ID: 1136072762

View in Genome Browser
Species Human (GRCh38)
Location 16:27798270-27798292
Sequence CGAACGTGTTCCCCTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136072761_1136072762 -1 Left 1136072761 16:27798248-27798270 CCAGGAGAGTGAAAGGCAGAGAC 0: 1
1: 0
2: 4
3: 33
4: 392
Right 1136072762 16:27798270-27798292 CGAACGTGTTCCCCTCTGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136072762 Original CRISPR CGAACGTGTTCCCCTCTGCC AGG Intronic
901396953 1:8988599-8988621 CAATCGTGGTCCCCTCTGCACGG - Intergenic
904196549 1:28789994-28790016 CTACCGTGTTCCCCAGTGCCTGG + Intergenic
914511627 1:148337483-148337505 CCAACGTGTCCCTCTTTGCCAGG + Intergenic
917231381 1:172841544-172841566 CTCACTTGCTCCCCTCTGCCTGG - Intergenic
918630848 1:186716444-186716466 CAAACGTTTTCTCCTCTGCTGGG + Intergenic
918753709 1:188308078-188308100 CGAACCTGTTCTGCTCTCCCCGG + Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1075353065 10:121743661-121743683 CTGACCTGTTCACCTCTGCCGGG - Exonic
1080788575 11:35499015-35499037 CAAACCTGTTCACCACTGCCAGG + Intronic
1087078741 11:94150173-94150195 CTTACATGATCCCCTCTGCCCGG - Intronic
1087203934 11:95374344-95374366 CTAACGTGTTCCTCACTGACTGG + Intergenic
1089397553 11:118145918-118145940 CCGCCGTGTTCCCCCCTGCCAGG - Intronic
1090118265 11:123997700-123997722 CGAAGGCATTTCCCTCTGCCTGG + Intergenic
1104398746 12:128458527-128458549 GGAACATGGTCCCCTTTGCCCGG + Intronic
1104743582 12:131196022-131196044 CCAGGGTGTTCCCCTCTGCCTGG + Intergenic
1105247866 13:18668577-18668599 AGAACCTGCTCCCGTCTGCCCGG - Intergenic
1107324483 13:39226513-39226535 CTCACATGTTCCTCTCTGCCTGG - Intergenic
1111578120 13:90185197-90185219 CGAATGTTTTCCTCTCTCCCTGG - Intergenic
1113100566 13:106713087-106713109 TGAGCGTGCACCCCTCTGCCAGG + Intergenic
1119043442 14:71296327-71296349 TGCAGGAGTTCCCCTCTGCCTGG - Intergenic
1134665817 16:16017875-16017897 TGTACTTATTCCCCTCTGCCTGG - Intronic
1136072762 16:27798270-27798292 CGAACGTGTTCCCCTCTGCCAGG + Intronic
1146124098 17:30218429-30218451 CCCACGTGTACCCCTCTGCTGGG - Intronic
1146633774 17:34489240-34489262 CTCACCTGGTCCCCTCTGCCTGG - Intergenic
1150517036 17:65824658-65824680 CACACATTTTCCCCTCTGCCTGG - Intronic
1154247761 18:12714845-12714867 CGAACGTGTGCCATTGTGCCCGG + Intronic
1154440983 18:14390557-14390579 AGAACCTGCTCCCGTCTGCCCGG + Intergenic
1157320038 18:46627308-46627330 AGAAAGTGTTCCCACCTGCCTGG - Intronic
1159784227 18:72695061-72695083 GGAACATGTTTCTCTCTGCCTGG + Intergenic
1161168880 19:2803187-2803209 CGGATGTGTTCACCACTGCCAGG + Intronic
1161531981 19:4795206-4795228 AGAACCTGCTCCCGTCTGCCTGG - Exonic
1162382388 19:10339245-10339267 CGTATGTGCTTCCCTCTGCCAGG - Intronic
1163692578 19:18745538-18745560 CGAGCTTGTGCCGCTCTGCCTGG + Intronic
1163828260 19:19535685-19535707 CCAATGTGCCCCCCTCTGCCTGG - Exonic
1166194744 19:41198400-41198422 CCAACCTGCTCCCCTCTGCCTGG + Intronic
926718512 2:15942334-15942356 CGAACGCGTCCTCCTCGGCCGGG - Exonic
931292877 2:60891719-60891741 AAAACGCATTCCCCTCTGCCTGG - Exonic
934516962 2:94994274-94994296 AGAGCGTTTTCCCCTCAGCCTGG - Intergenic
940428652 2:153560395-153560417 TGAACGTGTTTTCCTCTCCCAGG + Intergenic
1170619197 20:17980006-17980028 CAAACGTGAGCCCCTATGCCTGG + Intronic
950874212 3:16255384-16255406 CGAACTTGTCCACCTGTGCCAGG + Intergenic
954915886 3:54148452-54148474 AGAACGTGTTCCCCACTGGAAGG + Intronic
961602223 3:128071104-128071126 CCAGAGTGTGCCCCTCTGCCGGG - Exonic
964364706 3:155937419-155937441 TGAACCTATTCCCCTCTGCAGGG - Intronic
985363773 4:189204425-189204447 CAAATATGTTCCCCTCTCCCTGG + Intergenic
986746852 5:10752779-10752801 TGAAAATGTTCCCCTCTCCCAGG + Intronic
989484153 5:41968526-41968548 CCAACGTGTTGCCCCCTGCTGGG - Intergenic
989570620 5:42942960-42942982 CGAGCGTGTGCCCCCATGCCTGG - Intergenic
999726929 5:154445680-154445702 CGAATGTGTTCCTCTGTTCCTGG + Intergenic
1001572219 5:172737204-172737226 TGAAAGTGTTTCCCTCTGCTGGG + Intergenic
1004066790 6:12254264-12254286 TGAGGGTGTTTCCCTCTGCCTGG + Intergenic
1013575165 6:111476296-111476318 CAAACGTGTACCACCCTGCCTGG + Intronic
1018852809 6:167653348-167653370 CCAACTTGTGCTCCTCTGCCTGG + Intergenic
1024250815 7:47504456-47504478 CGATGGTGTTCCCCTCTGTGTGG - Intronic
1026737642 7:72959281-72959303 CAGGCGTGTGCCCCTCTGCCAGG + Intergenic
1027106091 7:75405787-75405809 CAGGCGTGTGCCCCTCTGCCAGG - Intronic
1029214132 7:98933309-98933331 AGAACGTGTTCCCCTCCATCAGG - Exonic
1049893770 9:95380-95402 AGAAGCTGTTCTCCTCTGCCTGG - Intergenic
1050296400 9:4209665-4209687 CTATCATGTTCCTCTCTGCCAGG + Intronic
1056733648 9:89186028-89186050 AGTACGTCTGCCCCTCTGCCTGG - Intergenic
1056963784 9:91149242-91149264 TGAAGGGGTCCCCCTCTGCCAGG + Intergenic
1062644182 9:137538334-137538356 CGCACCTGTGCCCATCTGCCGGG + Intronic
1197236662 X:124073562-124073584 CAAGCGTGTGCCACTCTGCCTGG + Intronic
1199392511 X:147297144-147297166 CCAACGTGTTTCCCTCTTGCAGG - Intergenic