ID: 1136075026

View in Genome Browser
Species Human (GRCh38)
Location 16:27811387-27811409
Sequence TTCCATCAGCAGAGGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136075024_1136075026 2 Left 1136075024 16:27811362-27811384 CCAAATAATGGTGCATGTGGTGA 0: 1
1: 0
2: 3
3: 8
4: 110
Right 1136075026 16:27811387-27811409 TTCCATCAGCAGAGGTGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 149
1136075021_1136075026 22 Left 1136075021 16:27811342-27811364 CCTCATTTTTGTTGACTCTTCCA 0: 1
1: 0
2: 0
3: 34
4: 315
Right 1136075026 16:27811387-27811409 TTCCATCAGCAGAGGTGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136075026 Original CRISPR TTCCATCAGCAGAGGTGCTC AGG Intronic
900421594 1:2558167-2558189 AGCCATGAGCAGAGCTGCTCTGG - Intronic
903331822 1:22600508-22600530 CTCCCTCAGGACAGGTGCTCTGG + Intronic
905459404 1:38112683-38112705 TTCTATGAGCAGATGTGTTCAGG + Intergenic
906249627 1:44301165-44301187 CTCTGTCAGCAGAGGTGCACCGG - Intronic
909005918 1:70276262-70276284 TTACATCAGCAAAGGTCCTATGG + Intronic
911565505 1:99458657-99458679 TTCCCTCAGAAGAGGTACTTAGG + Intergenic
912149238 1:106836782-106836804 TGCCATCTGCATAGCTGCTCTGG - Intergenic
916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG + Intergenic
917215055 1:172669546-172669568 TTCCATCACCAGAATTTCTCTGG + Intergenic
918575529 1:186054727-186054749 TTGTATCAGCATAGGAGCTCTGG + Intronic
920707926 1:208268330-208268352 TTCCATCAGCTGAGGCACCCTGG + Intergenic
924597550 1:245460703-245460725 TTCCAGCGGCAGAGGACCTCAGG + Intronic
1066656089 10:37701054-37701076 GTCCCTCAGCAGTGGGGCTCCGG - Intergenic
1067834503 10:49629824-49629846 TTCCATAGGCAGGGCTGCTCTGG - Intronic
1067842842 10:49695519-49695541 CTCCTTCAGCACAGGTGCCCCGG - Intronic
1069098617 10:64290512-64290534 TACCATCAGCAGAAATGATCAGG - Intergenic
1070759690 10:79016359-79016381 TTCCAGGAGCTGAGGTGCTGGGG - Intergenic
1072089253 10:92111023-92111045 TTCCAATAGCATATGTGCTCTGG + Intronic
1073382087 10:103086136-103086158 TTCTATCTGCAGGGTTGCTCTGG + Exonic
1074548509 10:114421191-114421213 TTCTATCAGCAAAGCTTCTCTGG - Intergenic
1078512485 11:11995820-11995842 CCCCATCAGCCGATGTGCTCAGG + Intronic
1079419765 11:20275264-20275286 TTCCATGACCAGAGAGGCTCAGG + Intergenic
1081768348 11:45628659-45628681 TTACAGGAGAAGAGGTGCTCTGG - Intergenic
1088397291 11:109382680-109382702 TGCAATCAGCAAAGGTGCCCAGG + Intergenic
1089585161 11:119505916-119505938 TTGCATCAGCAGAGGGGCCTAGG - Intergenic
1093110483 12:15145608-15145630 TTTCAACAGCAGGTGTGCTCAGG + Intronic
1093306429 12:17526706-17526728 TTACATCTGCTGAGGTGCTCAGG - Intergenic
1095945577 12:47751506-47751528 TTCCATAGGCAGTGCTGCTCTGG - Exonic
1096025235 12:48355053-48355075 TTCCATCAACAGAGCAGCCCAGG - Intergenic
1100244446 12:92743163-92743185 TTTCATCAGCAGAGGTCCCAGGG - Intronic
1101901221 12:108792523-108792545 CTCCACCTGCAGAGGTGCACAGG - Exonic
1103352920 12:120297942-120297964 TTCTTTCAGCAGATGTGGTCAGG + Intergenic
1103594288 12:122014298-122014320 TTTCATAAACAGAGGTGCTCTGG - Intergenic
1104149651 12:126070471-126070493 TCTCATCAGCAGAGGAGCTGGGG + Intergenic
1104926888 12:132318494-132318516 TCCCATCAGCACAGGGCCTCAGG + Intronic
1105250709 13:18697091-18697113 TTCCATCAGGAGAGGTGCAGAGG + Intergenic
1106412254 13:29518784-29518806 CTCCATGAGCACAGGTTCTCAGG + Intronic
1114964457 14:27940012-27940034 TTGGAGCAGAAGAGGTGCTCTGG - Intergenic
1115423470 14:33225300-33225322 ATACATGAGCACAGGTGCTCTGG + Intronic
1118091617 14:62486874-62486896 TACCATCAGCAGACTTACTCAGG - Intergenic
1119551312 14:75515847-75515869 TTACAAGAGCAGAGATGCTCTGG - Intergenic
1119970059 14:78960177-78960199 TTCCATCAGCAGTGAAGTTCGGG - Intronic
1124118172 15:26867049-26867071 GGCCCTCTGCAGAGGTGCTCCGG - Exonic
1129170559 15:73804940-73804962 TTCCTTCAGCAGATGAGCTAAGG - Intergenic
1129231895 15:74201582-74201604 TCCCTTTAGCAGAAGTGCTCAGG - Intronic
1130373233 15:83305334-83305356 TTACATAAGCAAAGGTGCTGAGG - Intergenic
1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG + Intergenic
1133256355 16:4518866-4518888 TTCCCACAGCAGAGGTGCTGGGG - Intronic
1134291381 16:12904512-12904534 TTCCCCCAGCAGAGCTGCACGGG - Intronic
1135738759 16:24955685-24955707 TTCTAACAGCAGAGCTGCTAAGG - Intronic
1135897426 16:26420317-26420339 TTGCAGGAGAAGAGGTGCTCTGG - Intergenic
1136075026 16:27811387-27811409 TTCCATCAGCAGAGGTGCTCAGG + Intronic
1142338665 16:89507041-89507063 GTGCCTCGGCAGAGGTGCTCGGG - Intronic
1145005334 17:19334275-19334297 ATCCTCCAGCACAGGTGCTCTGG - Exonic
1146056413 17:29583581-29583603 ATCCATCAGCAGGGGTGTGCTGG - Exonic
1146680315 17:34802564-34802586 TTCCATCAGTGGATGGGCTCTGG + Intergenic
1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG + Intronic
1148242430 17:46009472-46009494 TTCCATAAGCAGGGGTGGCCTGG - Intronic
1148738317 17:49877621-49877643 ATCTCTCAGCAGAGGAGCTCTGG - Intergenic
1150650426 17:67006354-67006376 TGCCATCAGCCGAGGCGCCCTGG - Intronic
1150908232 17:69361488-69361510 AGCCATCAGAAGAGGTGCTGTGG - Intergenic
1152296645 17:79471167-79471189 TTCCAGCAGGAGGGGTGCTGGGG - Intronic
1152807931 17:82366014-82366036 CACCAGCTGCAGAGGTGCTCTGG + Intergenic
1154438136 18:14361835-14361857 TTCCATCAGGAGAGGTGCAGAGG - Intergenic
1156560130 18:38115618-38115640 TTCCAGAAGCAAAGGTGCTTGGG - Intergenic
1157225577 18:45860246-45860268 TTCCAACAGCAGAGTTCCTTCGG - Exonic
1157582178 18:48780006-48780028 TTCCAGCAGCAGAAGTCCTAAGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162069660 19:8146157-8146179 TCCCATCCGCACAGGTGCACAGG + Exonic
1162809564 19:13155769-13155791 TTCCACCAGCAGACGTTCTGAGG - Intergenic
1163353966 19:16797649-16797671 TTCCATCAACAGAGGTGTTTTGG - Intronic
925874290 2:8298736-8298758 TTCCATCTGGGGAGGTCCTCTGG - Intergenic
927809653 2:26173953-26173975 TTCCATCAGCCGAGCGGCTGGGG - Intronic
932434019 2:71692510-71692532 TTACGTCAACAGAGGTGTTCTGG + Intergenic
932443000 2:71749683-71749705 TTCCCTCTGCTGAGGTGCCCTGG + Intergenic
932842796 2:75099370-75099392 TTGTAACAGCAGAGGTACTCAGG - Intronic
933555215 2:83823301-83823323 TGCCACAAGCAGTGGTGCTCAGG + Intergenic
933880218 2:86662181-86662203 TTGTATGAGCAGAGGTGGTCAGG + Intronic
934992409 2:98930690-98930712 TTCCACCAGCAGCTGTGCTCAGG + Intronic
936379572 2:111972460-111972482 TTCCATCATCAGGGGTGACCTGG - Intronic
937963006 2:127477020-127477042 TTGAATCTGTAGAGGTGCTCTGG - Intronic
938623143 2:133078489-133078511 ATCCAGCAGCAGAGGTCCTGGGG - Intronic
939360448 2:141164840-141164862 TTCAATCAGCAGAGGAATTCTGG - Intronic
944209858 2:197195701-197195723 TTACATCCGCAGAGGTTCTGTGG - Intronic
945346435 2:208723587-208723609 TTCCATCAGCAGGGGTACAGAGG + Intronic
946333049 2:219021267-219021289 GTCCAGCTGCAGAGCTGCTCAGG + Exonic
1170585530 20:17731393-17731415 TCCGTTCAGCACAGGTGCTCAGG + Intronic
1172780319 20:37432927-37432949 TTCCATCATCAGAAGAGCTGGGG + Intergenic
1173225212 20:41158517-41158539 CTCCCTCAGCAAAGGTGCACAGG - Intronic
1174796250 20:53525006-53525028 CCACAACAGCAGAGGTGCTCTGG + Intergenic
1175126225 20:56753826-56753848 TTCCATCTGCAGTGGAACTCTGG - Intergenic
1176096408 20:63346416-63346438 TTCCATCTGCAGGGGAGCTCAGG + Exonic
1176457537 21:6927637-6927659 TTCCATCAGGAGAGGTGCAGAGG + Intergenic
1176835711 21:13792721-13792743 TTCCATCAGGAGAGGTGCAGAGG + Intergenic
1179233481 21:39525828-39525850 TTCTAGAAGCAGAAGTGCTCTGG - Intergenic
1179796974 21:43790502-43790524 TTCCTGCAGCAGTGGTTCTCAGG - Intronic
1180600086 22:17009798-17009820 TGCCATCAGCAGAGGGTCTATGG - Intergenic
1183694687 22:39415074-39415096 TGCCATCAGCAGAGTAGCTGCGG - Exonic
1185275319 22:49948117-49948139 TTCCATCAGCAGGGCTGCTGTGG - Intergenic
952971932 3:38656769-38656791 TTCCATCCTAAGAGGGGCTCTGG + Intergenic
953385796 3:42505031-42505053 ATCCAGAAGCAGAGCTGCTCAGG + Intronic
953805258 3:46062674-46062696 TTCCAACAGAACAGGAGCTCAGG + Intergenic
955793981 3:62616478-62616500 TTCCTACAGCAGTGGTGTTCAGG + Intronic
955879384 3:63527525-63527547 CTCTGTCTGCAGAGGTGCTCAGG - Intronic
961168319 3:124778875-124778897 TTCCAACAGCAGAGGAGTTCAGG + Intronic
961681609 3:128603658-128603680 CCCCATCAGCAGGGGAGCTCAGG - Intergenic
966903370 3:184503635-184503657 TTCCATCAACAGAGGTTATCAGG - Intronic
967950302 3:194835296-194835318 TTCCACCACCAGTGGTGCACAGG - Intergenic
969596598 4:8152540-8152562 TTCCATCGCCAGGGCTGCTCAGG - Intronic
978143961 4:105349915-105349937 TACCAGCAGCTGATGTGCTCAGG - Intergenic
978190044 4:105900189-105900211 CTTCCTCATCAGAGGTGCTCTGG + Intronic
978205215 4:106073162-106073184 TTGCAGGAGGAGAGGTGCTCTGG + Intronic
982934735 4:161458188-161458210 TCACATCAGCAGAGCTGCCCAGG + Intronic
983441966 4:167798001-167798023 TTCCAGCTGCAGAGGTGCTCTGG - Intergenic
983687545 4:170429314-170429336 TTCCACCAGCACAGCAGCTCAGG - Intergenic
986292653 5:6412278-6412300 GTCAATCAGGAGAGGTGGTCTGG - Intergenic
989602035 5:43209365-43209387 TTCCAGCTAGAGAGGTGCTCTGG + Intronic
990127304 5:52534309-52534331 TTGGAGCAGAAGAGGTGCTCTGG - Intergenic
990627124 5:57626779-57626801 TTTCATCAGCAGTGGAGCTGTGG - Intergenic
990676764 5:58195433-58195455 TCCCCACAGCAGAGGTTCTCTGG - Intergenic
992115488 5:73534847-73534869 TTCCATCAGCTGGGGGGCTTAGG + Intergenic
995061693 5:107817488-107817510 TTTCATCAGCAGAAGTGCTTAGG + Intergenic
995181400 5:109234066-109234088 ATCCATCAGCAAAGGAGCTTTGG - Intergenic
995509922 5:112898532-112898554 CTCCATTAGCAGAGGTGATTAGG + Intronic
995894680 5:116998254-116998276 TTCCACCAGCACAGGAGCTATGG - Intergenic
997397598 5:133576646-133576668 ATCCAGCAGCAGAGGGGCTGAGG + Intronic
998226375 5:140329861-140329883 TCCCTTCAGCAGAGGTCCTCTGG - Intergenic
1000033706 5:157425403-157425425 TTGGATGAGAAGAGGTGCTCTGG - Intronic
1001058992 5:168472158-168472180 TGCCTTCCGCAGAGGTGGTCTGG - Intronic
1001079843 5:168659701-168659723 TCCCATCAACAGTGGTGCTCTGG + Intergenic
1003248307 6:4402464-4402486 TTGCATCTGCAGAGCGGCTCTGG - Intergenic
1008181388 6:48334251-48334273 TTCCAGCATCACAGGTGCTTGGG - Intergenic
1010820570 6:80411009-80411031 TTGCAGGAGAAGAGGTGCTCTGG + Intergenic
1013142018 6:107346888-107346910 TTCGACCAGCAGAGGTGTGCAGG + Intronic
1013378875 6:109546304-109546326 TTCCATCAACACTGGTCCTCAGG + Intronic
1015878532 6:137847787-137847809 TTCCATGAGCAGAAGTGAGCCGG - Intergenic
1016585018 6:145674364-145674386 TTGGAGGAGCAGAGGTGCTCTGG - Intronic
1022668237 7:32430930-32430952 TTCCATAAGGAGGGATGCTCTGG + Intergenic
1024696290 7:51859843-51859865 TTGCATCTGCAGAGGGTCTCAGG - Intergenic
1024786651 7:52914776-52914798 TTCCATCAGCATAGCTTCTTTGG + Intergenic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1027419674 7:78006740-78006762 TACCATTTGCAGTGGTGCTCTGG - Intergenic
1029361562 7:100091898-100091920 AGCCACCAGCAGGGGTGCTCAGG - Exonic
1038170683 8:25128751-25128773 CTCCATCAGCACAGGAGCTATGG - Intergenic
1041291442 8:56311963-56311985 TTCCCTAAGCAGAGGTCCTGGGG + Intronic
1041741328 8:61160093-61160115 TTTCTTCAGCAGAGAAGCTCAGG - Intronic
1042563337 8:70090113-70090135 ATTCCTCAGCAGAGGTCCTCGGG - Intergenic
1044842178 8:96345878-96345900 TTCCATCAGCAGAAGAGATCAGG - Intergenic
1049242045 8:141542980-141543002 TTCAATCAGCAGACGTACTGTGG + Intergenic
1051891354 9:21945519-21945541 TTCCAGCAGCAGGGGTGTTTGGG - Intronic
1052866956 9:33469751-33469773 TTCTGTCAGCAGAGGAGCCCTGG - Intronic
1054811612 9:69439840-69439862 TTGCAGGAGGAGAGGTGCTCTGG + Intronic
1056558882 9:87712396-87712418 TGCCCACAGCAGAGGTCCTCGGG + Intergenic
1057184168 9:93047312-93047334 GTTCATCAGCAGATGTGTTCTGG - Intergenic
1057701937 9:97369768-97369790 TTCCATCAAAAGAGGTCCTGAGG - Intronic
1057864313 9:98667124-98667146 TTAAATCAGCAGAGATGCTGGGG + Intronic
1058952997 9:109920882-109920904 TTCAATGAGTAGAGGAGCTCTGG - Intronic
1059329934 9:113528565-113528587 CTCCTTCAGCAGAGGAGCTAAGG - Intronic
1060461941 9:123864597-123864619 TTCTATGAGCAGACGTGCTTAGG - Intronic
1062170098 9:135129940-135129962 CTCCATCTGCAGATGAGCTCAGG + Intergenic
1062439132 9:136561747-136561769 TTCCATCAGCTGAGTTGTGCAGG - Intergenic
1062592751 9:137281412-137281434 TTCCCTGAGCAGAGGTCCTGCGG + Exonic
1062696600 9:137878910-137878932 TTCCGCCAGGAGAGGGGCTCCGG + Intronic
1185677053 X:1857623-1857645 TTCCAGGAGCATAGGTGCTGTGG - Intergenic
1186804469 X:13126293-13126315 TTTCATCAGAAGGTGTGCTCAGG - Intergenic
1187135464 X:16543357-16543379 TTCCATCATCACGGGTCCTCTGG + Intergenic
1189777624 X:44484519-44484541 TTCCATTAGGAGAGGTGCTCAGG - Intergenic
1199383871 X:147201345-147201367 TTGGAGCAGAAGAGGTGCTCTGG - Intergenic
1199561982 X:149172695-149172717 TTCATGGAGCAGAGGTGCTCTGG + Intergenic