ID: 1136074703

View in Genome Browser
Species Human (GRCh38)
Location 16:27808945-27808967
Sequence CCCAGCCATCAGTGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136074703_1136074710 -6 Left 1136074703 16:27808945-27808967 CCTGCGTCCCACTGATGGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1136074710 16:27808962-27808984 GCTGGGCCCGAGAACCGGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 84
1136074703_1136074708 -8 Left 1136074703 16:27808945-27808967 CCTGCGTCCCACTGATGGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1136074708 16:27808960-27808982 TGGCTGGGCCCGAGAACCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 103
1136074703_1136074709 -7 Left 1136074703 16:27808945-27808967 CCTGCGTCCCACTGATGGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 121
Right 1136074709 16:27808961-27808983 GGCTGGGCCCGAGAACCGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136074703 Original CRISPR CCCAGCCATCAGTGGGACGC AGG (reversed) Intronic
905091297 1:35433325-35433347 CCCACCCACCAGTGGCAGGCAGG + Intergenic
915525849 1:156475835-156475857 CCCAGCCAGGAGTGGGGCGGGGG - Intronic
923857958 1:237864883-237864905 CCCAGCCTCCTGTGGGAGGCAGG - Intergenic
1062909077 10:1200297-1200319 CCCAGCCATCACTGGGGCTCTGG + Intronic
1064650939 10:17508639-17508661 GCCAGTCATCAGAGGGGCGCTGG + Intergenic
1067559391 10:47294347-47294369 CCCAGCCAGCAGCGGCACTCGGG - Intergenic
1067655505 10:48188561-48188583 CCCAGCCTGCTGTGGGATGCAGG + Intronic
1067742212 10:48904225-48904247 CCCGGGCAGCAGTGGGTCGCTGG + Intronic
1068201468 10:53789093-53789115 TCCACCCATCAGTTGGACTCAGG + Intergenic
1075289731 10:121218214-121218236 CCCTGCTATCAGTGTGATGCTGG - Intergenic
1076543618 10:131229406-131229428 CCCAGCCGTCAATGACACGCAGG + Intronic
1076757478 10:132580014-132580036 CCCTGCCAGCAGTGGGAGGAAGG - Intronic
1077297559 11:1833198-1833220 GCCAGCCACGTGTGGGACGCCGG + Intronic
1078895826 11:15596277-15596299 CCCAGTCATCAGTGGAATGCTGG + Intergenic
1079998408 11:27320605-27320627 CCCAGCCGTCAGTGGCATACTGG - Intergenic
1084967253 11:72751213-72751235 CCCAGCCAGGAATGGGACACAGG + Intronic
1088917776 11:114240273-114240295 CCCAGCCATGAGTGGGACGGAGG + Intronic
1089557647 11:119323419-119323441 CCCAGCCACCAGAGGGATGTGGG + Intergenic
1090240965 11:125181581-125181603 CCCAGCCCTCACTGGGCAGCTGG - Intronic
1091582821 12:1799308-1799330 CCCAGCCCTCAGCGGGACTCCGG - Intronic
1092049263 12:5456392-5456414 CCCAGAAATCAGTGGGACCCTGG + Intronic
1093746141 12:22742791-22742813 CACAGGCATCAGTGGGGGGCAGG - Intergenic
1096465706 12:51847060-51847082 GCCACCCAGCTGTGGGACGCGGG - Intergenic
1097224488 12:57469338-57469360 CCCAGCAGTCACTGGGACACAGG + Intronic
1098640320 12:72831127-72831149 CCCAGGCAGCAGTGGAATGCAGG + Intergenic
1106379795 13:29225045-29225067 CCCAGGCATCAGTGAGCAGCAGG + Intronic
1110023689 13:70508912-70508934 ATCAGCCATCAGTGAGAAGCAGG - Intergenic
1117480407 14:56138113-56138135 CGCAGGCATCAGTGGCAAGCCGG - Intronic
1121434824 14:93912175-93912197 GGCAGCCATCAGAGGGACCCTGG - Intergenic
1122167525 14:99839926-99839948 CCCAGCCAGGAGTGGTACGCAGG + Intronic
1122822946 14:104356218-104356240 CCCTGCCATCTGCAGGACGCTGG + Intergenic
1128358684 15:66945583-66945605 CCCTGCCAGCACTGGGAAGCAGG + Intergenic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1130147516 15:81285610-81285632 CCCAGCCAGGAGTGGGCCCCTGG + Intronic
1130326962 15:82889071-82889093 CCCAGCCAACAGAGAGAGGCAGG + Intronic
1131614941 15:94006242-94006264 CCTAGCCAGCAGTGGCCCGCTGG + Intergenic
1132365205 15:101251828-101251850 CCCAGCCAGCCGGAGGACGCGGG - Exonic
1135683356 16:24477933-24477955 CCCTGACATCAGTGGGACAAGGG - Intergenic
1136074703 16:27808945-27808967 CCCAGCCATCAGTGGGACGCAGG - Intronic
1139445467 16:66995566-66995588 CCCAGCCACAAATGGGACCCTGG - Intronic
1139974187 16:70795879-70795901 CCCAGCCAGCAGTGAGACAGTGG + Intronic
1141148819 16:81550470-81550492 CCCAGCCAAGAGTGGGAGGGGGG - Intronic
1141592540 16:85078128-85078150 CCCAGCCATGAGTGGGAACAGGG - Intronic
1141890201 16:86921180-86921202 CCCAGCCCTGAGTGGGACCCAGG + Intergenic
1142189458 16:88711192-88711214 CCCAGCCCTCTGTGTAACGCTGG + Intronic
1142285784 16:89171038-89171060 CCTAGCGTTCAGTGGGATGCGGG + Intergenic
1142742726 17:1940547-1940569 CCCAGCCTGCAGGGGGAGGCAGG + Intronic
1143410292 17:6704461-6704483 CCTAGCCAGAAGTGGGAAGCTGG - Intronic
1143544293 17:7587430-7587452 CCCAGCCATCAGGGGATCTCCGG - Exonic
1144179545 17:12739251-12739273 CCCAGCCACCAGTCAGATGCGGG + Exonic
1147183067 17:38698982-38699004 CCCAGCCAGCAGTGTGACCTTGG - Intergenic
1148779123 17:50111823-50111845 CCCAGCCCTCAGTGTGGCCCAGG + Exonic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1158765641 18:60447237-60447259 CCCAGCAAGCAGTGGCAGGCTGG - Intergenic
1160693373 19:470591-470613 CCCAGCCCACACTGGGACTCAGG - Intronic
1161003343 19:1922223-1922245 ATCAGCCACCAGTGGGACACTGG - Intronic
1161594338 19:5143648-5143670 CCCAGCAGTCAGTGACACGCAGG + Intronic
1161767373 19:6215050-6215072 CCCAGTCACCTGTGGGATGCGGG - Intronic
1164673506 19:30087077-30087099 CCCAGCCATGGGCGGGACGCTGG + Intergenic
1165104701 19:33462075-33462097 GCCTGCCATCAGTGGGGTGCAGG - Intronic
1165325749 19:35113525-35113547 CCCAGCCATGAGAGGGGTGCTGG - Intergenic
927856114 2:26528970-26528992 CACAGCCAACAGTGGCAGGCTGG - Intronic
931471784 2:62545470-62545492 CCCACCCATCACTGGCACCCAGG + Intergenic
932595736 2:73092554-73092576 CCCAGCCCTCAGAGGAAGGCGGG + Intronic
933724403 2:85418482-85418504 CCCAGCAGGCAGTGGGCCGCGGG + Intergenic
934129415 2:88933187-88933209 GCCAGCCTTGAGTGGGACCCGGG + Intergenic
934976934 2:98809308-98809330 CCCAGCCACCACTGGGACTCTGG + Intronic
938139916 2:128787062-128787084 CCCAGCCAACAGCAGGAGGCAGG - Intergenic
940736007 2:157453395-157453417 CCAAGCCCTGAGTGTGACGCAGG - Intronic
947543540 2:230994760-230994782 CCCAGCCAGCTGTGTGACCCTGG + Intergenic
947856768 2:233329300-233329322 TCCACCCATCTGTGGGAAGCTGG - Intronic
948053967 2:234997648-234997670 CCCAGCCATCAGTGGGACAGTGG - Intronic
948589616 2:239040669-239040691 CCCAGGCATGAGGGTGACGCGGG - Intergenic
948852050 2:240713272-240713294 ATCGGCCATCAGTGTGACGCTGG + Intergenic
949034261 2:241809469-241809491 CCCAGCCTTCCGTGTGATGCTGG + Intronic
1170571497 20:17635342-17635364 ACCAGCCACCACAGGGACGCTGG + Intronic
1172107077 20:32523190-32523212 TCCACCCATCAATGGGACCCAGG - Intronic
1172908663 20:38389004-38389026 CCCAGCCCGCAGAGGAACGCTGG + Intergenic
1177338112 21:19760019-19760041 CCAAGCCATCTCTGGGACCCCGG + Intergenic
1183189667 22:36313825-36313847 CCCAGCCTTCAGGAGGATGCTGG + Intronic
1184354579 22:43970397-43970419 CTCAGCCATCAGAGGGACTCAGG - Intronic
1184726645 22:46351143-46351165 CCCAGCCCTCTCTGGGACACCGG - Intronic
949910104 3:8896734-8896756 CCTAGCCCACAGTGAGACGCAGG + Intronic
950173042 3:10852537-10852559 CCCAGCAATCACTGGGACTTTGG - Intronic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
954881397 3:53838241-53838263 CCCAGCCATGGGTAGGAGGCAGG + Intronic
965620841 3:170641079-170641101 CCCAGCCATAACTGGGTCACAGG - Intronic
967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG + Intronic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968727820 4:2256419-2256441 CCCAGCCATCCCCGGGAGGCAGG - Intronic
971658979 4:29387758-29387780 TCCAGGCATCAGTGGGTCACGGG + Intergenic
972638501 4:40905208-40905230 ACCAGCCATTAGTGGGTGGCGGG - Intronic
975557581 4:75680023-75680045 CCTAGCCCTCAGTGGGCTGCAGG + Intronic
983430909 4:167649851-167649873 CCCGGGCATCAGTGAGACCCTGG - Intergenic
984225391 4:177028812-177028834 CCCAGCCATGATAGGGACCCGGG + Intergenic
996342151 5:122451021-122451043 CCTTGGCATCAGGGGGACGCAGG + Exonic
997375624 5:133395154-133395176 CCCAGCCAGCAGTGGCAACCTGG + Intronic
999268548 5:150282882-150282904 CACAGCCAGCTGTGGGATGCAGG + Intronic
1001492367 5:172164888-172164910 GCCAGCCAGCAGTGGAAGGCTGG - Intronic
1007257844 6:40541156-40541178 GCCAGCCATCAGCGGGTCCCAGG + Intronic
1009907691 6:69889846-69889868 CCCAGCCAGCAGTGGCAACCTGG + Intronic
1013667875 6:112366700-112366722 CCCAGCCAGGAGCAGGACGCCGG - Intergenic
1013960211 6:115889875-115889897 CCCAGCCAGCAGTGGCAACCCGG + Intergenic
1018787430 6:167119063-167119085 ACCAGCCCTCAGTGGGGAGCTGG - Intergenic
1019159786 6:170062318-170062340 CACAGCCACCAGTGGGGCTCGGG - Intergenic
1022271140 7:28809236-28809258 CCCAGCCCACAGGGGGGCGCCGG + Exonic
1022479347 7:30733019-30733041 CCCAGCACCCAGTGAGACGCTGG - Intronic
1023103254 7:36739963-36739985 CACAGCCATCTGTGGGATGGGGG - Intergenic
1023689241 7:42769123-42769145 AACTGCCATCAGTGGGATGCGGG + Intergenic
1023779082 7:43639448-43639470 TCCAGCCACCAGTGGGATGATGG - Exonic
1024232593 7:47374010-47374032 TCCAGCCATCCGTGAGAGGCGGG + Intronic
1025144356 7:56491876-56491898 TCCAACCATCAGTGGGGCACAGG - Intergenic
1029855421 7:103510865-103510887 TCCAGCCTTCAGTGGGAGTCAGG + Exonic
1034001948 7:147424081-147424103 CCTAACCTTCAGTGGGACCCTGG + Intronic
1034224835 7:149474392-149474414 CCCCGCCATCGGTGGGTCCCAGG + Exonic
1035579745 8:732044-732066 CCCAGGCACCTGTGGGACACAGG + Intronic
1036601837 8:10267999-10268021 CAAAGCCATCATTGTGACGCAGG - Intronic
1037438138 8:18886348-18886370 CCCAGTCATCAGAGAGATGCCGG - Intronic
1037637217 8:20710871-20710893 TCCAGCCTTCAGGGGGACTCTGG + Intergenic
1043979019 8:86616736-86616758 GCCAGGCATCAGTGGGAGGCTGG - Intronic
1044441799 8:92231860-92231882 CCCAGCCAGCAGTGGCAACCCGG + Intergenic
1044600527 8:93999366-93999388 CCCAGCCAACAGTGGCAACCCGG + Intergenic
1048538135 8:135316680-135316702 CCCAGCCATCTGCAGGAGGCCGG - Intergenic
1049577745 8:143397455-143397477 CCCAGCTCTGAGTGGGACACTGG - Intergenic
1049995213 9:1027739-1027761 GTCAGCCTTCAGTGGGACACTGG - Intergenic
1057105261 9:92408778-92408800 CCCACCCATCAGTGGACAGCTGG - Intronic
1061401478 9:130370712-130370734 CCAAGCCCTCAGCGGGATGCTGG - Intronic
1061934430 9:133849493-133849515 CACAGCCAGCTCTGGGACGCAGG - Intronic
1062629125 9:137455767-137455789 CCCAGCCACCAGCAGGATGCTGG + Intronic
1185430859 X:11000-11022 CCCACCCATCCCTGGGACTCGGG + Intergenic
1185440125 X:223397-223419 CCCACCCATCCCTGGGACTCGGG + Intergenic
1186919373 X:14261395-14261417 CCCAGGCATCCTTGGGACACTGG - Intergenic
1190054969 X:47175995-47176017 CCCAGCCATCCATGGGAAGACGG + Intronic
1192705532 X:73526041-73526063 CCCAGCCATCAGCAGCATGCAGG - Intergenic