ID: 1136075037

View in Genome Browser
Species Human (GRCh38)
Location 16:27811482-27811504
Sequence GTGGTGTTCCGGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136075037_1136075050 15 Left 1136075037 16:27811482-27811504 CCCTCCTCATCCCGGAACACCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1136075050 16:27811520-27811542 CAGCACCTCTAGGTCAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 108
1136075037_1136075047 5 Left 1136075037 16:27811482-27811504 CCCTCCTCATCCCGGAACACCAC 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1136075047 16:27811510-27811532 TGGCCACATCCAGCACCTCTAGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136075037 Original CRISPR GTGGTGTTCCGGGATGAGGA GGG (reversed) Intronic
900829087 1:4951301-4951323 GTTGTGTTCAGGGACGAGGAGGG + Intergenic
909931396 1:81503413-81503435 GGGGTGCCCCGGGATGAGGTAGG - Intronic
912705260 1:111906894-111906916 GTGGTGTGTGGGGATGAGAAAGG - Intronic
913104080 1:115595645-115595667 GTGGTGGTCTGGGATGTGGGGGG + Intergenic
913330171 1:117660737-117660759 GTGGTGTGGCAGGATGAGCATGG + Intergenic
915163698 1:153936537-153936559 GTGGTGCTCCCTGATGAGGTAGG - Exonic
915222438 1:154385695-154385717 GTGGAGCTCCAGGAAGAGGATGG + Intergenic
915240758 1:154519865-154519887 GAAATGTTCCGGGAAGAGGAAGG + Intronic
915435025 1:155897878-155897900 GTGATGTTTGGGGAGGAGGAGGG - Intronic
916255464 1:162782868-162782890 GTCCTTTTCTGGGATGAGGAAGG + Exonic
917443151 1:175084357-175084379 GTTGTGTTGGGGGATGTGGAGGG + Intronic
918086295 1:181247966-181247988 GGGGTGTCCCTGCATGAGGAAGG - Intergenic
918427235 1:184423232-184423254 GTGAAGTTCCTGAATGAGGAAGG - Intronic
918808973 1:189091506-189091528 GTGGTGTTAGGGGATGGGGGAGG - Intergenic
920647127 1:207811986-207812008 GGGGTGCTCAGGGAGGAGGAGGG - Intergenic
920672350 1:208014177-208014199 GCGGTGGTCTGGGGTGAGGAAGG - Intergenic
921147957 1:212377557-212377579 GTGGAGTTCCGGCAGGAGGTAGG - Exonic
921900141 1:220441336-220441358 GTGTTGTTTGAGGATGAGGAGGG + Intergenic
922618894 1:226978841-226978863 GTGGTGTGCAGGTATGAGGTGGG - Intronic
923103830 1:230838866-230838888 GTGGTGGTCAGGGCTGGGGAAGG + Exonic
1064481327 10:15743640-15743662 GTGGTATTCTGGGCTGACGAGGG + Intergenic
1067582643 10:47455365-47455387 CTGGTTTCCCTGGATGAGGACGG + Intergenic
1069920241 10:71811879-71811901 GTGGTGTTGGGGGGTGAGGGAGG - Intronic
1071269056 10:83990373-83990395 GTGGCCTTCAGGGGTGAGGAAGG + Intergenic
1072308977 10:94136214-94136236 GTGGTTACCGGGGATGAGGAAGG + Intronic
1072877668 10:99190696-99190718 TTGGTGTTCCTGCATGGGGATGG - Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1076299052 10:129410870-129410892 GTGGTGTGCCTGGATGAAGCCGG + Intergenic
1077188111 11:1244501-1244523 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189066 11:1248272-1248294 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189629 11:1250456-1250478 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1078435432 11:11320998-11321020 GTGGCTTTGGGGGATGAGGAAGG + Intronic
1079119707 11:17673106-17673128 GTAGTGTTCTAGGATGAGGAAGG - Intergenic
1080575776 11:33597803-33597825 AAGGTGTTCTGGGATGAGGGAGG + Intronic
1081173162 11:39893237-39893259 GTGGGGTTGCGGGATGGGGGAGG + Intergenic
1083142005 11:60729839-60729861 CTAGTGCTCTGGGATGAGGAAGG + Intronic
1083835152 11:65261852-65261874 GTGGGGTTCCGGAATGAGCCGGG + Exonic
1085002391 11:73051201-73051223 GTGGTGTTGCATGCTGAGGAGGG + Intronic
1086319375 11:85628611-85628633 GTGGTGTTCGGGTATGAGGCTGG + Exonic
1087285437 11:96260178-96260200 GTGGTGTTGGGGGATGGGGTGGG + Intronic
1089337154 11:117733172-117733194 CTGGTCTTCCGGGATGTGCAGGG - Intronic
1089833234 11:121347589-121347611 GTGGTGTTCTGATAAGAGGAGGG + Intergenic
1090246778 11:125221805-125221827 GGGGTGGTCGGGGAGGAGGAGGG - Intronic
1092704303 12:11267384-11267406 GTGGCTTTCCTGGATGAGGTGGG + Exonic
1096094489 12:48925346-48925368 GCGGTGTGCCGGGCTGAGGCTGG - Exonic
1096790120 12:54039260-54039282 GTGCTGTTGGGGGATGAGGAGGG + Intronic
1102599860 12:114021543-114021565 GTGGTTTCCAGGGATGAGGGGGG - Intergenic
1103987707 12:124778637-124778659 GTGGTGGGCGGGGATGAGGGTGG - Intronic
1104431799 12:128722511-128722533 GTGTTGCTCTGGGATCAGGAAGG - Intergenic
1104608331 12:130206011-130206033 GTGGTGTCCCTGGAGGCGGACGG + Intergenic
1104846881 12:131851361-131851383 GTGCTGGCGCGGGATGAGGACGG + Exonic
1104930131 12:132334356-132334378 GTGGAGTTCAGGAATGAGGGTGG + Intergenic
1104933561 12:132352989-132353011 GTGGGGTTCCGAGAAGAGGGAGG - Intergenic
1105442875 13:20429992-20430014 GAGGAGTTCGGGGAGGAGGAGGG - Intronic
1114146423 14:19982826-19982848 GTGGTTCTCTGGGAGGAGGAGGG - Intergenic
1114551584 14:23535456-23535478 CTGGTGTTCAGGGAAGAGGATGG - Intronic
1117109423 14:52434699-52434721 GTGGTGTTCTGAGATGGGGTTGG - Intronic
1118407562 14:65441939-65441961 GTGGGGTTGTGGGAGGAGGAGGG - Intronic
1119446792 14:74671407-74671429 GTTGTTTTCCAGGATGAAGAAGG - Exonic
1127256687 15:57299158-57299180 GTGGAGGTTCGGGATGGGGACGG + Intronic
1127569937 15:60231954-60231976 GTGGGCTTCCTGGATGAGGCAGG - Intergenic
1128318287 15:66675046-66675068 GTACTGTTCTGGGATGTGGAGGG + Intronic
1128776425 15:70323742-70323764 GTGGTGTTTGGGGAAGAGAAGGG - Intergenic
1129253157 15:74319624-74319646 GGGGTCTTCCTGGAGGAGGAGGG + Intronic
1129295060 15:74595718-74595740 GGGGTGCCCCGGGATGAGGTAGG - Exonic
1130032565 15:80328903-80328925 CTGGGGTTCAGGGATGGGGATGG + Intergenic
1132873532 16:2125907-2125929 ATGGTGTTGGGGGAGGAGGAGGG - Intronic
1134450964 16:14363204-14363226 GTGGTGTTCCGCGGTGTGGAGGG - Intergenic
1134552620 16:15145083-15145105 ATGGTGTTGGGGGAGGAGGAGGG - Intergenic
1136075037 16:27811482-27811504 GTGGTGTTCCGGGATGAGGAGGG - Intronic
1136471507 16:30483831-30483853 GAGGTGTTCCGGGAGGAGCTGGG + Exonic
1142267355 16:89070743-89070765 GTGGTGGTGCGGGGTGAGGGCGG - Intergenic
1143371269 17:6441545-6441567 GAGGTGTTAGGGGCTGAGGAAGG + Intergenic
1144004970 17:11091384-11091406 GTGGTGCTGGGGGCTGAGGAGGG + Intergenic
1144840837 17:18184571-18184593 GTGGTGTCCCGCGCTGAGAAGGG + Exonic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1146723870 17:35142064-35142086 GTGCAGTTCCAGGATGAGGGCGG - Exonic
1146834448 17:36099047-36099069 GTGGTGGTCAAGGATGTGGAGGG + Intergenic
1147028324 17:37609078-37609100 CTGGTGTTCCGGGATCAGTTGGG - Intronic
1147526694 17:41231772-41231794 GGGGATTTCCGGGATGAGAATGG - Intronic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151758792 17:76089205-76089227 GTGGTGCTCGGGGATGATGTCGG + Exonic
1151828316 17:76535803-76535825 ATGGTGTTCCATGATGTGGACGG + Intronic
1151977871 17:77492606-77492628 GCGGTGATCTGGGATAAGGAGGG - Exonic
1153179822 18:2420530-2420552 GTGGGGTTCAGGGAACAGGAAGG + Intergenic
1155505854 18:26532087-26532109 GTGGTATGCTGGGATGAGGATGG + Intronic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1161079412 19:2303136-2303158 GTGGGGGTCCGGGCTGGGGAGGG - Intronic
1162514311 19:11138896-11138918 GTGATTTTCCGTGATGATGAAGG + Intronic
1162929262 19:13948594-13948616 ATGGTCTTGGGGGATGAGGATGG - Intronic
1163461352 19:17439745-17439767 GTGGCTTCCAGGGATGAGGAAGG + Intronic
1164474857 19:28568004-28568026 GTGGGCTTCCTGGAAGAGGAAGG + Intergenic
1164817170 19:31213395-31213417 GTGGTGTCCAGGGGTAAGGAGGG + Intergenic
1165309902 19:35023530-35023552 GTGGAGCTCCTGGATGAGGTAGG + Exonic
1167072663 19:47230096-47230118 GTGCTGTTCCGGGATGATACTGG - Intronic
1167098875 19:47391786-47391808 GTCGGCTTCCGGGAGGAGGAAGG - Intergenic
1167663479 19:50810266-50810288 GTTGTGGTTGGGGATGAGGATGG + Intergenic
928248970 2:29658025-29658047 GTCCTGTTCCGGGAGGAGAAGGG + Intronic
931891633 2:66679474-66679496 GAGGTGGTCAGGGATGGGGAAGG + Intergenic
932355421 2:71064562-71064584 CTGTTGATCTGGGATGAGGAAGG - Intronic
932771653 2:74503758-74503780 GGGGTGTTCCTGGAAGAGGTCGG + Intergenic
933050887 2:77600582-77600604 GTGATGTTCTGGAATGAGAAGGG - Intergenic
933695448 2:85213994-85214016 GGGGCGTTCCGGGGTGAGAATGG - Intronic
936286714 2:111186911-111186933 GTGGTGTAGAGGGATGAGCATGG + Intergenic
937744492 2:125395510-125395532 GAGAAGTTCCGAGATGAGGATGG - Intergenic
939914496 2:148021770-148021792 GTGGAGCTCCGGGGTGAGGAGGG + Intronic
940508543 2:154585064-154585086 GTGGTGGTGCAGGATGTGGAAGG + Intergenic
942116187 2:172731365-172731387 ATGGTGGTCTGGGATGAGGAAGG + Intergenic
942772865 2:179543561-179543583 GTGGTGTTCTGGGATGCAGCGGG + Intronic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
945096406 2:206223486-206223508 GTGGAGTTCCTGGAAGAAGAAGG + Intergenic
946160695 2:217834315-217834337 GTGCTGTTCAGGGATCAGGTTGG - Intronic
948594414 2:239070209-239070231 TTGGTGTTCCAGGGTGAGTAAGG - Intronic
948777399 2:240296822-240296844 GGGGGGCTCCGGGCTGAGGAGGG + Intergenic
1169194056 20:3673980-3674002 GTGGGGTTTGGGGAAGAGGAAGG - Intronic
1170183963 20:13566207-13566229 TTGGTGTTACGAGATGAAGAGGG + Intronic
1171123020 20:22582117-22582139 GTGGTGTTCCGGCTTCAGGTGGG + Exonic
1172189268 20:33052142-33052164 GTGGTGTTCCAGGAACAGCAGGG - Intergenic
1172621798 20:36322247-36322269 GGGGTTTTCAGGGAAGAGGAAGG + Intronic
1172929734 20:38577474-38577496 GTGGCATTCCGTGAAGAGGAAGG + Exonic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1175689346 20:61054414-61054436 GTGATGTCCCGGGATGAAGAAGG - Intergenic
1176384164 21:6128866-6128888 GTCGTGTTCCGTGGTGGGGAAGG + Intergenic
1176548881 21:8213184-8213206 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176556776 21:8257397-8257419 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176567812 21:8396219-8396241 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176575715 21:8440438-8440460 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176956068 21:15105403-15105425 TTTGGGTTCCGGGATGAAGAGGG - Intergenic
1177861705 21:26462247-26462269 GTGGTGGCAAGGGATGAGGAGGG + Intergenic
1179148587 21:38790767-38790789 GTGGTCTTTCTGGATGTGGATGG + Intergenic
1179739310 21:43409378-43409400 GTCGTGTTCCGTGGTGGGGAAGG - Intergenic
1180001464 21:44997240-44997262 GTGGTGCTCCGGGAGGAGGGTGG + Intergenic
1180092022 21:45538145-45538167 TTGGTGCTACGGGGTGAGGATGG - Intronic
1180569597 22:16702737-16702759 GGCGTGTTTTGGGATGAGGAAGG - Intergenic
1181961253 22:26623234-26623256 ATGGTGGTGTGGGATGAGGACGG + Exonic
1182503306 22:30764279-30764301 GGGGTGGGCGGGGATGAGGAGGG + Intronic
1184688829 22:46108377-46108399 CTGGTGCTCAGGGAGGAGGAGGG + Intronic
1184849304 22:47110871-47110893 CTGGGTTTCCGGGATGAGTAAGG + Intronic
1185272631 22:49935919-49935941 GTGGGGGTCCGGGAGGAGCAGGG + Intergenic
1185272647 22:49935954-49935976 GTGGGGGTCCGGGAGGAGCAGGG + Intergenic
1185272661 22:49935989-49936011 GTGGAGGTCCGGGAGGAGCAGGG + Intergenic
1203253766 22_KI270733v1_random:129492-129514 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203261822 22_KI270733v1_random:174571-174593 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
950906820 3:16546009-16546031 GTGGAGTTGGGGGATGGGGAGGG + Intergenic
952545102 3:34410450-34410472 GTGATGTTGAGGGATGAGCATGG + Intergenic
962653506 3:137519177-137519199 GTGGGGTTAAGGGATGAGGGTGG + Intergenic
963259650 3:143179019-143179041 GTAGGGTTCAGGGCTGAGGATGG - Intergenic
966515109 3:180811339-180811361 GTGGTGTTCCAAGCTAAGGAAGG - Intronic
967953009 3:194855175-194855197 GTGGTAATCCAGGAAGAGGAAGG - Intergenic
968904678 4:3445774-3445796 GTGGGGTTCCGGGCTGCTGAGGG + Intronic
974135862 4:57817118-57817140 GTGGTGGTCAGGGATTGGGAGGG + Intergenic
974177192 4:58339314-58339336 GTGGGGTTGGGGGAGGAGGAAGG + Intergenic
981929422 4:150173775-150173797 GTGCTGCTCCTGGATGAGGTTGG + Intronic
982881991 4:160731564-160731586 GTGGTTTTCTGGGAAAAGGAAGG + Intergenic
984460949 4:180035872-180035894 AAGGTGTTCAGGGATGAAGATGG - Intergenic
985423878 4:189810535-189810557 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423898 4:189810612-189810634 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423909 4:189810645-189810667 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423920 4:189810678-189810700 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423929 4:189810711-189810733 CAGGTGTTCCGGGCTGAGGCCGG + Intergenic
985423939 4:189810744-189810766 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423950 4:189810777-189810799 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423960 4:189810810-189810832 CCGGTGTTCCGGGCTGAGGCCGG + Intergenic
985423970 4:189810843-189810865 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423981 4:189810876-189810898 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423991 4:189810909-189810931 CCGGTGTTCCGGGCTGAGGCCGG + Intergenic
985424018 4:189811008-189811030 GCGGTGTTTCGGGCTGAGGCTGG + Intergenic
985545578 5:507591-507613 GGGGTGTTGGGGGTTGAGGATGG - Intronic
985790679 5:1925504-1925526 GTGGCATTCTGGGATCAGGAGGG + Intergenic
986452501 5:7880648-7880670 TTGGTGTTTAGGGAGGAGGATGG + Intronic
996747871 5:126860969-126860991 GAGTTGTACTGGGATGAGGAGGG + Intergenic
1001738155 5:174023850-174023872 GTGTGGTTCCAGGATGAAGAAGG - Intergenic
1006475244 6:34248863-34248885 GGGGTGTTGGGGGATGCGGATGG + Intronic
1010180144 6:73076909-73076931 GTGGTGTTGAGGGCTGAGGCAGG + Intronic
1011501076 6:87990707-87990729 GTGGTAATCTGGGGTGAGGAAGG + Intergenic
1012865433 6:104612780-104612802 CTGGTGTTCTGGGATGAGCCTGG - Intergenic
1015173015 6:130275724-130275746 GTAATGTTCAGGGAAGAGGAGGG - Intronic
1018994494 6:168700897-168700919 GTGCTGTTCCTGGATGCAGAGGG - Intergenic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1021442984 7:20700416-20700438 GTAGTGTTCTGGGATCAGAACGG + Intronic
1021813317 7:24424556-24424578 GTGGTGATCATGGAAGAGGAGGG + Intergenic
1022580838 7:31552713-31552735 TTGGTGGTCTGGGATGTGGACGG - Intronic
1023838708 7:44083131-44083153 TTGGTGTTAAGGAATGAGGAAGG - Intergenic
1027674288 7:81140885-81140907 TTGGTGTTCCTGCATGGGGAGGG - Intergenic
1028064742 7:86369287-86369309 GTGGGGTTGGGGGAGGAGGAAGG + Intergenic
1028898511 7:96069073-96069095 AGGGTGTACAGGGATGAGGATGG - Intronic
1029192965 7:98784880-98784902 GGGGTGGCCAGGGATGAGGAGGG + Intergenic
1029622276 7:101697714-101697736 GTGAAGGTCCGGAATGAGGAAGG + Intergenic
1030660209 7:112209996-112210018 GTGGGGTTGGGGGATGGGGAAGG + Intronic
1031824649 7:126548165-126548187 GTGGGGTGGAGGGATGAGGAGGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034035184 7:147812211-147812233 GAGATGTTCCAGGAAGAGGAAGG + Intronic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034897940 7:154889640-154889662 GTGGTGGTCGGTGATGAGCAAGG + Intronic
1035096136 7:156357417-156357439 GTGATGATCCAGGATGTGGATGG + Intergenic
1036206860 8:6811871-6811893 GAGGGGTCACGGGATGAGGATGG + Exonic
1036501872 8:9321584-9321606 CTGGTGTTCCGAGCTGAGGCTGG + Intergenic
1036627197 8:10482078-10482100 TTGGGGTTCCAGGAAGAGGATGG + Intergenic
1038490384 8:27966369-27966391 CTGGTCTTTTGGGATGAGGAAGG - Intronic
1039729838 8:40262701-40262723 GTGGGGTTTGGGGAGGAGGAAGG - Intergenic
1042157909 8:65864959-65864981 CTGGTGTTCTGGGGTGAGGGTGG - Intergenic
1042957582 8:74268108-74268130 GAGTTGTTCTGGGATGAGGACGG + Intronic
1043181815 8:77094283-77094305 GTGGTGTGCGGGGAGGGGGAGGG + Intergenic
1047371401 8:124258972-124258994 ATGGTGTTGGGGGATGGGGAAGG - Intergenic
1048512472 8:135075275-135075297 GTGGAGTTCACAGATGAGGAGGG - Intergenic
1049644102 8:143728414-143728436 GTGGCGGTCCGGGTCGAGGAAGG + Exonic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1057383622 9:94589698-94589720 GTGCTGTTCAGGGAAGAGGGTGG - Intronic
1058969390 9:110066198-110066220 GTGGAGTTTCTGGAAGAGGATGG + Intronic
1059298954 9:113297738-113297760 GTGGTGGCTGGGGATGAGGATGG + Exonic
1059306026 9:113353908-113353930 CTGGGGTTCTGGGATGAAGACGG + Intronic
1060786058 9:126452367-126452389 GTGCTGGTCCGAGCTGAGGAGGG - Intronic
1061209688 9:129183651-129183673 GAGGTGCTCTGGGGTGAGGATGG + Intergenic
1061908072 9:133708896-133708918 GGGGGGTTCCTTGATGAGGAGGG - Intronic
1062567871 9:137171296-137171318 GTGCTGTCCCTGGAGGAGGAGGG - Intronic
1203470166 Un_GL000220v1:112640-112662 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203477987 Un_GL000220v1:156612-156634 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1186214436 X:7283759-7283781 ATGGTGGTGGGGGATGAGGAAGG + Intronic
1186608048 X:11111684-11111706 GTGGTGACCCGGGTGGAGGAGGG - Intronic
1186707493 X:12157327-12157349 GTGATGTTCCAGGAAGAAGAGGG - Intronic
1187813521 X:23206719-23206741 GTGGGGTGTCGGGATGAGTATGG - Intergenic
1189914264 X:45841490-45841512 GTGGTGCTATGGGATGAGGAAGG - Intergenic
1190375436 X:49784332-49784354 GGGGTGTCCCGTGAGGAGGAGGG + Intergenic
1191049041 X:56171514-56171536 GTGGGGTTCAGGGAGGGGGAGGG - Intergenic
1191609102 X:63092395-63092417 GTGGTGTGGGGGGATGGGGAAGG - Intergenic
1196605902 X:117656721-117656743 GTGGTGGTGCAGGATGTGGAAGG - Intergenic
1197439114 X:126468914-126468936 GTGGTGTTGGAGGATAAGGATGG + Intergenic
1201794741 Y:17882837-17882859 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1201806814 Y:18023148-18023170 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic
1202356116 Y:24050616-24050638 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1202514662 Y:25619493-25619515 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic