intronic
1137402306 16:48163567-48163589 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1137417421 16:48296599-48296621 CGCCTGTAGTCCCACCTACTCGG + Intronic
1137457570 16:48629822-48629844 CGCCTGCAGTCCCACCTACTTGG + Intergenic
1137566253 16:49534377-49534399 CGCCTGTAGTCCCACCTACTTGG - Intronic
1137993473 16:53184068-53184090 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1138055440 16:53828343-53828365 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1138119447 16:54387430-54387452 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1138681790 16:58689008-58689030 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1138709179 16:58950170-58950192 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1138969170 16:62123989-62124011 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1139116985 16:63966467-63966489 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1139147505 16:64341834-64341856 CACCTGAAGCCCCAGCTACTCGG - Intergenic
1139154452 16:64423726-64423748 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1139241468 16:65396618-65396640 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1139412329 16:66774003-66774025 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1139417661 16:66827441-66827463 CGCCTGTAGTCCCACCTACTCGG + Intronic
1139428367 16:66897092-66897114 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1139525505 16:67513364-67513386 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1139723746 16:68878948-68878970 CACCTGTAGCCCCAGCTAGTTGG + Intronic
1139762701 16:69199467-69199489 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1139772272 16:69287731-69287753 TGCCTTAAGTCCCAGCTACTCGG + Intronic
1139831885 16:69806073-69806095 CGCCTGTAGTCCCACCTACTTGG + Intronic
1139855671 16:69977885-69977907 CACCTTCATCCCCACCCAGTGGG - Intergenic
1139857435 16:69991947-69991969 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1139871260 16:70110485-70110507 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1139873882 16:70129468-70129490 CGCCTGTAGTCCCACCTACTCGG - Intronic
1140073278 16:71671786-71671808 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1140361899 16:74351672-74351694 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1140367061 16:74390202-74390224 CACCTTCATCCCCACCCAGTGGG + Intronic
1140402963 16:74686455-74686477 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1140495511 16:75383691-75383713 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1140756207 16:78069741-78069763 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1140767608 16:78174860-78174882 CGCCTTTAGTCCCAGCTACTGGG + Intronic
1140823734 16:78686383-78686405 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1140827698 16:78722914-78722936 CGCCTGTAGCCCCACCTACTTGG + Intronic
1141089401 16:81119946-81119968 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1141142615 16:81506777-81506799 CGCCTATAGCCCCAGCTATTTGG + Intronic
1141956452 16:87375178-87375200 CGCCTGTAGTCCCACCTACTTGG + Intronic
1142055323 16:87990886-87990908 CGCCTGTAGTCCCAGCTAGTGGG - Intronic
1142152316 16:88518077-88518099 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1142209416 16:88801446-88801468 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1142209438 16:88801594-88801616 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1142337848 16:89501819-89501841 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1142384154 16:89751894-89751916 CACCTGTAGCCCCACCTACTCGG - Intronic
1142415659 16:89939751-89939773 CGCCTTTAGTCCCAACTACTCGG + Intergenic
1142417700 16:89952001-89952023 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1142581433 17:945503-945525 CGCCTGTAGTCCCACCTACTTGG + Intronic
1142635517 17:1254805-1254827 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1142660731 17:1427465-1427487 CGCCTGTAGTCCCACCTACTCGG + Intronic
1142816506 17:2430236-2430258 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1142908586 17:3066872-3066894 CGCCTATAGTCCCACCTACTCGG - Intergenic
1142925978 17:3237373-3237395 CGCCTATAGTCCCACCTACTCGG + Intergenic
1143047887 17:4097133-4097155 CGCCTGTAGTCCCACCTACTCGG + Intronic
1143217135 17:5233496-5233518 CGCCTATAGCCCCAGCTACTCGG - Intronic
1143330704 17:6133020-6133042 CGCCTGCAGTCCCAGCTAGTCGG - Intergenic
1143392657 17:6569096-6569118 TGCCTTTAGCCCCAGCTACTCGG + Intergenic
1143468518 17:7155738-7155760 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1143643813 17:8216523-8216545 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1143677182 17:8442903-8442925 CGCCTGTAGTCCCACCTACTCGG - Intronic
1143716477 17:8775036-8775058 CGCCTCTAGTCCCACCTAGTCGG - Intergenic
1143746806 17:9001008-9001030 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1143785472 17:9252316-9252338 CGCCTGTAGTCCCACCTACTTGG + Intronic
1143820940 17:9562278-9562300 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1143908500 17:10228429-10228451 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1143998497 17:11030836-11030858 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1144221700 17:13105574-13105596 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1144591039 17:16523997-16524019 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1144816242 17:18037456-18037478 CGCCTGTAGTCCCACCTACTTGG + Intronic
1145075630 17:19852393-19852415 CGCCTATAGCCCCAGCTACTTGG + Intronic
1145222749 17:21102917-21102939 TGCCTGTAGCCCCAACTAGTTGG + Intergenic
1145835314 17:27950349-27950371 CGCCTACAGTCCCACCTACTTGG + Intergenic
1145928893 17:28669808-28669830 CGCCTGTAGTCCCACCTACTCGG + Intronic
1146088285 17:29850857-29850879 CGCCTGCAGTCCCACCTACTCGG + Intronic
1146119001 17:30173087-30173109 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1146205388 17:30900725-30900747 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1146376189 17:32296100-32296122 CGCCTGTAGTCCCACCTACTCGG + Intronic
1146395335 17:32460645-32460667 CGCCTGAAGTCCCAGCTACTGGG + Intronic
1146468071 17:33102907-33102929 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1146769434 17:35555244-35555266 CGCCTGTAGTCCCACCTATTCGG + Intronic
1146803051 17:35842856-35842878 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1146900505 17:36583177-36583199 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1147035003 17:37673298-37673320 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1147136695 17:38438193-38438215 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1147274570 17:39304715-39304737 CGCCTTTAGTCCCAGCTATTTGG - Intronic
1147287998 17:39418405-39418427 TGCCTATAGCCCCACCTACTTGG + Intronic
1147397566 17:40156561-40156583 CGCCTGTAGTCCCACCTACTTGG + Intronic
1147687036 17:42292452-42292474 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1147807724 17:43144095-43144117 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1147856927 17:43488150-43488172 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1148035233 17:44655441-44655463 CGCCTGTAGCCCCAACTACTCGG + Intergenic
1148112650 17:45154834-45154856 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1148114518 17:45167718-45167740 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1148263057 17:46201035-46201057 CGCCTGTAGTCCCACCTACTTGG - Intronic
1148603823 17:48913478-48913500 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1148609646 17:48956122-48956144 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1148625082 17:49063036-49063058 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1148902980 17:50892614-50892636 CGCCTATAGTCCCACCTACTTGG - Intergenic
1148918982 17:51012442-51012464 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1149273072 17:55004051-55004073 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1149294513 17:55249797-55249819 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1149676677 17:58470798-58470820 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1149813804 17:59703931-59703953 TGCCTGAAGTCCCACCTACTTGG - Intronic
1150055149 17:62007720-62007742 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1150074632 17:62182024-62182046 CGCCTGTAGCCCCAGCTACTAGG - Intergenic
1150352358 17:64455577-64455599 CGCCTGTAGTCCCACCTACTCGG - Intronic
1150706907 17:67495180-67495202 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1150742383 17:67789845-67789867 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1150834008 17:68548402-68548424 CGCCTTTAGTCCCAGCTATTTGG + Intronic
1150910925 17:69386713-69386735 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1150968399 17:69998431-69998453 CGCCTGTAGCCCCAGCTACTGGG - Intergenic
1151217840 17:72589998-72590020 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1151262461 17:72927170-72927192 CGCCTGTAGTCCCACCTACTCGG - Intronic
1151274075 17:73020806-73020828 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1151438282 17:74112020-74112042 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1151585765 17:75007522-75007544 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1151741862 17:75988434-75988456 CGCCTGTAGCCCCAGCTACTGGG + Intronic
1152265875 17:79294434-79294456 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1152348398 17:79768957-79768979 CGCCTCTAGCCCCAGCTACTTGG + Intergenic
1152673574 17:81624471-81624493 CGCCTACAGTCCCAGCTAGTCGG + Intronic
1152871131 17:82753580-82753602 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1153039016 18:793163-793185 CGCCTGTAGTCCCACCTACTTGG - Intronic
1153224977 18:2892924-2892946 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1153444319 18:5154909-5154931 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1153689586 18:7578459-7578481 CGCCTATAGCCCCAGCTACTCGG - Intronic
1153809533 18:8739855-8739877 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1153890480 18:9509762-9509784 CGCCTATAGTCCCAGCTAGTCGG + Intronic
1154117143 18:11621077-11621099 CACCTTCATCCCCACCCAGTGGG - Intergenic
1154118880 18:11635198-11635220 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1154281802 18:13010031-13010053 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1155170221 18:23261495-23261517 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1155189115 18:23413816-23413838 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1155193437 18:23451346-23451368 CGCCTATAGTCCCACCTACTCGG + Intergenic
1155925579 18:31651894-31651916 CGCCTGAAGTCCCAGCTACTGGG - Intronic
1155926629 18:31662713-31662735 CGCCTGTAGTCCCACCTACTTGG + Intronic
1155948002 18:31877484-31877506 CGCCTGTAGTCCCACCTACTCGG + Intronic
1155950914 18:31912363-31912385 CGCCTGTAGTCCCACCTACTTGG + Intronic
1155967266 18:32048000-32048022 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1156440876 18:37186439-37186461 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1156775380 18:40781135-40781157 CACCTGTAGCCCCACCTACTAGG - Intergenic
1157510681 18:48270355-48270377 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1157532114 18:48429853-48429875 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1157544375 18:48537814-48537836 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1157825031 18:50804915-50804937 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1157903651 18:51545318-51545340 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1158121185 18:54050085-54050107 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1158144748 18:54299307-54299329 CGCCTGTAGTCCCACCTACTGGG + Intronic
1158263198 18:55632162-55632184 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1158583408 18:58706109-58706131 CGCCTGTAGTCCCACCTACTCGG - Intronic
1158736581 18:60089313-60089335 CGCCTTCAGTCCCAGCTACTTGG + Intergenic
1159016583 18:63105812-63105834 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1159383849 18:67696691-67696713 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1159520160 18:69509510-69509532 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1159547410 18:69857041-69857063 CGCCTGAAGTCCCAGCTACTCGG + Exonic
1160207557 18:76847589-76847611 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1160458154 18:79017548-79017570 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1160671049 19:363657-363679 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1160998037 19:1893708-1893730 CGCCTGTAGTCCCACCTACTGGG + Intergenic
1161210849 19:3064672-3064694 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1161224094 19:3134863-3134885 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1161360452 19:3846100-3846122 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1161467228 19:4437863-4437885 CGCCTGTAGTCCCACCTACTTGG - Intronic
1161471801 19:4461116-4461138 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1161472561 19:4466484-4466506 CGCCTTTAGTCCCAGCTAGTTGG + Intergenic
1161639279 19:5410445-5410467 CGCCTCAAGTCCCAGCTACTTGG - Intergenic
1161653739 19:5500428-5500450 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1161717632 19:5885922-5885944 CGCCTGTAGTCCCACCTACTCGG + Intronic
1161736044 19:5992633-5992655 CGCCTATAGTCCCACCTACTTGG + Intergenic
1161781541 19:6296347-6296369 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1162008271 19:7794046-7794068 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1162040821 19:7970096-7970118 CGCCTGGAGTCCCACCTACTCGG - Intronic
1162058914 19:8082930-8082952 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1162089637 19:8270608-8270630 CGCCTGTAGTCCCACCTACTTGG + Intronic
1162097410 19:8318843-8318865 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1162110878 19:8399076-8399098 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1162181305 19:8870965-8870987 CGCCTGTAGTCCCACCTACTCGG - Intronic
1162354312 19:10171879-10171901 CGCCTGTAGCCCCAGCTAGTTGG + Intronic
1162562438 19:11424374-11424396 CGCCTGAAGTCCCAGCTACTTGG + Intronic
1162711810 19:12600962-12600984 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1162939290 19:13998356-13998378 TGCCTGTAGCCCCACCTATTCGG + Intronic
1163000331 19:14363062-14363084 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1163498691 19:17662792-17662814 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1163607914 19:18285740-18285762 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1163687683 19:18721317-18721339 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1163731213 19:18950390-18950412 CGCCTGTAGCCCCAGCTACTGGG + Intergenic
1163733000 19:18960964-18960986 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1163898029 19:20076765-20076787 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1164481837 19:28617442-28617464 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1164991333 19:32686530-32686552 CGCCTGTAGTCCCACCTACTAGG + Intergenic
1165024795 19:32952353-32952375 TGCCTAAAGCCCCAGCTACTCGG + Intronic
1165034602 19:33023657-33023679 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1165052860 19:33153618-33153640 CGCCTGTAGTCCCACCTACTCGG - Intronic
1165123251 19:33576773-33576795 CGCCTATAGCCCCAGCTACTTGG + Intergenic
1165188356 19:34040940-34040962 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1165238299 19:34441793-34441815 CGCCTGTAGTCCCACCTACTCGG + Intronic
1165430868 19:35771707-35771729 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1165441108 19:35828388-35828410 CGCCTGTAGTCCCACCTACTCGG - Intronic
1165573693 19:36796402-36796424 CGCCTGTAATCCCACCTAGTCGG - Intergenic
1165671698 19:37685062-37685084 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1165675237 19:37717309-37717331 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1165699021 19:37923009-37923031 CGCCTGTAGTCCCACCTACTCGG + Intronic
1165839943 19:38782510-38782532 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1165951940 19:39479069-39479091 CGCCTGTAGTCCCACCTACTGGG - Intergenic
1166123116 19:40697668-40697690 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1166134847 19:40769866-40769888 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1166190599 19:41174092-41174114 CGCCTGAAGTTCCACCTACTTGG - Intergenic
1166273967 19:41738298-41738320 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1166395618 19:42438230-42438252 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1166491488 19:43264581-43264603 CGCCTGTAGTCCCACCTACTTGG - Intronic
1166539475 19:43595750-43595772 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1166763925 19:45241350-45241372 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1166779648 19:45334696-45334718 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1166865232 19:45831965-45831987 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1166877240 19:45904783-45904805 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1166950312 19:46422862-46422884 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1166952390 19:46438166-46438188 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1167064461 19:47173908-47173930 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1167259001 19:48447197-48447219 CGCCTATAGCCCCAGCTACTTGG - Intronic
1167285004 19:48594133-48594155 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1167452141 19:49577429-49577451 TGCCTGTAGCCCCAGCTAGTCGG + Intronic
1167488495 19:49777507-49777529 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1167652088 19:50737375-50737397 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1167695206 19:51011156-51011178 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1167707760 19:51091726-51091748 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1167778343 19:51577787-51577809 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1167883210 19:52479407-52479429 CGCCCGAAGTCCCACCTACTTGG + Intronic
1167922108 19:52790369-52790391 CACCTTTAGCCCCAGCTACTTGG + Intronic
1167979496 19:53261262-53261284 CGCCTGTAGTCCCAGCTAGTGGG + Intronic
1168071443 19:53954556-53954578 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1168114188 19:54211848-54211870 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1168248327 19:55125715-55125737 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1168285081 19:55327357-55327379 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1168360293 19:55734046-55734068 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1168552477 19:57309165-57309187 CGCCTTTAGTCCCACCTACTCGG + Intergenic
1168634466 19:57984967-57984989 CGCCTGTAGTCCCACCTACTAGG + Intronic
1168656913 19:58136550-58136572 CGCCTTTAGTCCCAGGTAGTTGG + Intronic
925357694 2:3253732-3253754 CGCCTTTAGCTCCTGCTAGTGGG - Intronic
926113968 2:10199652-10199674 CGCCTGAAGTCCCAGCTACTCGG + Intronic
926439605 2:12874348-12874370 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
926511581 2:13787493-13787515 CGCCTGTAGTCCCACCTACTCGG - Intergenic
926827272 2:16918840-16918862 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
927470022 2:23367016-23367038 CGCCTCCAGTCCCAGCTAGTCGG - Intergenic
927605106 2:24479984-24480006 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
927774207 2:25889420-25889442 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
928457824 2:31439409-31439431 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
928573346 2:32629558-32629580 CGCCTTTAGTCCCAGCTACTCGG - Intronic
929352990 2:40983264-40983286 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
929447029 2:42009769-42009791 CGCCTTTAGCCCCAGCTACTCGG - Intergenic
929476893 2:42259853-42259875 CGCCTGTAGCCCCAGCTACTTGG - Intronic
929506414 2:42531576-42531598 CGCCTGTAGTCCCACCTACTCGG - Intronic
929531861 2:42757705-42757727 CGCCTATAGCCCCAGCTACTTGG - Intergenic
929609591 2:43260478-43260500 TGCCTGAAGTCCCACCTACTTGG + Intronic
929639759 2:43565960-43565982 CGCCTGAAGTCCCAGCTACTCGG + Intronic
929689658 2:44063815-44063837 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
929816307 2:45235611-45235633 CGCCTGTAGTCCCACCTACTCGG + Intergenic
929853060 2:45610800-45610822 CGCCTGTAGCCCCAGCTACTCGG + Intronic
930047095 2:47182081-47182103 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
930178491 2:48325972-48325994 TGCCTTTAACCCCAGCTAGTTGG - Intronic
930191672 2:48466335-48466357 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
930306702 2:49683967-49683989 CGCCTGAAGTCCCAGCTATTAGG - Intergenic
930312562 2:49759749-49759771 CGCCTATAGCCCCAGCTACTTGG + Intergenic
930428284 2:51239782-51239804 CGCCTATAGTCCCAGCTAGTCGG + Intergenic
930609760 2:53528722-53528744 CGCCTGTAGTCCCACCTACTCGG + Intergenic
930654490 2:53994202-53994224 CGCCTGTAGCCCCAGCTACTCGG + Intronic
930763843 2:55063753-55063775 CGCCTGTAGTCCCACCTACTTGG + Intronic
930765914 2:55084911-55084933 TGCCTTAAGTCCCAGCTAGTTGG - Intronic
930951642 2:57149861-57149883 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
930993105 2:57684430-57684452 CGCCTGTAGTCCCACCTACTCGG + Intergenic
931349201 2:61472559-61472581 CGCCTGTAGCCCCAGCTACTAGG - Intergenic
931351001 2:61488974-61488996 CGCCTGTAGTCCCACCTACTCGG + Intronic
931387182 2:61808396-61808418 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
931555135 2:63494792-63494814 CGCCTGTAGTCCCACCTACTCGG + Intronic
931604685 2:64041151-64041173 CGCCTGTAGTCCCACCTACTTGG + Intergenic
931679841 2:64736911-64736933 CGCCTGTAGTCCCACCTACTCGG + Intronic
931769443 2:65485163-65485185 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
932028910 2:68163403-68163425 CGCCTTTAGTCCCACCTACTCGG + Intronic
932372181 2:71199690-71199712 CGCCTTTAGTCCCAGCTACTTGG - Intronic
932539500 2:72637662-72637684 CGCCTTTAGTCCCAGCTACTGGG + Intronic
932787610 2:74621154-74621176 CGCCTGTAGTCCCACCTACTCGG + Intronic
932902973 2:75721113-75721135 CACCTGAAGCCCCAGCTACTTGG - Intergenic
932984901 2:76714168-76714190 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
933148481 2:78885680-78885702 CGCCTGTAGTCCCACCTACTCGG + Intergenic
933638569 2:84734264-84734286 CGCCTGAAGTCCCAGCTACTAGG - Intronic
933818001 2:86084138-86084160 CGCCTGTAGTCCCACCTACTCGG + Intronic
933911638 2:86945749-86945771 CGCCTGTAGTCCCACCTACTCGG + Intronic
934011358 2:87824146-87824168 CGCCTGTAGTCCCACCTACTCGG - Intronic
934095733 2:88601975-88601997 CGCCTGTAGTCCCACCTACTCGG - Intronic
934123473 2:88863101-88863123 CGCCTTTAGTCCCAGCTAGTCGG - Intergenic
934473019 2:94573058-94573080 CGCCTGTAGTCCCACCTACTTGG - Intergenic
934627778 2:95876724-95876746 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
934687564 2:96333057-96333079 AGCCTCAAGGCTCACCTAGTGGG + Intergenic
934805790 2:97224573-97224595 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
934864487 2:97793866-97793888 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
935030443 2:99316880-99316902 CGCCTGTAGTCCCACCTACTGGG - Intronic
935142567 2:100366436-100366458 CGCCTGAAGTCCCAGCTACTTGG - Intergenic
935160013 2:100521858-100521880 CGCCTGTAGCCCCAGCTAATCGG + Intergenic
935286741 2:101571254-101571276 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
935774917 2:106464847-106464869 CGCCTGTAGTCCCACCTACTCGG - Intronic
935905150 2:107831049-107831071 CGCCTGTAGTCCCACCTACTCGG + Intronic
935991514 2:108722763-108722785 CGCCTGTAGTCCCACCTACTCGG + Intronic
936018008 2:108974202-108974224 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
936126933 2:109796131-109796153 CGCCTGTAGTCCCACCTACTCGG + Intronic
936217764 2:110575355-110575377 CGCCTGTAGTCCCACCTACTCGG - Intronic
936426907 2:112429931-112429953 CGCCTGTAGTCCCACCTACTCGG - Intronic
938118277 2:128616875-128616897 CGCCTGTAGTCCCACCTACTCGG + Intergenic
938401800 2:130999278-130999300 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
938416854 2:131110499-131110521 CGCCTGTAGTCCCACCTACTCGG - Intronic
938863001 2:135389577-135389599 CGCCTGTAGTCCCACCTACTGGG + Intronic
938887987 2:135672979-135673001 CGCCTGTAGCCCCAGCTACTGGG + Intronic
938893629 2:135729642-135729664 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
939024360 2:136994439-136994461 CGCCTTTAGTCCCAGCTACTTGG + Intronic
939503519 2:143015017-143015039 CACCTTTAGTCCCACCTACTTGG - Intronic
939802386 2:146726279-146726301 CGCCTGTAGTCCCACCTACTCGG + Intergenic
939810043 2:146820369-146820391 CGCTTTTAGTCCCACCTACTCGG - Intergenic
940155372 2:150650796-150650818 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
940210260 2:151249508-151249530 CGCCTGTAGTCCCACCTACTCGG - Exonic
940215493 2:151299419-151299441 CGCCTGTAGCCCCACCTACTCGG - Intergenic
940276997 2:151949920-151949942 CGCCTGTAGCCCCAGCTACTTGG + Intronic
940384834 2:153058302-153058324 CGCCTGTAGTCCCACCTACTCGG + Intergenic
940523301 2:154779667-154779689 CGCCTGTAGCCCCAGCTACTCGG - Intronic
941157026 2:161991643-161991665 CGCCTGTAGTCCCACCTACTGGG - Intergenic
941450293 2:165652666-165652688 TGCCTGTAGCCCCAGCTAGTTGG - Intronic
941795181 2:169590879-169590901 CGCCTTTAGTCCCAGCTACTCGG + Intronic
941817655 2:169813734-169813756 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
941951709 2:171162410-171162432 CGCCTGAAGTCCCAGCTACTCGG + Intronic
942055392 2:172177609-172177631 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
942339343 2:174926881-174926903 CGCCTTTAGTCCCAGCTACTCGG - Intronic
942475398 2:176314309-176314331 CGCCTGTAGTCCCACCTACTTGG + Intronic
943030429 2:182679307-182679329 CGCCTGTAGTCCCACCTACTTGG - Intergenic
943105423 2:183540948-183540970 CGCCTGCAGCCCCAGCTACTTGG - Intergenic
943641136 2:190359429-190359451 CGCCTGTAGTCCCACCTACTCGG + Intronic
943978130 2:194509737-194509759 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
943988828 2:194659404-194659426 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
944072009 2:195681398-195681420 CGCCTGTAGCCCCAGCTACTCGG + Intronic
944118025 2:196209887-196209909 CGCCTGTAGCCCCATCTACTCGG - Intronic
944424787 2:199569034-199569056 CGCCTGTAGTCCCACCTACTCGG - Intergenic
944556018 2:200888649-200888671 CGCCTGTAGTCCCACCTACTCGG - Intronic
944625077 2:201562311-201562333 CGCCTGTAGTCCCACCTACTCGG - Intronic
944640947 2:201724985-201725007 CGCCTGGAGTCCCACCTACTCGG + Intronic
944668225 2:201974068-201974090 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
944957743 2:204832098-204832120 CGCCTGTAGTCCCAGCTAGTGGG + Intronic
944969807 2:204979078-204979100 CGCCTTTAGTCCCACCTACTTGG + Intronic
945248007 2:207738344-207738366 CGCCTGTAACCCCACCTACTCGG - Intronic
945833690 2:214813501-214813523 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
945852327 2:215023702-215023724 CCCCTAAAGCCCCACATAGTAGG - Intronic
946000024 2:216474627-216474649 CGCCTGTAATCCCACCTAGTTGG + Intronic
946262945 2:218511432-218511454 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
946304542 2:218848292-218848314 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
946439969 2:219686836-219686858 CGCCTATAGCCCCAGCTACTTGG - Intergenic
946877007 2:224139418-224139440 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
947340573 2:229134363-229134385 CGCCTGTAGCCCCAGCTACTTGG - Intronic
947738078 2:232468782-232468804 TGCCTGAAGCCCCAGCTACTAGG - Intergenic
947739225 2:232477420-232477442 CCCCTGAAGACCCACCTACTTGG - Intergenic
948137642 2:235648759-235648781 CGCCTGTAGCCCCAGCTACTCGG + Intronic
948337303 2:237219725-237219747 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
948920073 2:241061757-241061779 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1168751816 20:287781-287803 CGCCTTCAGTCCCAGCTACTCGG + Intronic
1169044746 20:2526243-2526265 CGCCTATAGTCCCACCTACTTGG - Intergenic
1169168299 20:3442099-3442121 TGCCTGTAGTCCCACCTAGTTGG - Intergenic
1169262255 20:4147938-4147960 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1169370048 20:5021735-5021757 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1169370498 20:5025364-5025386 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1169420856 20:5458355-5458377 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1169938869 20:10915392-10915414 CGCCTGTAGCCCCAACTACTCGG + Intergenic
1170000896 20:11612300-11612322 CGCCTGTAGCCCCACCTACTTGG + Intergenic
1170022811 20:11854573-11854595 CGCCTGCAGCCCCAGCTACTCGG + Intergenic
1170024874 20:11878407-11878429 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1170227840 20:14011652-14011674 CGCCTGGAGTCCCAGCTAGTCGG - Intronic
1170229860 20:14034095-14034117 CGCCTGTAGTCCCAACTAGTCGG - Intronic
1170587870 20:17749101-17749123 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1170685960 20:18569698-18569720 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1170996608 20:21366429-21366451 CGCCTGTAGACCCAGCTAGTTGG + Intronic
1171503284 20:25611385-25611407 CACCTTAAGTCCCAGCTACTTGG - Intergenic
1171508098 20:25655817-25655839 CGCCTGTAGTCCCACCTATTCGG - Intergenic
1171989177 20:31682569-31682591 CACCTGTAGTCCCACCTAGTCGG - Intronic
1172030880 20:31981245-31981267 CGCCTGAAGTCCCAGCTACTTGG + Intronic
1172231776 20:33341569-33341591 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1172262937 20:33584389-33584411 CGCCTGTAGTCCCACCTACTTGG - Intronic
1172278851 20:33696380-33696402 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1172316410 20:33958416-33958438 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1172318228 20:33973538-33973560 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1172327933 20:34051719-34051741 CGCCTGTAGCCCCAGCTACTGGG - Intronic
1172554616 20:35830037-35830059 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1172609943 20:36242981-36243003 CACCTGAAGTCCCACCTACTTGG - Intronic
1172806347 20:37614700-37614722 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1172887334 20:38240020-38240042 TGCCTTTAGCCCCAGCTACTCGG - Intronic
1173111322 20:40193168-40193190 CGCCTAAAGTCCCAGCTACTGGG - Intergenic
1173134333 20:40425956-40425978 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1173235198 20:41239126-41239148 CGCCTATAGCCCCAGCTACTCGG - Intronic
1173347843 20:42217245-42217267 CGCCTGAAGTCCCAGCTACTGGG + Intronic
1173610764 20:44365879-44365901 CGCCTGTAGTCCCACCTACTCGG + Intronic
1173999497 20:47364087-47364109 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1174032527 20:47641622-47641644 CGCCTGTAGCCCCAGCTAGTCGG - Intronic
1174530287 20:51206767-51206789 CGCCTATAGTCCCACCTACTCGG - Intergenic
1174638082 20:52019031-52019053 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1174659809 20:52201983-52202005 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1174821600 20:53731129-53731151 CGCCTTTAACCCCAGCTACTTGG + Intergenic
1174937954 20:54893104-54893126 CGCCTGTAGTCCCAGCTAGTGGG - Intergenic
1175080910 20:56419550-56419572 TGCCTGAAGCCCCAGCTACTTGG - Intronic
1175235121 20:57504403-57504425 CGCCTGTAGTCCCACCTACTTGG - Intronic
1175271974 20:57740531-57740553 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1175389855 20:58620226-58620248 CCCCTCAAGCCCCAGCTGGTGGG + Intergenic
1175568991 20:60004638-60004660 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1176202248 20:63866585-63866607 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1176213591 20:63938155-63938177 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1176224494 20:63988369-63988391 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1176417842 21:6488910-6488932 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1177074686 21:16556851-16556873 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1177430871 21:20990513-20990535 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1177546856 21:22569579-22569601 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1177565498 21:22816114-22816136 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1177635563 21:23783084-23783106 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1177669768 21:24209489-24209511 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1177785229 21:25664359-25664381 CGCCTATAGCCCCAGCTACTCGG - Intronic
1178087651 21:29128426-29128448 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1178147438 21:29756253-29756275 CGCCTGCAGCCCCAGCTACTCGG + Intronic
1178559024 21:33620684-33620706 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1178953266 21:37002913-37002935 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1178956287 21:37025010-37025032 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1178961092 21:37065955-37065977 CGCCTGTAGTCCCACCTACTCGG + Intronic
1179105576 21:38397470-38397492 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1179346201 21:40559916-40559938 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1179693336 21:43097241-43097263 CGCCTGTAGTCCCACCTACTTGG - Intronic
1179832834 21:44008868-44008890 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1179964656 21:44795135-44795157 CGCCTATAGCCCCAGCTACTTGG + Intronic
1179994775 21:44968877-44968899 CGCCTGTAGTCCCACCTACTTGG - Intronic
1180452464 22:15478113-15478135 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1180453328 22:15488205-15488227 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1180620838 22:17160521-17160543 CGCCTCAAGTCCCAGCTACTCGG + Intronic
1180889585 22:19276793-19276815 CGCCTGAAGCCCCAGCTACTTGG - Intronic
1181126517 22:20705185-20705207 CGCCTGAAGTCCCAGCTACTTGG - Intergenic
1181275274 22:21684079-21684101 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1181289537 22:21781098-21781120 CGCCTGTAGCCCCAGCTACTAGG + Intronic
1181570699 22:23766576-23766598 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1182185114 22:28393566-28393588 TGCCTTTAGCCCCAGCTACTAGG + Intronic
1182755769 22:32677673-32677695 CGCCTGTAGTCCCACCTACTCGG + Intronic
1182806815 22:33079351-33079373 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1182843305 22:33409733-33409755 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1183001475 22:34863115-34863137 CGCCTTCAGTCCCAGCTACTTGG - Intergenic
1183085192 22:35482710-35482732 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1183216604 22:36484343-36484365 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1183435888 22:37794823-37794845 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1183577110 22:38698880-38698902 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1183587881 22:38763364-38763386 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1183916552 22:41125242-41125264 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1183939201 22:41283381-41283403 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1183949837 22:41346688-41346710 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1183964055 22:41430764-41430786 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1183973422 22:41495744-41495766 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1184120527 22:42446829-42446851 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1184309716 22:43633420-43633442 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1184355716 22:43978307-43978329 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1184583590 22:45433128-45433150 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1184665607 22:45987350-45987372 CGGCTGCAGCCCCACCTAGGAGG - Intergenic
1185042576 22:48512795-48512817 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1185084501 22:48732380-48732402 CGCCTGTAGACCCACCTACTCGG - Intronic
1185190074 22:49429739-49429761 CGCCTTTAGTCCCAGCTAATTGG + Intronic
1185407367 22:50661212-50661234 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
949152641 3:789003-789025 CGCCTGTAGTCCCAGCTAGTGGG + Intergenic
949671665 3:6403380-6403402 TGCCTTTAGTCCCAGCTAGTTGG + Intergenic
949707031 3:6830270-6830292 CGCCTGAAGTCCCAGCTACTTGG + Intronic
949997206 3:9627524-9627546 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
950069057 3:10137170-10137192 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
950460456 3:13118945-13118967 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
950514329 3:13454328-13454350 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
950793502 3:15492539-15492561 CGCCTGTAGTCCCACCTACTTGG + Intronic
950811314 3:15652198-15652220 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
950991759 3:17446843-17446865 CGCCTGTAGTCCCACCTACTTGG + Intronic
951025913 3:17829762-17829784 CACCTGAAGTCCCACCTACTCGG - Intronic
951228552 3:20149368-20149390 CGCCTGAGGCCCCAGCTACTTGG + Intronic
951408375 3:22328949-22328971 CGCCTGTAGTCCCACCTACTTGG + Intronic
951572210 3:24076451-24076473 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
951818390 3:26781407-26781429 CGCCTGTAGTCCCACCTATTTGG - Intergenic
952054254 3:29425246-29425268 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
952332265 3:32374985-32375007 TGCCTGTAGCCCCAGCTAGTCGG - Intergenic
952371419 3:32726568-32726590 CGCCTGTAGCCCCAGCTACTTGG + Intronic
952475596 3:33706837-33706859 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
952642599 3:35615129-35615151 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
953057006 3:39396082-39396104 CGCCTGTAGTCCCACCTACTCGG + Intronic
953083768 3:39646846-39646868 CGCCTGTAGTCCCACCTACTGGG + Intergenic
953147863 3:40295300-40295322 CGCCTGTAGTCCCACCTAATTGG + Intergenic
953319461 3:41959237-41959259 CGCCTGTAGTCCCACCTACTCGG + Intronic
953340047 3:42125974-42125996 CGCCTGTAGCCCCAGCTACTCGG - Intronic
953383487 3:42491698-42491720 CGCCTGTAGCCCCAGCTACTTGG - Intronic
953684084 3:45062471-45062493 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
953723512 3:45377289-45377311 CACCTGTAGCCCCACCTACTTGG - Intergenic
953949392 3:47177027-47177049 CGCCTATAGCCCCAGCTACTAGG + Intergenic
954057436 3:48038974-48038996 CGCCTATAGTCCCACCTATTTGG + Intronic
954112585 3:48443112-48443134 CGCCTTTAGTCCCAGCTACTCGG + Intronic
954180372 3:48876968-48876990 CGCCTGTAGTCCCACCTACTAGG + Intronic
954185214 3:48911812-48911834 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
954220209 3:49148891-49148913 CGCCTGTAGTCCCACCTACTTGG + Intergenic
954229546 3:49206087-49206109 CGCCTGTAGTCCCACCTACTCGG - Intronic
954586766 3:51743382-51743404 TGCCCAAAGCCCCACCTAGTGGG + Intergenic
954641969 3:52106067-52106089 CGCCTGTAGTCCCACCTACTTGG + Intronic
954838346 3:53490972-53490994 CGCCTTAAGTCCCAGCTACGTGG - Intergenic
955066057 3:55534568-55534590 CGCCTGTAGTCCCACCTACTTGG + Intronic
955686474 3:61553966-61553988 CGCCTGTAGTCCCACCTACTCGG + Intergenic
955775091 3:62424307-62424329 CACCTGTAGCCCCACCTACTCGG - Intronic
955915098 3:63899737-63899759 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
956144087 3:66174658-66174680 CGCCTGTAGTCCCACCTACTCGG + Intronic
956192520 3:66621275-66621297 CGCCTATAGTCCCACCTACTCGG + Intergenic
956347125 3:68292650-68292672 CACCTGAAGTCCCACCTACTTGG - Intronic
956666235 3:71644520-71644542 CACCTTTAGCCCCAGCTACTTGG + Intergenic
956875508 3:73458864-73458886 CGCCTGTAGCCCCAGCTACTTGG + Intronic
957121757 3:76102948-76102970 CGCCTGCAGTCCCAGCTAGTTGG - Intronic
957138737 3:76324977-76324999 CGCCTGTAGCCCCAGCTACTCGG + Intronic
957239536 3:77640235-77640257 CGCCTTTAGTCCCAGCTACTCGG - Intronic
957282471 3:78171593-78171615 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
957301279 3:78394510-78394532 CGCCTGTAGTCCCACCTACTTGG - Intergenic
957332846 3:78788239-78788261 CGCCTTTAGCCCCAGCTACTCGG - Intronic
957558191 3:81786991-81787013 CGCCTGTAGTCCCACCTACTCGG + Intergenic
957625745 3:82650470-82650492 CGTCTGCAGCCCCACCCAGTAGG - Intergenic
958821343 3:98977051-98977073 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
959067298 3:101670754-101670776 CGCCTGTAGTCCCACCTACTTGG - Intronic
959069458 3:101688757-101688779 CGCCTGTAGTCCCACCTACTCGG + Intergenic
959194755 3:103166120-103166142 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
959403289 3:105929573-105929595 CGCCTGTAGCCCCAGCTACTAGG - Intergenic
959437732 3:106337694-106337716 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
959664932 3:108910370-108910392 CGCCTGTAGTCCCACCTACTTGG + Intronic
959833590 3:110892816-110892838 CGCCTGTAGTCCCACCTATTCGG - Intronic
959938420 3:112054863-112054885 CGCCTGTAGTCCCACCTACTCGG - Intronic
960108124 3:113819714-113819736 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
960345072 3:116520812-116520834 CGCCTGTAGCCCCAGCTACTCGG + Intronic
960549602 3:118959917-118959939 CGCCTGTAGCCCCAGCTACTCGG + Intronic
960592846 3:119381858-119381880 CGCCTTTAGTTCCAGCTAGTGGG + Intronic
960879346 3:122329089-122329111 CGCCTGTAGTCCCACCTACTCGG - Intronic
960881630 3:122351451-122351473 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
960897009 3:122515563-122515585 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
961597928 3:128034035-128034057 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
961702652 3:128758396-128758418 CGCCTGTAGTCCCACCTACTCGG - Intronic
961765653 3:129208661-129208683 CGCCTGTAGTCCCACCTACTCGG - Intergenic
961856172 3:129873552-129873574 CGCCTCTAGTCCCAGCTAGTCGG + Intronic
962145672 3:132837054-132837076 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
962228053 3:133632896-133632918 CGTCTGTAGCCCCAGCTAGTTGG - Intronic
962547623 3:136453463-136453485 CGCCTGTAGTCCCACCTACTCGG + Intronic
962582297 3:136809253-136809275 CGCCTGTAGTCCCACCTACTTGG - Intergenic
962584589 3:136829345-136829367 CGCCTGAAGTCCCAGCTACTTGG - Intronic
962641381 3:137390189-137390211 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
962670229 3:137697875-137697897 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
962685357 3:137842503-137842525 CGCCTGTAGTCCCACCTACTCGG + Intergenic
962815049 3:138989853-138989875 CGCCTGTAACCCCACCTACTTGG - Intergenic
962858791 3:139376873-139376895 CGCCTGTAGCCCCATCTACTCGG - Intronic
963335387 3:143969480-143969502 CGCCTGTAGTCCCACCTACTCGG - Intergenic
963539188 3:146564605-146564627 CGCCTGTAGTCCCAACTAGTCGG + Intergenic
963757581 3:149251726-149251748 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
964152255 3:153541121-153541143 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
964356485 3:155855781-155855803 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
964365934 3:155950873-155950895 CGCCTGTAGTCCCACCTACTCGG - Intergenic
964717915 3:159742098-159742120 CGCCTGTAGCCCCAGCTACTCGG + Intronic
964745445 3:160007915-160007937 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
964752049 3:160061944-160061966 CGCCTGTAGTCCCACCTACTTGG - Intergenic
965111880 3:164435451-164435473 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
965142409 3:164855910-164855932 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
965282896 3:166776312-166776334 CGCCTGTAGTCCCACCTACTCGG + Intergenic
965576846 3:170226036-170226058 CGCCTGTAGTCCCACCTACTCGG - Intronic
965591469 3:170364074-170364096 CGCCTGAAGTCCCAGCTACTCGG - Intronic
965981594 3:174698736-174698758 CGCCTTTAGTCCCAGCTACTTGG + Intronic
967003594 3:185361524-185361546 CGCCTGTAGCCCCAGCTACTCGG - Intronic
967024713 3:185554717-185554739 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
967029989 3:185596977-185596999 CGCCTTTAGTCCCAGCTACTTGG - Intronic
967040146 3:185684528-185684550 CGCCTGAAGTCCCAGCTACTTGG - Intronic
967146517 3:186611349-186611371 CGCCTGTAGTCCCACCTACTCGG - Intergenic
967617057 3:191582914-191582936 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
967720836 3:192814737-192814759 CGCCTTTAGTCCCAGCTACTGGG + Intronic
967730281 3:192900813-192900835 CGCCTGTAGTCCCACCTACTCGG + Intronic
967801825 3:193670490-193670512 CGCCTGTAGCCCCAGCTACTCGG - Intronic
968214147 3:196873712-196873734 CGCCTGAAGTCCCAGCTACTCGG + Intronic
968266861 3:197369401-197369423 CGCCTGTAGCCCCAGCTACTGGG + Intergenic
968353082 3:198079159-198079181 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
968386780 4:147736-147758 CGCCTGTAGCCCCAGCTACTTGG + Intronic
968414844 4:422180-422202 CGCCTGTAGTCCCAGCTAGTAGG - Intergenic
968419155 4:468139-468161 CGCCTTTAGTCCCAGCTACTTGG + Intronic
968586801 4:1421466-1421488 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
968643069 4:1724514-1724536 CGCCTGTAGCCCCAGCTACTCGG - Intronic
968766715 4:2475289-2475311 CGCCTGTAGCCCCAGCTACTTGG - Intronic
968837900 4:2979097-2979119 CGCCTATAGTCCCACCTACTTGG + Intronic
968948991 4:3680519-3680541 CGCCTATAGCCCCAGCTATTCGG - Intergenic
969408555 4:7012174-7012196 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
969713312 4:8856957-8856979 CGCCTGAAGTCCCAGCTACTCGG + Intronic
969933286 4:10654973-10654995 CGCCTGTAGTCCCACCTACTAGG + Intronic
970517496 4:16847740-16847762 CGCCTGTAGCCCCAGCTACTCGG - Intronic
971064754 4:23018263-23018285 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
971188154 4:24401142-24401164 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
971404374 4:26308148-26308170 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
971507681 4:27384143-27384165 CGCCTGTAGTCCCACCTACTCGG + Intergenic
971733890 4:30420876-30420898 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
971798328 4:31257294-31257316 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
972000200 4:34022095-34022117 CGCCTGTAGTCCCACCTACTCGG + Intergenic
972053391 4:34769323-34769345 CGCCTGTAGCCCCACGTACTCGG + Intergenic
972352328 4:38247210-38247232 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
972395254 4:38653642-38653664 CGCCTATAGCCCCAGCTACTAGG + Intergenic
972517014 4:39818421-39818443 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
972593705 4:40511807-40511829 CGCCTATAGCCCCAGCTACTGGG + Intronic
972673890 4:41240733-41240755 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
972717929 4:41666979-41667001 CGCCTTTAGTCCCAGCTACTTGG + Intronic
972884028 4:43463309-43463331 CGCCTGAAGCCCCAACTACTCGG - Intergenic
973220809 4:47723868-47723890 CGCCTGTAGTCCCACCTACTAGG + Intronic
973239976 4:47946907-47946929 CGCCTTTAGTCCCAGCTACTTGG - Intronic
974259740 4:59510519-59510541 CGCCTGTAGTCCCACCTACTAGG - Intergenic
974375809 4:61074439-61074461 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
974524741 4:63035247-63035269 CGCCTGTAGTCCCACCTACTCGG - Intergenic
975298039 4:72756570-72756592 CGCCTGTAGTCCCACCTACTCGG + Intergenic
975438465 4:74381857-74381879 CGCCTGAAGTCCCAGCTACTCGG + Intronic
975808082 4:78134082-78134104 CGCCTGAAGTCCCAGCTACTCGG - Intronic
976180702 4:82396105-82396127 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
976186042 4:82443600-82443622 CGCCTGAAGTCCCAGCTACTCGG + Intronic
976210696 4:82666388-82666410 CGCCTGTAGTCCCACCTACTCGG + Intronic
976232428 4:82858416-82858438 CACCTGTAGCCCCACCTACTCGG + Intronic
976403526 4:84635880-84635902 CACCTGAAGCCCCAGCTACTCGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977197023 4:94076251-94076273 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
977230007 4:94440601-94440623 CGCCTGTAGCCCCAACTACTCGG + Intergenic
977365739 4:96066245-96066267 CGCCTGTAGCCCCAGCTATTTGG - Intergenic
977688303 4:99874556-99874578 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
977842769 4:101729008-101729030 CGCCTGTAGTCCCACCTACTCGG + Intronic
978242190 4:106529230-106529252 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
978316591 4:107444726-107444748 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
978371826 4:108036770-108036792 CGCCTGTAGTCCCACCTATTCGG - Intergenic
978383473 4:108155584-108155606 TGCCTTGGGCCCCACCTGGTGGG - Intronic
978573971 4:110169928-110169950 CGCCTTTAGTCCCAGCTACTTGG - Intronic
978817189 4:112921150-112921172 CGCCTGTAGCCCCAGCTACTTGG - Intronic
979009304 4:115346440-115346462 CGCCTGTAGTCCCACCTACTCGG - Intergenic
979018598 4:115466599-115466621 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
979221212 4:118227735-118227757 CGCCTGTAGCCCCAGCTACTCGG - Intronic
979682813 4:123480361-123480383 CGCCTTTAGTCCCAACTACTTGG - Intergenic
979694384 4:123596095-123596117 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
979807674 4:124994937-124994959 CGCCTGTAGTCCCACCTACTGGG - Intergenic
979988689 4:127347608-127347630 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
980468648 4:133220582-133220604 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
981059287 4:140404217-140404239 CGCCTGTAGCCCCAGCTACTCGG - Intronic
981934329 4:150222738-150222760 CGCCTGAAGTCCCAGCTACTCGG + Intronic
981991996 4:150932788-150932810 CACCTTTAGCCCCATCTACTTGG + Intronic
982241492 4:153304237-153304259 CGCCTGTAGCCCCAGCTACTTGG - Intronic
982596473 4:157391719-157391741 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
982708776 4:158738705-158738727 CGCCTGTAGCCCCAGCTATTCGG - Intergenic
982711648 4:158763928-158763950 CGCCTTTAGTCCCAGCTACTAGG - Intergenic
982933366 4:161437439-161437461 CGCCTTTAGTCCCAGCTACTCGG + Intronic
983571337 4:169211354-169211376 CGCCTGTAGCCCCAGCTACTTGG + Intronic
983880843 4:172930788-172930810 CGCCTTCAGTCCCAGCTACTTGG - Intronic
983964727 4:173795987-173796009 CGCCTATAGCCCCAGCTACTTGG - Intergenic
984020959 4:174484445-174484467 CGCCTGTAGTCCCACCTACTCGG + Intergenic
984250034 4:177320601-177320623 CGCCTGTAGCCCCAGCTACTCGG - Intronic
984362051 4:178746343-178746365 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
984500698 4:180555021-180555043 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
984524994 4:180848248-180848270 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
984791410 4:183618182-183618204 CGCCTGTAGTCCCACCTACTCGG + Intergenic
985222032 4:187716811-187716833 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
985259970 4:188106173-188106195 CGCCTGAAGTCCCAGCTACTCGG - Intronic
985264997 4:188149037-188149059 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
985659325 5:1148330-1148352 CGCCTGTAGTCCCAGCTAGTAGG - Intergenic
985810418 5:2079353-2079375 CGCCTGTAGTCCCAACTAGTTGG + Intergenic
986424044 5:7612888-7612910 CGCCTGTAGCCCCAGCTACTTGG + Intronic
986718897 5:10545166-10545188 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
986720995 5:10561850-10561872 CGCCTGTAGCCCCAGCTACTGGG - Intergenic
986925591 5:12744796-12744818 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
987305109 5:16630147-16630169 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
987328049 5:16830108-16830130 CGCCTTTAGTCCCAGCTACTTGG + Intronic
987526325 5:19054640-19054662 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
987576133 5:19731323-19731345 CGCCTGTAGCCCCAGCTACTCGG + Intronic
988154410 5:27431489-27431511 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
988455139 5:31380943-31380965 CGCCTGTAGTCCCACCTACTGGG + Intergenic
988512743 5:31879259-31879281 CGCCTGTAGTCCCACCTACTTGG + Intronic
988746174 5:34141242-34141264 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
988856371 5:35231502-35231524 CGCCTGTAGTCCCACCTACTCGG - Intergenic
988944568 5:36183390-36183412 CGCCTGTAGTCCCAGCTAGTCGG - Exonic
989220631 5:38958109-38958131 CGCCTTTAGTCCCAGCTACTTGG + Intronic
989247687 5:39272544-39272566 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
989277056 5:39601561-39601583 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
989986336 5:50703173-50703195 CACCTTAAGTCCCAGCTACTTGG + Intronic
990480884 5:56209590-56209612 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
991031768 5:62088983-62089005 TGCCTTTAGTCCCACCTACTCGG + Intergenic
991082701 5:62618783-62618805 CGCCTGTAGTCCCACCTAGTCGG + Intronic
991082816 5:62619725-62619747 CGCCTGTAGTCCCACCTAGTCGG + Intronic
991337416 5:65564452-65564474 CGCCTGTAGCCCCAGCTACTCGG - Intronic
991358976 5:65800547-65800569 CGCCTGTAGCCCCAGCTACTCGG + Intronic
991403654 5:66279878-66279900 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
991456217 5:66807368-66807390 CGCCTTTAGTCCCAGCTACTCGG + Intronic
991584261 5:68186406-68186428 CGCCTGTAGTCCCACCTACTCGG + Intergenic
991657554 5:68919150-68919172 CGCCTGTAGTCCCACCTACTTGG + Intergenic
991682245 5:69150988-69151010 CGCCTATAGTCCCACCTACTTGG + Intergenic
991714742 5:69440956-69440978 CGCCTGTAGCCCCAGCTACTTGG + Intronic
991939037 5:71832287-71832309 CGCCTATAGTCCCACCTACTCGG + Intergenic
992251370 5:74879210-74879232 CGCCTGTAGCCCCAGCTACTAGG - Intergenic
992318216 5:75581803-75581825 CGCCTGTAGTCCCACCTACTTGG - Intronic
992647015 5:78820433-78820455 CGCCTATAGTCCCACCTACTCGG + Intronic
992709438 5:79435703-79435725 CGCCTGTAGTCCCACCTACTCGG + Intronic
992886923 5:81168434-81168456 CGCCTGTAGCCCCAGCTACTTGG - Intronic
993468186 5:88273032-88273054 CCCCTGTAGCCCCACCTACTTGG + Intergenic
993518392 5:88866019-88866041 CGCCTGTAGCCCCAGCTACTCGG - Intronic
993627868 5:90247600-90247622 CGCCTTCAGTCCCAGCTACTAGG + Intergenic
993716209 5:91278104-91278126 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
993936060 5:94004454-94004476 CGCCTGAAGTCCCAGCTACTCGG + Intronic
993942519 5:94077245-94077267 CGCCTGTAGTCCCACCTACTCGG + Intronic
993975305 5:94472616-94472638 CGCCTTTAGTCCCAGCTACTCGG + Intronic
994106118 5:95951241-95951263 CGCCTGTAGCCCCAGCTACTTGG + Intronic
994112012 5:96016960-96016982 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
994498471 5:100543241-100543263 CGCCTGTAGTCCCACCTACTTGG - Intronic
994672909 5:102784017-102784039 CGCCTTTAGTCCCAGCTACTTGG - Intronic
995004723 5:107178399-107178421 CGCCTTTAGTCCCAGCTATTCGG + Intergenic
995167899 5:109068307-109068329 CGCCTATAGCCCCAGCTACTCGG - Intronic
995192918 5:109338512-109338534 CGCCTTTAGTCCCAGCTACTCGG + Intronic
995216783 5:109604578-109604600 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
995250122 5:109983592-109983614 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
995378216 5:111502341-111502363 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
995615049 5:113952424-113952446 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
995866993 5:116702000-116702022 CGCCTGAAGTCCCAGCTATTCGG + Intergenic
995909953 5:117174982-117175004 CGCCTGTAGTCCCACCTACTTGG + Intergenic
996299728 5:121966903-121966925 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
996705391 5:126492593-126492615 CGCCTGAAGTCCCAGCTACTTGG + Intronic
997316438 5:132940373-132940395 CGCCTGAAGTCCCAGCTACTCGG + Intronic
997325084 5:133013594-133013616 CGCCTGTAGTCCCACCTACTTGG + Intronic
997326297 5:133024775-133024797 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
997344591 5:133178290-133178312 CGCCTGTAGTCCCACCTACTCGG - Intergenic
997458188 5:134033281-134033303 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
997464112 5:134075707-134075729 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
997466952 5:134094569-134094591 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
997673066 5:135692190-135692212 CGCCTGTAGTCCCACCTACTTGG + Intergenic
997832417 5:137162261-137162283 TGCCTGTAGCCCCAGCTAGTCGG - Intronic
998272500 5:140719305-140719327 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
998963447 5:147511978-147512000 CGCCTGTAGTCCCACCTACTTGG + Intergenic
999218984 5:149959709-149959731 CTCCTTCACCCCCATCTAGTGGG + Intergenic
999758368 5:154682295-154682317 CGCCTGAAGTCCCAGCTACTTGG - Intergenic
999792243 5:154952006-154952028 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
999871202 5:155753209-155753231 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1000018144 5:157296466-157296488 TGCCTGAAGTCCCACCTACTTGG + Intronic
1000308625 5:160019708-160019730 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1000313859 5:160070345-160070367 TGCTTTCAGCCCCAGCTAGTTGG + Intronic
1000323921 5:160157602-160157624 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1000350748 5:160350574-160350596 TGCCTTTAGCCCCATCTACTTGG + Intronic
1000711959 5:164591483-164591505 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1000726093 5:164772794-164772816 CGCCTGTAGCCCCAGCTAGTTGG + Intergenic
1000935218 5:167298475-167298497 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1001587436 5:172843016-172843038 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1001891802 5:175345559-175345581 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1002022913 5:176376234-176376256 CGCCTGTAGTCCCACCTACTAGG + Exonic
1002057195 5:176605217-176605239 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1002428467 5:179189471-179189493 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1002483809 5:179521056-179521078 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1002511920 5:179725860-179725882 CGCCTGTAGTCCCACCTATTCGG + Intronic
1002519177 5:179781552-179781574 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1002567787 5:180121437-180121459 CGCCTGTAGTCCCACCTACTCGG - Intronic
1002632107 5:180589142-180589164 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1003091439 6:3107124-3107146 TGCCTTTAGCCCCAGCTACTAGG + Intronic
1003317940 6:5028311-5028333 CGCCTATAGTCCCAGCTAGTCGG + Intergenic
1003371283 6:5529431-5529453 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1003659563 6:8047331-8047353 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1003836521 6:10077452-10077474 CGCCTGTAGTCCCACCTACTCGG - Intronic
1003899555 6:10641445-10641467 CACCTGTAGCCCCAGCTAGTTGG - Intergenic
1004155426 6:13163117-13163139 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1004608401 6:17215257-17215279 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1004719131 6:18250341-18250363 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1004882200 6:20020244-20020266 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1004941099 6:20556910-20556932 CGCCTGTAGTCCCACCTACTCGG + Intronic
1005003940 6:21269660-21269682 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1005047729 6:21658160-21658182 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1005251266 6:23948953-23948975 CGCCTTTAGTCCCAGCTTGTCGG + Intergenic
1005251313 6:23949316-23949338 CGCCTTTAGTCCCAGCTTGTCGG + Intergenic
1005296756 6:24434710-24434732 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1005544324 6:26849475-26849497 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1005627245 6:27674512-27674534 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1006322352 6:33327294-33327316 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1006663672 6:35672802-35672824 CGCCTGTAGCCCAAGCTAGTCGG + Intronic
1006698936 6:35956135-35956157 AGCCTGTAGCCCCACCTACTGGG + Intronic
1006782349 6:36640567-36640589 CGCCTGTAGTCCCACCTATTCGG - Intergenic
1006886620 6:37387464-37387486 CGCCTGTAGCCCCAGCTACTAGG - Intronic
1006890603 6:37424366-37424388 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1007435614 6:41808533-41808555 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1007566883 6:42858388-42858410 CGCCTTCAGTCCCAGCTACTTGG + Intronic
1008179456 6:48310357-48310379 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1008338204 6:50332276-50332298 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1008668634 6:53743595-53743617 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1009422700 6:63481466-63481488 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1009593104 6:65699987-65700009 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1010207310 6:73334533-73334555 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1010222680 6:73461407-73461429 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1011040219 6:83021741-83021763 CGCCTGTAGTCCCACCTACTCGG + Intronic
1011272352 6:85592886-85592908 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1011362788 6:86546389-86546411 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1011418671 6:87150244-87150266 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1011477148 6:87759250-87759272 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1011688100 6:89840235-89840257 CGCCTTTAGTCCCACCTACTCGG + Intronic
1012096428 6:94968357-94968379 CGCCTTTAGACCCAGCTACTCGG + Intergenic
1012098066 6:94991711-94991733 CGCCTTTAGACCCAGCTACTCGG + Intergenic
1012447129 6:99318131-99318153 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1012475871 6:99614150-99614172 CGCCCTAAGCCCCGCCGAGCTGG + Exonic
1012780479 6:103550781-103550803 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1013362584 6:109407917-109407939 CACCTTTAGTCCCACCTACTTGG - Intronic
1013383155 6:109597545-109597567 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1013456765 6:110336612-110336634 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1013554413 6:111241596-111241618 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1013750454 6:113399861-113399883 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1014027048 6:116661002-116661024 TGCCTTTAGCCCCATCTACTTGG - Intronic
1014200999 6:118608367-118608389 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1015771396 6:136772032-136772054 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1015997212 6:139007325-139007347 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1016048317 6:139503756-139503778 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1016352718 6:143185068-143185090 CGCCTGTAGTCCCACCTACTTGG + Intronic
1016543727 6:145196568-145196590 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1016888509 6:148982222-148982244 CGCCTGTAGCCCCACCTACTTGG - Intronic
1017361187 6:153573840-153573862 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1017413551 6:154195271-154195293 CGCCTGTAGTCCCACCTACTCGG - Intronic
1017803955 6:157926654-157926676 CGCCTAAAGTCCCAGCTACTTGG + Intronic
1017806831 6:157953481-157953503 TGCCTGTAGCCCCACCTACTTGG - Intergenic
1017893397 6:158658016-158658038 CGCCTGTAGTCCCACCTACTTGG - Intronic
1018150447 6:160932295-160932317 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1018154169 6:160970100-160970122 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1018324089 6:162645998-162646020 CGCCTGAAGTCCCAGCTACTGGG - Intronic
1018674863 6:166210590-166210612 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1018675662 6:166220302-166220324 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1019104686 6:169658807-169658829 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1019371600 7:664786-664808 CGCCTGTGGCCCCAGCTAGTCGG + Intronic
1019744560 7:2692414-2692436 CGCCTTTAGTCCCAGCTATTCGG + Intronic
1020095044 7:5363476-5363498 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1020134889 7:5581663-5581685 TGCCTGTAGTCCCACCTAGTCGG + Intergenic
1020167401 7:5818655-5818677 CGCCTATAGCCCCAGCTACTCGG - Intergenic
1020183578 7:5941616-5941638 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1020249577 7:6456676-6456698 CGCCTGTAGTCCCACCTACTCGG - Intronic
1020258155 7:6514125-6514147 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1020299335 7:6783154-6783176 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1021041803 7:15872013-15872035 CGCCTGTAGTCCCAGCTAGTAGG + Intergenic
1021078216 7:16331123-16331145 CGCCTGTAGTCCCACCTACTCGG - Intronic
1021231610 7:18092262-18092284 TGCCTGAAGTCCCAGCTAGTTGG + Intronic
1021352879 7:19617005-19617027 TGCCTGTAGCCCCAGCTAGTCGG - Intergenic
1021690266 7:23224119-23224141 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1021768652 7:23975632-23975654 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1022190133 7:28009607-28009629 CGCCTGTAGTCCCACCTACTCGG - Intronic
1022565450 7:31395515-31395537 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1022679308 7:32528882-32528904 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1023201271 7:37699433-37699455 CGCCTGTAGTCCCACCTACTCGG + Intronic
1023219446 7:37903934-37903956 CGCCTGTAGTCCCACCTACTTGG - Intronic
1023239191 7:38124297-38124319 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1023421946 7:39989906-39989928 CGCCTGTAGTCCCACCTACTCGG - Intronic
1023425256 7:40029300-40029322 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1023434364 7:40126930-40126952 CGCCTGTAGTCCCAGCTAGTCGG - Exonic
1023624254 7:42100614-42100636 CGCCTGTAGTCCCACCTACTTGG + Intronic
1023956194 7:44888702-44888724 CGCCTGCAGTCCCACCTACTCGG - Intergenic
1023999744 7:45182586-45182608 CTCCTTCAGCCCCATCTAGCAGG - Intronic
1025172551 7:56772845-56772867 CGCCTCTAGCCCCAGCTACTTGG + Intergenic
1025990873 7:66495780-66495802 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1026059129 7:67010599-67010621 CGCCTGTAGTCCCACCTACTCGG - Intronic
1026251343 7:68673686-68673708 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1026301082 7:69098618-69098640 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1026355758 7:69555790-69555812 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1026559429 7:71435892-71435914 CGCCTGTAGTCCCACCTACTCGG + Intronic
1026606819 7:71823590-71823612 CGCCTGTAGTCCCACCTACTTGG + Intronic
1026701676 7:72652250-72652272 CGCCTGAAGTCCCAGCTACTTGG + Intronic
1026819255 7:73535843-73535865 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1026972157 7:74475127-74475149 CACCTTAAGTCCCAGCTACTTGG + Intronic
1027193669 7:76013198-76013220 CGCCTGTAGTCCCACCTACTTGG + Intronic
1027222262 7:76221486-76221508 CGCCTGTAGTCCCAGCTAGTAGG - Intronic
1027256206 7:76432312-76432334 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1027343512 7:77234607-77234629 CGCCTGTAGTCCCACCTAATTGG + Intronic
1027461426 7:78458758-78458780 CGCCTGTAGTCCCACCTACTCGG - Intronic
1028126593 7:87120099-87120121 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1028537143 7:91902281-91902303 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1028597411 7:92560102-92560124 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1028818968 7:95183574-95183596 CGCCTATAGTCCCACCTACTCGG - Intronic
1029034812 7:97508216-97508238 CGCCTGTAGACCCAGCTAGTCGG + Intergenic
1029087169 7:98020827-98020849 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1029120228 7:98262878-98262900 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1029153615 7:98499295-98499317 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1029255581 7:99267352-99267374 TGCCTTAAGTCCCAGCTACTTGG - Intergenic
1029427421 7:100504876-100504898 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1029433941 7:100551193-100551215 CGCCTGTAGTCCCACCTACTCGG - Intronic
1029556008 7:101269673-101269695 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1029681245 7:102112365-102112387 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1029689565 7:102172215-102172237 CGCCTGCAGCTCCAGCTAGTTGG - Intronic
1029732763 7:102448583-102448605 CGCCTGTAGCCCCAGCTACTTGG + Exonic
1029739019 7:102481537-102481559 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1029757020 7:102580714-102580736 CGCCTTTAGTCCCAGCTACTCGG + Exonic
1029774959 7:102679776-102679798 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1030040119 7:105441963-105441985 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1030193988 7:106835379-106835401 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1030372145 7:108712567-108712589 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1030459679 7:109817262-109817284 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1031123133 7:117743634-117743656 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1031132255 7:117845974-117845996 CGCCTGTAGTCCCACCTACTCGG - Intronic
1031532993 7:122899130-122899152 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1031839326 7:126718109-126718131 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1031906590 7:127466636-127466658 CGCCTGCAGCCCCAGCTACTCGG - Intergenic
1032140262 7:129322715-129322737 CGCCTATAGCCCCAGCTACTCGG - Intronic
1032635137 7:133698454-133698476 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1032762560 7:134957543-134957565 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1032912744 7:136452304-136452326 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1032932596 7:136690577-136690599 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1033147926 7:138887025-138887047 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1033594699 7:142849862-142849884 CGCCTATAGTCCCAGCTAGTCGG + Intergenic
1034397937 7:150841616-150841638 CGCCTGTAGTCCCACCTACTTGG - Intronic
1035983391 8:4398517-4398539 CGCCTGTAGTCCCACCTACTCGG - Intronic
1035997645 8:4566525-4566547 CGCCTGCAGTCCCACCTACTCGG + Intronic
1036003704 8:4637794-4637816 CGCCTGTAGTCCCACCTACTCGG - Intronic
1036079355 8:5537282-5537304 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1036134071 8:6142794-6142816 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1036162664 8:6404366-6404388 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1036484257 8:9165300-9165322 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1036525997 8:9535358-9535380 CGCCTGTAGTCCCACCTAATGGG + Intergenic
1036582916 8:10092530-10092552 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1036609740 8:10339665-10339687 CACCTGTAGCCCCACCTAGTCGG - Intronic
1036616385 8:10390848-10390870 CGCCTGTAGTCCCACCTACTCGG + Intronic
1036835599 8:12062769-12062791 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1036955625 8:13185431-13185453 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1037014542 8:13886271-13886293 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1037120485 8:15280011-15280033 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1037151545 8:15641233-15641255 CGCCTGTAGTCCCACCTACTCGG + Intronic
1037187968 8:16087784-16087806 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1037296592 8:17408261-17408283 CGCCTGTAGTCCCACCTACTTGG + Intronic
1037341665 8:17852197-17852219 CGCCTGTAGCCCCATCTACTTGG + Intergenic
1037750299 8:21677494-21677516 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1037851593 8:22334394-22334416 CGCCTATAGCCCCAGCTACTCGG + Intronic
1038014611 8:23503510-23503532 CGCCTGTAGTCCCACCTAGTTGG - Intergenic
1038093082 8:24276355-24276377 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1038147078 8:24907570-24907592 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1038166998 8:25095093-25095115 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1038549285 8:28451856-28451878 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1039018103 8:33175359-33175381 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1039023736 8:33235166-33235188 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1039087571 8:33795127-33795149 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1039897923 8:41729514-41729536 CGCCTTAGTCCCCACCTACTTGG - Intronic
1040414485 8:47184083-47184105 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1040488832 8:47900721-47900743 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1041060338 8:54029065-54029087 CGCCTGTAGTCCCAGCTAGTTGG + Intergenic
1041134376 8:54740908-54740930 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1041606327 8:59786266-59786288 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1042156438 8:65849359-65849381 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1042312884 8:67396265-67396287 CGCCTGTAGTCCCACCTACTGGG - Intergenic
1043805002 8:84661052-84661074 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1044346154 8:91106916-91106938 CGCCTGTAGCCCCAACTACTTGG - Intronic
1044456867 8:92399801-92399823 TGCCCAAAGCCCCACCTAGGGGG - Intergenic
1044669978 8:94669742-94669764 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1044672867 8:94700801-94700823 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1044690268 8:94870175-94870197 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1044930762 8:97249448-97249470 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1044983491 8:97738204-97738226 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1045162893 8:99568935-99568957 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1045279365 8:100736320-100736342 TGCCTTTAGTCCCACCTACTTGG + Intergenic
1046169832 8:110490774-110490796 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1046224157 8:111255218-111255240 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1046485821 8:114886552-114886574 CGCCTGTAGCCCCAGCTACTAGG + Intergenic
1046746374 8:117880714-117880736 CGCCTGTAGTCCCACCTACTCGG - Intronic
1046834899 8:118789422-118789444 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1047257188 8:123223480-123223502 CGCCTGTAGTCCCACCTACTTGG + Intronic
1047259394 8:123242093-123242115 CGCCTGTAGCCCCAGCTACTTGG - Intronic
1047507180 8:125489131-125489153 CGCCTGTAGCCCCAGCTAATTGG + Intergenic
1048250295 8:132860702-132860724 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1048351952 8:133623646-133623668 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1048929539 8:139301410-139301432 CGCCTGTAGCCCCAGCTACTGGG + Intergenic
1049722680 8:144126923-144126945 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1049811516 8:144576205-144576227 CGCCTGAAGTCCCAGCTACTCGG + Intronic
1049923824 9:389897-389919 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1049971514 9:826079-826101 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1050209223 9:3234513-3234535 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1050438258 9:5631559-5631581 CGCCTATAGCCCCAGCTACTCGG + Intronic
1050678914 9:8087196-8087218 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1050765788 9:9132131-9132153 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1050814042 9:9787009-9787031 CGCCTGAAGTCCCAACTACTTGG + Intronic
1050950909 9:11591459-11591481 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1051016722 9:12485765-12485787 CGCCTGTAACCCCACCTACTAGG + Intergenic
1051347727 9:16167785-16167807 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1051420895 9:16888222-16888244 CGCCTGCAGCCCCAGCTACTCGG + Intergenic
1051442061 9:17095945-17095967 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1051444720 9:17128060-17128082 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1051526537 9:18051173-18051195 CGCCTGTAGCCCCAGCTACTTGG + Intergenic
1051594178 9:18807517-18807539 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1051625416 9:19094664-19094686 CGCCTATAGCCCCAGCTACTCGG + Intronic
1051917851 9:22229564-22229586 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1052019625 9:23510459-23510481 CGCCTTTAGTCCCAGCTACTCGG - Intergenic
1052179554 9:25507100-25507122 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1052299933 9:26942754-26942776 CGCCTAAAGTCCCAGCTACTCGG + Intronic
1052756651 9:32549179-32549201 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1052904931 9:33825364-33825386 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1052939402 9:34120543-34120565 CGCCTGTAGTCCCAGCTAGTCGG + Intronic
1052943258 9:34147049-34147071 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1053106373 9:35412383-35412405 TGCCTTTAGCCCCAGCTAGTTGG - Intergenic
1053250244 9:36568176-36568198 CGCCTTTAGTCCCACCTACTTGG + Intergenic
1053358945 9:37469230-37469252 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1053549979 9:39067521-39067543 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1053573922 9:39338670-39338692 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1053719664 9:40932725-40932747 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1053814091 9:41887614-41887636 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1053924414 9:43037993-43038015 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1054095488 9:60897358-60897380 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1054116412 9:61167415-61167437 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1054591346 9:67015131-67015153 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1054616505 9:67299826-67299848 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1054791569 9:69261439-69261461 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1054797501 9:69316358-69316380 TGCCTTTAGCCCCACCTACTTGG + Intergenic
1055045835 9:71923002-71923024 CGCCTGTAACCCCACCTACTCGG + Intronic
1055238751 9:74158232-74158254 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1055467143 9:76577119-76577141 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1055501665 9:76907501-76907523 CCCATTAAGCCACACCTATTAGG - Intergenic
1056242164 9:84658670-84658692 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1056634078 9:88317329-88317351 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1056768939 9:89463069-89463091 CTCCTTAAGCCAAACCTAGAAGG + Intronic
1056964943 9:91157710-91157732 CGCCTGAAGTCCCAGCTACTTGG + Intergenic
1057021519 9:91701551-91701573 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1057064846 9:92039019-92039041 CGCCTGTAGTCCCAGCTAGTTGG + Intronic
1057088455 9:92233885-92233907 CGCCTTTAGTCCCAGCTACTTGG - Intronic
1057117217 9:92536993-92537015 CGCCTTTAAGCCCACCTACTCGG - Intronic
1057137463 9:92703174-92703196 CGCCTTTAGTCCCAGCTACTGGG + Intergenic
1057188642 9:93073370-93073392 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1057357780 9:94345978-94346000 CGCCTGTAGTCCCAGCTAGTGGG + Intergenic
1057413359 9:94839034-94839056 CGCCTGTAGTCCCACCTACTCGG - Intronic
1057413387 9:94839209-94839231 CGCCTGTAGTCCCACCTACTCGG - Intronic
1057424734 9:94939120-94939142 CGCCTGTAGTCCCACCTACTTGG + Intronic
1057519238 9:95748180-95748202 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1057766594 9:97925210-97925232 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1057954206 9:99394774-99394796 CGCCTATAGCCCCAGCTATTTGG + Intergenic
1058044990 9:100348783-100348805 CGCCTGCAGCCCCAGCTACTTGG + Intronic
1058451762 9:105103559-105103581 CGCCTGTAGTCCCAGCTAGTTGG - Intergenic
1058866930 9:109169298-109169320 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1059021698 9:110582767-110582789 TGCCTGAAGTCCCAGCTAGTCGG + Intergenic
1059130309 9:111741013-111741035 CACCTTTAGTCCCAGCTAGTCGG - Intronic
1059197232 9:112381477-112381499 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1059201973 9:112426359-112426381 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1059577807 9:115509774-115509796 CGCCTGTAGTCCCAGCTAGTCGG - Intergenic
1060446553 9:123693951-123693973 CGCCTGAAGTCCCAGCTACTCGG - Intronic
1060954993 9:127632398-127632420 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1061066425 9:128280641-128280663 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1061068646 9:128295070-128295092 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1061109990 9:128562226-128562248 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1061199429 9:129128408-129128430 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1061308631 9:129747882-129747904 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1061335550 9:129932083-129932105 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1061441179 9:130604770-130604792 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1061511648 9:131064963-131064985 CACCGCAAGCCCCACCTACTGGG - Intronic
1062322162 9:135995564-135995586 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1062700165 9:137896111-137896133 CGCCTGTAGTCCCACCTACTCGG + Intronic
1203363727 Un_KI270442v1:239325-239347 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1185557559 X:1033339-1033361 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1185651031 X:1648229-1648251 CGCCTGTAGCCCCAGCTACTAGG + Intergenic
1185662954 X:1741559-1741581 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1185791867 X:2933234-2933256 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1185955750 X:4487283-4487305 CTCCTTTAGCCCCAGCTACTCGG - Intergenic
1186138758 X:6548647-6548669 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1186206232 X:7203908-7203930 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1186269880 X:7875500-7875522 CGCCTTTAGTCCCAGCTACTTGG - Intergenic
1186360072 X:8831647-8831669 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1186422827 X:9439881-9439903 CGCCTTTAGTCCCAGCTACTTGG + Intergenic
1186831291 X:13393004-13393026 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1186835833 X:13436805-13436827 CACCTGAAGCACCACCTAGGAGG - Intergenic
1187147752 X:16653482-16653504 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1187283382 X:17880149-17880171 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1187379048 X:18783590-18783612 CGCCTTTAGTCCCAGCTACTTGG + Intronic
1187967557 X:24627457-24627479 CGCCTGTAGTCCCAGCTAGTTGG - Intronic
1188669285 X:32863389-32863411 CGCCTGAAGTCCCAGCTACTTGG + Intronic
1189288795 X:39870755-39870777 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic
1189354765 X:40302174-40302196 CGCCTGTAGTCCCACCTACTCGG + Intergenic
1189411099 X:40772159-40772181 CGCCTGAAGTCCCAGCTACTCGG + Intergenic
1190016750 X:46834244-46834266 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1190016851 X:46835066-46835088 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1190027048 X:46934259-46934281 CGCCTGTAGTCCCACCTACTCGG - Intronic
1190095032 X:47472562-47472584 CGCCTGTAGTCCCACCTACTTGG - Intronic
1190283268 X:48945394-48945416 CGCCTGTAGTCCCAGCTAGTCGG - Intronic
1190406795 X:50096442-50096464 CGCCTGTAGTCCCACCTACTTGG - Exonic
1190471806 X:50788479-50788501 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1190514102 X:51205447-51205469 CGCCTGTAGCCCCAACTACTCGG + Intergenic
1190703077 X:53002604-53002626 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1190705386 X:53022855-53022877 CGCCTGTAGCCCCAGCTACTTGG - Intergenic
1190792164 X:53710633-53710655 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1190793804 X:53723068-53723090 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1190847949 X:54211676-54211698 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1190865395 X:54380361-54380383 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1192575153 X:72237828-72237850 CACCTTAAGTCCCAGCTACTAGG + Intronic
1192581520 X:72286574-72286596 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1192673525 X:73170604-73170626 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1193166364 X:78285293-78285315 CGCCTTTAGTCCCAGCTACTCGG + Intronic
1193627242 X:83836785-83836807 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1194518784 X:94892563-94892585 CGCCTGTAGCCCCAACTACTGGG + Intergenic
1195400166 X:104452949-104452971 CACCTGTAGTCCCACCTAGTTGG + Intergenic
1195755531 X:108195395-108195417 CGCCTATAGCCCCAGCTACTTGG - Intronic
1195789434 X:108566672-108566694 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1195928807 X:110052874-110052896 TGCCTGTAGCCCCACCTACTCGG - Intronic
1195935918 X:110125619-110125641 GGCCTAAAGCCCCACCTTGTGGG + Intronic
1196102369 X:111860032-111860054 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1196276276 X:113768892-113768914 AGCCTTAATCCCCATCCAGTGGG - Intergenic
1196430605 X:115620817-115620839 CGCCTATAGTCCCACCTACTCGG - Intronic
1196671196 X:118369592-118369614 CGCCTGTAGCCCCAGCTACTCGG - Intronic
1196688444 X:118532653-118532675 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1196719074 X:118837092-118837114 CGCCTAAAGTCCCAGCTACTTGG - Intergenic
1196747124 X:119081139-119081161 CGCCTGTAGTCCCAGCTAGTCGG + Exonic
1196782607 X:119397199-119397221 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1196911502 X:120488682-120488704 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1197211741 X:123833817-123833839 CGCCTGAAGTCCCAGCTACTCGG - Intergenic
1197236803 X:124075397-124075419 CGCCTATACTCCCACCTAGTTGG - Intronic
1197407419 X:126069255-126069277 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1197479341 X:126963163-126963185 CGCCTGTAGTCCCACCTACTCGG - Intergenic
1197701809 X:129605393-129605415 CGCCTATAGTCCCAGCTAGTTGG + Intergenic
1197763441 X:130043698-130043720 CGCCTGTAGTCCCAGCTAGTGGG - Intronic
1197936504 X:131745581-131745603 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1198027674 X:132724012-132724034 CGCCTGTAGCCCCAGCTACTTGG + Intronic
1198071762 X:133155559-133155581 CGCCTGTAGTCCCACCTACTTGG - Intergenic
1198143020 X:133824979-133825001 CGCCTGAAGTCCCAGCTACTTGG - Intronic
1198219301 X:134585218-134585240 CGCCTGTAGCCCCAGCTACTCGG + Intronic
1198825072 X:140690929-140690951 CGCCTGTAGCCCCAGCTACTCGG + Intergenic
1199225199 X:145364854-145364876 CGCCTGTAGCCCCAGCTACTCGG - Intergenic
1199935781 X:152572153-152572175 CGCCTGTAGTCCCACCTATTTGG + Intergenic
1200209098 X:154338025-154338047 CGCCTTTAGTCCCAGCTACTCGG + Intergenic
1200221777 X:154394104-154394126 CGCCTTTAGTCCCAGCTACTCGG - Intronic
1200520819 Y:4208088-4208110 CGCCTGTAGTCCCACCTACTTGG + Intergenic
1201230106 Y:11856112-11856134 CGCCTGTAGTCCCAGCTAGTCGG + Intergenic