ID: 1136074683

View in Genome Browser
Species Human (GRCh38)
Location 16:27808824-27808846
Sequence CCCGCAGAGGCTGCTCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136074683_1136074689 0 Left 1136074683 16:27808824-27808846 CCAGAGCGAGCAGCCTCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1136074689 16:27808847-27808869 GTGGCAGCAGAGGAGAAGCATGG 0: 1
1: 1
2: 3
3: 109
4: 641
1136074683_1136074690 8 Left 1136074683 16:27808824-27808846 CCAGAGCGAGCAGCCTCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1136074690 16:27808855-27808877 AGAGGAGAAGCATGGAGCAGAGG 0: 1
1: 0
2: 7
3: 92
4: 769
1136074683_1136074693 30 Left 1136074683 16:27808824-27808846 CCAGAGCGAGCAGCCTCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1136074693 16:27808877-27808899 GCTGTTGAGGACCTGGACAGTGG 0: 1
1: 0
2: 3
3: 17
4: 275
1136074683_1136074691 17 Left 1136074683 16:27808824-27808846 CCAGAGCGAGCAGCCTCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1136074691 16:27808864-27808886 GCATGGAGCAGAGGCTGTTGAGG 0: 1
1: 0
2: 12
3: 45
4: 379
1136074683_1136074688 -10 Left 1136074683 16:27808824-27808846 CCAGAGCGAGCAGCCTCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1136074688 16:27808837-27808859 CCTCTGCGGGGTGGCAGCAGAGG 0: 1
1: 0
2: 2
3: 28
4: 323
1136074683_1136074692 23 Left 1136074683 16:27808824-27808846 CCAGAGCGAGCAGCCTCTGCGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1136074692 16:27808870-27808892 AGCAGAGGCTGTTGAGGACCTGG 0: 2
1: 0
2: 5
3: 34
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136074683 Original CRISPR CCCGCAGAGGCTGCTCGCTC TGG (reversed) Intronic
900399527 1:2467339-2467361 CCAGCAGAGGCTGCTGGGCCCGG + Intronic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
901221808 1:7587720-7587742 CCTGCAGAAGCTGGGCGCTCGGG - Intronic
901766224 1:11501738-11501760 CCCGCCGAGGCGCCTCGCGCTGG + Exonic
904941769 1:34168655-34168677 CCCTCTGAGGCTTCTCTCTCTGG + Intronic
905231071 1:36515287-36515309 CCCCCAGAGCCTGCTCTCCCTGG - Intergenic
912824813 1:112895635-112895657 CCAGCAGTGGCAACTCGCTCGGG + Intergenic
913968041 1:143393043-143393065 TCCGCAGGAGCTGCTCTCTCTGG + Intergenic
914062422 1:144218633-144218655 TCCGCAGGAGCTGCTCTCTCTGG + Intergenic
914116728 1:144747721-144747743 TCCGCAGGAGCTGCTCTCTCTGG - Intergenic
915303014 1:154962109-154962131 TCCGCAGAGGGGGCTGGCTCCGG - Intronic
923503431 1:234585209-234585231 CCCGCAGAGGTTCCTGGCTGCGG - Intergenic
1063392556 10:5659782-5659804 CCCACACAGGCTGCTCGTGCAGG + Intronic
1065441468 10:25756632-25756654 CCCGCAGTGGCAACCCGCTCGGG + Intergenic
1067372702 10:45699928-45699950 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067387075 10:45826196-45826218 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067419053 10:46131055-46131077 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067504404 10:46837644-46837666 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067590182 10:47502349-47502371 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067876187 10:50009883-50009905 CCCGCAGCAGCTGCTGGCCCAGG - Exonic
1076614257 10:131745778-131745800 AAGGCAGAGGGTGCTCGCTCAGG + Intergenic
1076661284 10:132057453-132057475 CCCTCAGAGGCTGGTTGCACAGG + Intergenic
1077377211 11:2210687-2210709 CCAGCCGAGGCTGCTGGCCCTGG + Intergenic
1077486193 11:2839372-2839394 CCTGCAGAGGCTGCTCCGTGCGG - Intronic
1078010721 11:7571113-7571135 CCAGCAGAGGCTGCTCATTCAGG - Intronic
1082808087 11:57462459-57462481 GCAGCAGAGGCCTCTCGCTCTGG - Intronic
1083198943 11:61107940-61107962 GCCCCAGAGCCTGCTTGCTCTGG - Intronic
1083793294 11:64999782-64999804 CCCACTGGGGCTGCTGGCTCTGG - Intergenic
1084598468 11:70131147-70131169 GCTGCAGAGGCTGCTGCCTCAGG + Intronic
1085252808 11:75154715-75154737 CCTGCAGAGCCAGCTCCCTCAGG - Intronic
1087404802 11:97717559-97717581 CCAGCAGCGGCAGCCCGCTCAGG - Intergenic
1091688995 12:2583146-2583168 CCCGCAGCGGCGCCGCGCTCCGG + Intronic
1091836895 12:3592392-3592414 CCCACAGAGCTGGCTCGCTCAGG + Intronic
1091979866 12:4856093-4856115 CACGCAGAGGCTGGACGCCCTGG + Intergenic
1092428266 12:8390530-8390552 CGCCGAGAGGCCGCTCGCTCCGG - Intergenic
1096152940 12:49325863-49325885 CCCCCAGAGGCTACAGGCTCTGG + Exonic
1097029391 12:56080431-56080453 CCCTCCGAGGCTGCGCGCACTGG - Intronic
1098951940 12:76648627-76648649 CCCGCATGGGCAGCTGGCTCTGG - Intergenic
1100329778 12:93571993-93572015 CCCGCGAGGGCTGCGCGCTCGGG + Exonic
1101955527 12:109209021-109209043 GCCCCAGAGGCTGCTGGGTCTGG + Intronic
1102025795 12:109713873-109713895 CGCGGAGAGGCTGCGCGCGCCGG + Intergenic
1103439081 12:120949852-120949874 CCAGCAGTGGCAGCCCGCTCGGG - Intergenic
1104939155 12:132386753-132386775 CCACCAGGAGCTGCTCGCTCTGG + Intergenic
1105071409 12:133236128-133236150 CCCGCAGAGCCTGCTCCTTCCGG - Intergenic
1107170229 13:37332458-37332480 CCAGCAGAGGCAACTTGCTCTGG + Intergenic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1110792265 13:79599697-79599719 CCAGCAGTGGCAACTCGCTCGGG - Intergenic
1111841224 13:93453886-93453908 CCAGCAGTGGCAGCCCGCTCAGG - Intronic
1113385066 13:109841139-109841161 ACCCCAGAGCCTGCTCACTCCGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118906435 14:70027131-70027153 CCCACAGAGCCTTCTAGCTCTGG - Intronic
1118923179 14:70168316-70168338 CGAGCAGAGGCTGGTGGCTCAGG - Exonic
1121127699 14:91418264-91418286 CCCGCAGCTGCCGCCCGCTCTGG + Intergenic
1127267191 15:57371866-57371888 CCAGGAGAGGCTGCTGGCTGTGG + Intergenic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130662317 15:85840374-85840396 CCGGCAGAGGCTGCCCAATCAGG - Intergenic
1132540917 16:509309-509331 CTCGCGGAGGCCGCTGGCTCGGG + Intronic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1136635794 16:31522016-31522038 CCGGCAGTGGTTGCTCACTCCGG + Intergenic
1136638223 16:31539482-31539504 CCGGCAGTGGCTGCTCACCCCGG - Intergenic
1139366594 16:66437495-66437517 CCCGCAGAGGTTGACAGCTCAGG + Intronic
1139472369 16:67185042-67185064 CCCGCAGCTGCTGCTGGCTGAGG - Exonic
1142027550 16:87822709-87822731 CCCGGAGAGGTTGCACGCTCTGG - Intergenic
1142107863 16:88315900-88315922 CCCGCCCAGGCTGCCTGCTCCGG + Intergenic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1144777689 17:17793071-17793093 CCGGCAGCGGCTGCTCGCCAAGG + Exonic
1146303514 17:31710411-31710433 GGCGCAGAGGATGCACGCTCAGG - Intergenic
1148846483 17:50532934-50532956 ACCGCAGAGGCTACTCGGGCTGG + Exonic
1151666712 17:75549494-75549516 TCCGCAGGGGCTGCTGGGTCAGG - Intronic
1151712203 17:75813268-75813290 CAGGCAGAGGCTGCTCCCACTGG + Intronic
1162021178 19:7869323-7869345 CCCCCAGTGGCAGCTCGCCCAGG + Exonic
1162142314 19:8592189-8592211 CCCGGAGAGGCTGATATCTCTGG - Intronic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1163804160 19:19386042-19386064 CCCGCGGAGGCGACTCCCTCAGG - Exonic
1165710160 19:38005307-38005329 CCCCCAGACCCTGCTTGCTCTGG + Intronic
1202701830 1_KI270712v1_random:170511-170533 TCCGCAGGAGCTGCTCTCTCTGG + Intergenic
925041589 2:735329-735351 CCCGAAGGGGCTGGTGGCTCTGG + Intergenic
925844996 2:8027023-8027045 CTCTCAGAGGCTGCTTTCTCTGG + Intergenic
929947412 2:46381565-46381587 CCCTCATAGCCTGCTCTCTCGGG + Intronic
932486073 2:72085161-72085183 CCCCCAGAGGTGGCTTGCTCTGG + Intergenic
932571149 2:72939041-72939063 CCCACTGAGGCTCCTCTCTCTGG + Intergenic
934172740 2:89553958-89553980 TCCGCAGGAGCTGCTCTCTCTGG + Intergenic
948459163 2:238120844-238120866 TCCGCAGGGGCTGCTCACACTGG + Intronic
948808321 2:240462480-240462502 CCCGCAGGCGCAGCTCTCTCGGG - Exonic
1171318703 20:24220142-24220164 CCAGCAGTGGCAACTCGCTCGGG - Intergenic
1172166570 20:32903210-32903232 CTTGCATAGGCTGCTCCCTCCGG + Intronic
1174751036 20:53111838-53111860 CCCCCAGAGATTGCACGCTCTGG + Intronic
1178922978 21:36751510-36751532 CCCCCAGAGGCTGCGCTCTGTGG + Exonic
1179814173 21:43893247-43893269 CTAGCAGAGGCTGCTGGCTCAGG - Intronic
1180161675 21:46001072-46001094 CCCGTAAAGGCTGCTCTGTCCGG - Intronic
1180740889 22:18052747-18052769 CCGGCAGAGGCAACTCGCTCTGG - Intergenic
1180986250 22:19905526-19905548 CCCTCAGAGGCTGCCCGCTTGGG - Intronic
1183059621 22:35328149-35328171 CCTGCAGAGTCAGCTCGGTCAGG - Intronic
949133652 3:536162-536184 CCAGCAGAGGGAGCTGGCTCCGG + Intergenic
953982752 3:47420808-47420830 CATCCAGAGGCTGCTCGCACAGG + Intronic
954108300 3:48420743-48420765 CCCCCAGCGGCTGCTCACACAGG + Exonic
968676482 4:1883765-1883787 CCCACACATGCTGCTCGCTCTGG - Intronic
968756134 4:2417520-2417542 CCCGCCGAGGCTGCTGGCCACGG + Intronic
968831538 4:2934768-2934790 CCTGCCGCGGCTGCGCGCTCGGG + Intronic
969573966 4:8025678-8025700 CCCACAGAGGCTGCTCACAGGGG + Intronic
969590903 4:8121450-8121472 TCCTCAGATGCTCCTCGCTCTGG - Intronic
969796594 4:9532365-9532387 CGCCCAGAGGCCGCTCGCGCCGG + Intergenic
969869716 4:10097071-10097093 CCCTCAGATGCTGCTGGCCCCGG + Intronic
971905084 4:32715971-32715993 CCAGCAGAGGCAACCCGCTCGGG - Intergenic
975439821 4:74398642-74398664 CCCGCAGTGGCAACCCGCTCAGG - Intergenic
978875614 4:113637015-113637037 CCCTTAGAGGCTCCTCCCTCAGG + Intronic
984957310 4:185058304-185058326 CTGCCAGAGGCTGCTCCCTCTGG + Intergenic
985228492 4:187789229-187789251 CCCGCAGAGGCTGCTCCAGAAGG - Intergenic
987146118 5:14993381-14993403 CCAGCAGTGGCAGCCCGCTCGGG - Intergenic
987696550 5:21341358-21341380 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
988755653 5:34245212-34245234 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
989133551 5:38130831-38130853 CCAGGAGAGGCTGCTAGGTCAGG - Intergenic
989375396 5:40755607-40755629 CCGGCAGAGCCTGGTCGCTAGGG - Intronic
991743904 5:69710983-69711005 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
991753805 5:69844259-69844281 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
991795476 5:70290715-70290737 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
991803422 5:70400986-70401008 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
991823274 5:70586251-70586273 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
991833121 5:70719372-70719394 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
991887843 5:71290234-71290256 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
994841528 5:104929817-104929839 CCAGCAGTGGCAACTCGCTCTGG + Intergenic
995583802 5:113625861-113625883 CCAGCAGTGGCAACTCGCTCAGG - Intergenic
997475719 5:134141266-134141288 CCCTTAGGGGCTGCTGGCTCAGG + Intronic
999286546 5:150397651-150397673 CCCGAAGAGCCAGCTCGTTCTGG + Intronic
1002485147 5:179530198-179530220 CCCCCAGAGGCTCCTCGCCCTGG - Intergenic
1002780157 6:359294-359316 CCCACAGGGGCTGCTCGGTGGGG + Intergenic
1005554292 6:26956987-26957009 CCGGCAGAGGGAGCCCGCTCAGG + Intergenic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1013908211 6:115241115-115241137 CCAGCAGCGGCAACTCGCTCAGG - Intergenic
1013916684 6:115347692-115347714 CCAGCACAGGCTGCTTGCTGTGG - Intergenic
1018744935 6:166754665-166754687 CCTGGAGAGGCTGCTCCCCCAGG - Intronic
1020000710 7:4754094-4754116 CCCGCGGAGGCTACCTGCTCCGG + Intronic
1025284981 7:57653746-57653768 GCCGCGGAGGCTGCTGGATCCGG + Intergenic
1026272169 7:68845927-68845949 CCCGCAGAGGCTACTGGCATAGG - Intergenic
1028930649 7:96409211-96409233 CCCGCAGAAGCTGCTTCCTTTGG - Intergenic
1034807971 7:154105372-154105394 CCTGCCGAGGCTGCTCACTGCGG + Intronic
1036080386 8:5548915-5548937 CCCGGAGAGGTTGCTACCTCAGG + Intergenic
1036204399 8:6794490-6794512 CCCGCAGAGGCTGAACCCCCTGG + Intergenic
1038256419 8:25955016-25955038 CGCCCAGGGGCTGCACGCTCTGG + Intronic
1041713270 8:60911816-60911838 TCTGCAGGGGCTGCTGGCTCTGG - Intergenic
1044242455 8:89902717-89902739 CCCGGCGAGGCTGCCCGCTCGGG - Exonic
1049687147 8:143943558-143943580 CCCGCACAGGCTGCAGGCTGAGG + Intronic
1049780377 8:144426067-144426089 CCCACAGAGCCCGCTCTCTCCGG - Intronic
1049815408 8:144596862-144596884 CCGGCAGAGCCTGCGCCCTCCGG - Intronic
1054156150 9:61642002-61642024 ACTGCAGTGGCTGCTCGCTGAGG - Intergenic
1056413378 9:86354184-86354206 CCGGCAGAGGCTGAGCCCTCGGG - Intronic
1061808422 9:133149027-133149049 CTCGCAGAGGCCGCTCGCCTGGG + Intronic
1061834788 9:133321707-133321729 CGCGCAGAGCCTGGACGCTCAGG - Intergenic
1062174633 9:135154351-135154373 CCGGCAGTGGTTGCTGGCTCAGG + Intergenic
1062332371 9:136050443-136050465 CCAGCAGGCGCTGCTCGTTCAGG + Exonic
1185464203 X:345693-345715 CCCGCAGAGGCCCCGCGCTCAGG - Intronic
1186221988 X:7359077-7359099 CACACAGAGGCTGCTCCCTCCGG + Intergenic
1186368271 X:8918969-8918991 GCAGCTGAGGCTGCTAGCTCAGG - Intergenic
1201590355 Y:15608190-15608212 CACACAGAGGCTGGTCCCTCAGG + Intergenic