ID: 1136074799

View in Genome Browser
Species Human (GRCh38)
Location 16:27809657-27809679
Sequence GAGAGAAAAGAGAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2803
Summary {0: 1, 1: 2, 2: 35, 3: 386, 4: 2379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136074799 Original CRISPR GAGAGAAAAGAGAGGGATGG AGG (reversed) Intronic
Too many off-targets to display for this crispr