ID: 1136078299

View in Genome Browser
Species Human (GRCh38)
Location 16:27832000-27832022
Sequence GAAAATGCCCACTGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136078299 Original CRISPR GAAAATGCCCACTGAGGAAG GGG (reversed) Intronic
902714911 1:18265944-18265966 GGAGGTGCCCACTGAGGGAGAGG + Intronic
904119185 1:28185023-28185045 GAAAGGCCCCACTGAGAAAGTGG - Intronic
904556046 1:31365224-31365246 GAAAATGACCACTGGCCAAGAGG - Intergenic
906632228 1:47381103-47381125 GAAAAGCCTCACTGAAGAAGAGG - Intergenic
908566041 1:65357232-65357254 AAAAATGCCCACTGGTGAATGGG + Intronic
908609881 1:65845985-65846007 GGAAAAGCCCACGGAGGAGGCGG - Intronic
909127172 1:71687390-71687412 CAAAATGCCCACTGTGCCAGGGG - Intronic
909380907 1:74997312-74997334 GAAAGTGCTCTTTGAGGAAGTGG - Intergenic
912074923 1:105861938-105861960 GAATGCGTCCACTGAGGAAGAGG + Intergenic
912508732 1:110174237-110174259 GACCATTCCCACTGGGGAAGGGG - Intronic
912617361 1:111117000-111117022 GAAAGTGCCCAGTGATGAACTGG - Intergenic
913163365 1:116165148-116165170 GAAATTGTCCTCAGAGGAAGTGG - Intergenic
913452911 1:119004268-119004290 GAAAATGCTGACTGAGGCTGAGG + Intergenic
916393832 1:164363628-164363650 AAACATGCCCACTGATGAAAGGG - Intergenic
916464698 1:165062324-165062346 GAAAAAGCCATCTGGGGAAGGGG + Intergenic
916562127 1:165942052-165942074 GAAAATGCAGACGGAGGAAGGGG - Intergenic
917466216 1:175278741-175278763 AATTATGCCCACTGTGGAAGGGG + Intergenic
917476036 1:175369865-175369887 ACAAAAGCCTACTGAGGAAGGGG - Intronic
917480583 1:175408303-175408325 GAAAATGCTCAGTGAGCAAAAGG + Intronic
920434273 1:205938129-205938151 GAAAGGTACCACTGAGGAAGTGG - Intronic
920519774 1:206614659-206614681 GATTGTGCCCACTGGGGAAGGGG - Intergenic
920596952 1:207281431-207281453 GGAAGTGCCCTCTGAGGAAGTGG - Intergenic
920929302 1:210371815-210371837 GAATATGCCCACTGGGGTTGGGG - Intronic
921436365 1:215128161-215128183 GACAATGCCTACTAAGGAAAAGG - Intronic
924177153 1:241402908-241402930 GAAAATGCAAACAGAGAAAGGGG - Intergenic
924813791 1:247425498-247425520 TAACATGCCCAAGGAGGAAGAGG + Exonic
1062919744 10:1270922-1270944 GAAAATGCCCACAGGAAAAGAGG + Intronic
1063067857 10:2626990-2627012 GAAAAGTCCCAGTAAGGAAGTGG + Intergenic
1063768095 10:9165901-9165923 GGAAATGACCACACAGGAAGTGG + Intergenic
1064985566 10:21206803-21206825 GAAAATCCCCACAGAGGAATGGG - Intergenic
1065124720 10:22563156-22563178 AAAAATGCTCACTTGGGAAGGGG - Intronic
1065719440 10:28612001-28612023 GAAAAAGCCCTCTGAGAATGAGG + Intronic
1065784768 10:29202976-29202998 GCTAATGCCCACTGAGGTAGAGG + Intergenic
1069634702 10:69918088-69918110 GAGAATGGACCCTGAGGAAGGGG - Intronic
1070718049 10:78736820-78736842 CAAAATGCCATCAGAGGAAGTGG - Intergenic
1070766482 10:79059485-79059507 GAGACTGCCCACTGCGGGAGGGG + Intergenic
1071140869 10:82507769-82507791 GAAAATAGCCCCTAAGGAAGGGG + Intronic
1071444977 10:85737039-85737061 TAATACACCCACTGAGGAAGAGG + Intronic
1071981427 10:91007960-91007982 GTCAATGACCACTGAGGAGGAGG + Intergenic
1072009552 10:91291331-91291353 GAAACTGCCCACTGAGATGGAGG - Intergenic
1073155420 10:101342558-101342580 AAAAATGCCTTTTGAGGAAGAGG - Intergenic
1074729875 10:116359618-116359640 CAAAATGTCCGCTGGGGAAGGGG + Intronic
1079593279 11:22207841-22207863 AAAAATGCCCAGTTAGAAAGTGG + Intronic
1080416602 11:32074821-32074843 GAAAATGCCCATGGACTAAGAGG - Intronic
1082980425 11:59115742-59115764 GAAAATCCCCACCCAGGGAGGGG - Intronic
1083753939 11:64778935-64778957 GAAACTGCCCCCTGGGGGAGGGG - Intergenic
1083777337 11:64900679-64900701 TAAAAGGCCCGCTGAGGACGGGG - Intronic
1086388004 11:86329309-86329331 CAAAATGCCCAATGAGGAATGGG - Intronic
1087656255 11:100926381-100926403 TTAAGTGTCCACTGAGGAAGTGG - Intronic
1088282345 11:108148234-108148256 GAAAACTCCCCCTCAGGAAGAGG + Intergenic
1090837725 11:130465489-130465511 GAAACAGACCACAGAGGAAGTGG - Intronic
1090902635 11:131046323-131046345 TGAAATGCCCACTTGGGAAGGGG + Intergenic
1090934247 11:131327631-131327653 GAAAAGCCTCGCTGAGGAAGTGG - Intergenic
1091848328 12:3675297-3675319 GAAGAGGCCCACTGAGAAATGGG + Intronic
1093523162 12:20073669-20073691 CAAAATGCCCACATAGCAAGTGG + Intergenic
1094554056 12:31480717-31480739 GAAAAGGCTCATTTAGGAAGTGG + Intronic
1096384147 12:51183606-51183628 GAAAATGTCCACTGATTAACTGG - Intergenic
1097166755 12:57090071-57090093 GAAAAGGCTGACCGAGGAAGTGG + Intronic
1098070112 12:66664912-66664934 AAAAATTCCTATTGAGGAAGGGG - Intronic
1101810176 12:108101152-108101174 GAAAATTCCCACTCAGAGAGGGG - Intergenic
1102533015 12:113560709-113560731 GAAAATGGCCCCAGAGGATGGGG + Intergenic
1104644482 12:130487083-130487105 GCAAAAGCACAGTGAGGAAGGGG - Intronic
1106103144 13:26711334-26711356 GAAAACGCCCATCCAGGAAGCGG - Intergenic
1106547802 13:30745383-30745405 GAAAATGCCCACAGAGGGCAAGG - Intronic
1106764595 13:32901338-32901360 GAAAAGTCTCACTGAAGAAGAGG - Intergenic
1107046684 13:36000217-36000239 GTAAGTGCCCAGTGAGAAAGAGG - Intronic
1108166691 13:47700663-47700685 GTAATTGCACATTGAGGAAGGGG + Intergenic
1110781408 13:79469934-79469956 GAAAATGCCCAAGGTAGAAGAGG - Intergenic
1112709211 13:102107507-102107529 GAGACTGGCCCCTGAGGAAGTGG + Intronic
1113054544 13:106254130-106254152 AAAACTAACCACTGAGGAAGAGG + Intergenic
1113361603 13:109636481-109636503 GAAAAATCTCACTGGGGAAGAGG - Intergenic
1113838338 13:113344243-113344265 GAAGTTACCAACTGAGGAAGGGG + Intronic
1113917362 13:113882532-113882554 AAAATAGCCCAGTGAGGAAGCGG - Intergenic
1114155452 14:20098911-20098933 GGCAATACACACTGAGGAAGGGG - Intergenic
1115049423 14:29039181-29039203 GACAATTTCCACAGAGGAAGGGG + Intergenic
1117815714 14:59595214-59595236 GGAAATGCCAACTGAGCAAAGGG - Intergenic
1118913864 14:70084711-70084733 GAAAATATCCATTGAGAAAGAGG + Intronic
1119675577 14:76551097-76551119 GAAAATGCCAACTGTGCGAGAGG + Intergenic
1119771479 14:77222703-77222725 GAGAAGGGCCACTGCGGAAGGGG - Intronic
1121834647 14:97080873-97080895 GAAAATAACCACTGGAGAAGTGG - Intergenic
1121919234 14:97865385-97865407 GAAAATGCCAACAGAGAAAGGGG - Intergenic
1122976795 14:105174153-105174175 GCCACTGCCCACTGAGGGAGGGG - Intronic
1125788833 15:42347199-42347221 GAGATTGGCCAGTGAGGAAGGGG + Intronic
1127706711 15:61554644-61554666 GCCAATGGCCACTGAGGAAGAGG - Intergenic
1127798764 15:62459884-62459906 GAAAATCCTCTCTGAGGTAGGGG - Intronic
1128660078 15:69493673-69493695 GAATCTGCCCTCTGAGGAATGGG - Intergenic
1128682297 15:69660896-69660918 CAGAATGCCCACTAAGAAAGTGG + Intergenic
1130297366 15:82656765-82656787 GAAAATGCCCCCGGGGGATGTGG + Intergenic
1131244724 15:90781074-90781096 GAACAAGCTCACTGAGGAAGTGG + Intronic
1136078299 16:27832000-27832022 GAAAATGCCCACTGAGGAAGGGG - Intronic
1136619395 16:31418113-31418135 GACAGTGCCCACTGAGGATGAGG + Exonic
1140774952 16:78240994-78241016 GAACATGCCCACTGAGATGGAGG - Intronic
1142154159 16:88525693-88525715 GAAAATGGTGACGGAGGAAGGGG - Intronic
1142199161 16:88753035-88753057 GAAAAGGCTCAGAGAGGAAGAGG + Intronic
1142204734 16:88777557-88777579 GTAAATCCCCGCTGAGGCAGGGG + Intronic
1142216467 16:88832311-88832333 CATCATGCCCACTGAGGAAATGG + Intronic
1143125863 17:4640612-4640634 GAAAATGCGCACGGAGCAGGTGG - Intronic
1143402615 17:6656210-6656232 GAAAATGCGCACGGAGCAGGTGG + Intergenic
1143418079 17:6764929-6764951 GAGAAAGTCCACTGAGGAAGAGG - Intronic
1146409087 17:32566506-32566528 GAAAATGCAGAGTGAGGAGGTGG + Intronic
1147045057 17:37745540-37745562 GAAACTGACCACTTAGGAAGGGG + Intergenic
1147209517 17:38864053-38864075 GAAAAATCCCACTGAGAAAGGGG - Intergenic
1147597228 17:41724985-41725007 GAAGGTGCCGGCTGAGGAAGGGG - Exonic
1147966257 17:44195888-44195910 GAAAATAACCAGAGAGGAAGTGG + Intronic
1149162533 17:53711253-53711275 AAGAATCCCCACAGAGGAAGAGG + Intergenic
1149574734 17:57703458-57703480 CAAAATGCCCACTCTGGCAGTGG - Intergenic
1149772721 17:59333325-59333347 GCAAAGCCCAACTGAGGAAGCGG - Intronic
1150263792 17:63818538-63818560 GAAAATTCCTTCTGATGAAGGGG - Exonic
1151498596 17:74474424-74474446 CAAACTGCCCACTAAGGAAGGGG - Intronic
1152868191 17:82736554-82736576 GAAAATGTTAACGGAGGAAGTGG + Intronic
1154381415 18:13853893-13853915 GAAAATGCCAACTGAGAACAAGG + Intergenic
1155349723 18:24894692-24894714 GAAAATGCACAGGGAGAAAGGGG + Intergenic
1155486996 18:26355349-26355371 AAAAATGGCCACTGAGTTAGAGG - Intronic
1155554827 18:27007315-27007337 GAAAATGCAGACTAAAGAAGAGG + Intronic
1157017544 18:43735410-43735432 AAAAATGCCCATTCAGGATGAGG + Intergenic
1157258367 18:46157941-46157963 GAAGATCCCCACAGAGGAACGGG - Intergenic
1158111346 18:53943920-53943942 GAAAATGCCCAAGGGGGAGGAGG - Intergenic
1158792049 18:60793422-60793444 TAACATGCCCACTGAAGAAGGGG - Intergenic
1162949379 19:14061706-14061728 GAAAATCCCCGAAGAGGAAGGGG + Intergenic
1164565700 19:29324362-29324384 GAAAATGCCCACTCCAGAGGTGG - Intergenic
1164858389 19:31543084-31543106 GAAACTGCCCACTCTGGAGGTGG + Intergenic
1167268786 19:48496930-48496952 GAAAATGCCCTGTGTAGAAGGGG - Intronic
925465061 2:4099958-4099980 GAAAATGCATAATGAAGAAGGGG - Intergenic
925584833 2:5454142-5454164 GCAAATGCCCACAGGAGAAGTGG - Intergenic
925725004 2:6864066-6864088 GATAATGCACATTGAGGAACTGG - Intronic
926150774 2:10424588-10424610 GAAGATGCCCTCTGAAGAGGTGG - Intronic
926934963 2:18077628-18077650 GAAAAGGCCCTTTGAGGAAAGGG - Intronic
927071845 2:19538749-19538771 TAAAATGTCCACGGAGGAAGGGG + Intergenic
927229334 2:20804802-20804824 AAAAATCCCCACTTAGAAAGTGG + Intronic
927483910 2:23475787-23475809 GTAAAATCGCACTGAGGAAGAGG - Intronic
928444080 2:31317699-31317721 GAAAATGCCCAAAGAGAATGGGG - Intergenic
929050582 2:37833441-37833463 TAAAATGGCCACTGTGGAAATGG + Intergenic
929067612 2:37995295-37995317 GAATATACCCCCTGAAGAAGAGG + Intronic
931257243 2:60584387-60584409 TAAACTGCCCACTTGGGAAGGGG + Intergenic
931644470 2:64409117-64409139 GAAAGCGCTCACTGAGGAACTGG - Intergenic
932311300 2:70744463-70744485 GAAAATGACCTCTGAAGAGGTGG + Intronic
932502184 2:72192703-72192725 GAAAATCACCCCTGGGGAAGAGG - Intronic
935029972 2:99312204-99312226 GAAAATGTCCACAGAATAAGGGG - Intronic
937013971 2:118586853-118586875 AAGAAGGCCCACTGAGGAGGAGG + Intergenic
937023425 2:118678905-118678927 GAAAATGAGCGGTGAGGAAGAGG + Intergenic
937463192 2:122107028-122107050 GAAAATGCACAGTGGGCAAGAGG + Intergenic
937567853 2:123317672-123317694 GAAAATGCCAAGTGAAGAACTGG + Intergenic
938669306 2:133571886-133571908 AAAAAAGCCCAGTGAGGAGGCGG + Intergenic
939514150 2:143145337-143145359 GCAAATGTCCAGTGAGGAAGAGG - Intronic
939639632 2:144623840-144623862 GAGAATGCTCACTGTGGATGAGG + Intergenic
940251205 2:151678820-151678842 GAAAGTACCCACAGAGAAAGGGG + Intronic
941632717 2:167902684-167902706 GAAAATACCAATTGAAGAAGGGG - Intergenic
941740106 2:169026841-169026863 GAAAGTGCCAAATGAGGAGGAGG - Intronic
942082452 2:172413484-172413506 GAAAATTCCCTCTCAGAAAGTGG - Intergenic
942519065 2:176783816-176783838 GAAAATGCCCACAGGAGAAAGGG - Intergenic
942698656 2:178677723-178677745 GGAAATTCCACCTGAGGAAGAGG - Exonic
944392148 2:199228759-199228781 GAAAATGCCCAAGGAGGAGAAGG - Intergenic
945327575 2:208500687-208500709 GAAACTGCCAACTGAGCAACAGG + Intronic
946034030 2:216727593-216727615 AAGAAAGCCCACTGAGAAAGTGG - Intergenic
946856509 2:223955633-223955655 GAAAAGTCACACTTAGGAAGAGG - Intergenic
946944570 2:224807365-224807387 GAAGGTGTCCACTGAGGAAGGGG + Intronic
1168878728 20:1188021-1188043 AAAAATGACCCCTGAGGAGGAGG + Intronic
1169064593 20:2687693-2687715 CTCAATGCCCATTGAGGAAGAGG - Intergenic
1171449212 20:25224354-25224376 TAAAATGGCATCTGAGGAAGTGG - Intronic
1173457680 20:43216543-43216565 GAAAATACCCATAGAGGAATGGG + Intergenic
1173743956 20:45422163-45422185 GTAAAAGACCTCTGAGGAAGAGG + Intronic
1175472442 20:59240210-59240232 GAAAATTCCAACTGCAGAAGGGG - Intronic
1175634086 20:60566217-60566239 GAAAGGGCCCTCTGAGGAAGAGG + Intergenic
1177787217 21:25684113-25684135 GAAAATTTCCACTGAGGAGGTGG - Intronic
1178672334 21:34602991-34603013 GAATAGGTCCACTCAGGAAGCGG + Intronic
1179336342 21:40459614-40459636 CAAAATGACCATTGAGTAAGCGG + Intronic
1179481968 21:41684344-41684366 GAAAAGGCCCCCTGAGGACAGGG + Intergenic
1180213088 21:46307459-46307481 TAAAAAGCACACTGAGGTAGGGG - Intronic
1181129544 22:20722560-20722582 GAAAATGACCAAGAAGGAAGAGG - Intronic
1181620897 22:24090500-24090522 AAAAATGACCACACAGGAAGTGG - Intronic
1181766320 22:25094711-25094733 GAAAATGAACACTTAGGAAGAGG + Intronic
1182405775 22:30128675-30128697 GAAAATCCACCCTGAGGAGGTGG - Intronic
1183439006 22:37812695-37812717 GACAGTTCCCACTGAGGAACTGG - Intronic
1184365649 22:44049572-44049594 TAAAAGGCCTGCTGAGGAAGCGG + Intronic
1184503704 22:44888794-44888816 GCAAATGCCCAGGGAGGGAGAGG + Intronic
1184820645 22:46907313-46907335 AAAAATGCACAGAGAGGAAGGGG - Intronic
1185110979 22:48900001-48900023 AAAAATGGCCACCGAGGAATGGG - Intergenic
950351731 3:12361306-12361328 GAAAAAGCACACAGAGTAAGAGG - Intronic
951249073 3:20373136-20373158 TTAAATACCCAGTGAGGAAGAGG + Intergenic
952430248 3:33216920-33216942 ATAATTGTCCACTGAGGAAGTGG + Intronic
952478476 3:33735307-33735329 GAAAATGCAAAACGAGGAAGAGG - Intergenic
953052180 3:39354536-39354558 GAGAATGCCCTCTGTGGAGGGGG - Intergenic
953341923 3:42141734-42141756 GAAAACGCCCACAGAGGAGAGGG - Intronic
953915355 3:46916396-46916418 GAAGACGCTCACTTAGGAAGAGG - Intergenic
954524759 3:51260362-51260384 GAAACCACCCACTGAGAAAGAGG - Intronic
954711115 3:52505558-52505580 GGAAACTCCCACTGAGTAAGGGG - Intronic
954728019 3:52632606-52632628 GAAAATGGGCACTGAAGAAAAGG + Intronic
955438444 3:58930063-58930085 GAGAAGGCCCTCTGAAGAAGTGG - Intronic
955992539 3:64643143-64643165 TGAAATGCGCACTGAGGCAGTGG + Intronic
956780525 3:72599678-72599700 GAAACTGAGAACTGAGGAAGAGG - Intergenic
959637679 3:108593434-108593456 GAAAATGCTCACTTATGAACAGG - Intronic
962586386 3:136846505-136846527 GTAAGTGCCCACTAAGGCAGAGG - Intronic
965556673 3:170025636-170025658 GAAAATGAGAACTGAGGATGAGG + Intergenic
966667697 3:182490697-182490719 GAAAATGCCCACTGTAGATAAGG - Intergenic
966797177 3:183726659-183726681 GAATATGCCTAATGAGGGAGGGG - Intronic
967212771 3:187183415-187183437 CAACACGCACACTGAGGAAGTGG + Intergenic
967749488 3:193097598-193097620 GAAAATGCCCATTGAATCAGAGG - Intergenic
967948795 3:194824592-194824614 GAGAATGTCCAGTGTGGAAGCGG + Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969416099 4:7060313-7060335 GAAACTGACCACTGAGAAATGGG - Exonic
969586474 4:8097047-8097069 GAAAAGGCCCAGAGAGGCAGGGG + Intronic
969996600 4:11318866-11318888 GAAAATCCTCCCTGATGAAGGGG + Intergenic
972413522 4:38816305-38816327 GAAAATTGGTACTGAGGAAGGGG - Intronic
974197453 4:58593926-58593948 GAAAAGGCACACTGAGGAGCAGG - Intergenic
974694050 4:65341293-65341315 GAAATTGCCCAGCTAGGAAGTGG + Intronic
975425135 4:74216511-74216533 GCAAAGGCCCACTGAGGGACTGG - Intronic
976341568 4:83951446-83951468 GAAAATGACGACTGTGGCAGAGG + Intergenic
976591062 4:86850405-86850427 GAGAATGGACACTGAGGAACGGG + Intergenic
976821800 4:89215168-89215190 TAAAAGGCCCCCAGAGGAAGAGG - Intergenic
977429550 4:96914102-96914124 GAAAACTCATACTGAGGAAGGGG - Intergenic
977573798 4:98657063-98657085 GCGGGTGCCCACTGAGGAAGAGG + Intronic
978008264 4:103646325-103646347 AAAAATTCCTACTGTGGAAGTGG - Intronic
984567681 4:181350238-181350260 GTCATTACCCACTGAGGAAGAGG - Intergenic
985051981 4:186000209-186000231 GAACCTGTCCACTGAGTAAGCGG - Intergenic
986018704 5:3780989-3781011 GAAAATGTCCACTTGGCAAGGGG + Intergenic
986041030 5:3994187-3994209 GGAAATCCCCACAGAGGATGGGG + Intergenic
986704106 5:10441411-10441433 GAAACTGCCCACTGTCTAAGCGG + Intergenic
989159917 5:38380448-38380470 CAAAAAGCAAACTGAGGAAGAGG + Intronic
989517830 5:42363884-42363906 GGAAATGCACAGTGAGGAACAGG + Intergenic
990386027 5:55263665-55263687 GAAAAGGCTCACAGAAGAAGGGG + Intronic
994166507 5:96614722-96614744 GAAAAAAAGCACTGAGGAAGAGG - Intronic
996716436 5:126591660-126591682 GACAAAGCACACTGAGGATGGGG + Intronic
997871739 5:137511777-137511799 GAAAATGCTCACAAAGGATGTGG + Intronic
999519388 5:152335002-152335024 CAAAATGCCCACTGAGGAACAGG - Intergenic
999687504 5:154116168-154116190 GAGATTCCCCTCTGAGGAAGTGG + Intronic
999693923 5:154171662-154171684 CAAAAAGCCCACTTTGGAAGTGG + Intronic
1000003187 5:157159583-157159605 GATAACTCCCTCTGAGGAAGAGG + Intronic
1000909394 5:167003339-167003361 GGAAAAGCACACTCAGGAAGAGG - Intergenic
1001145445 5:169180071-169180093 GACAGTGACCAATGAGGAAGGGG + Intronic
1002932269 6:1642898-1642920 GAAAAAACTCAGTGAGGAAGGGG - Intronic
1002985590 6:2188120-2188142 CAACATGCCCACCGAGGAGGGGG + Intronic
1003796747 6:9613564-9613586 GCAAATGCCACCTAAGGAAGTGG - Intronic
1004186631 6:13426661-13426683 GAACAAGCCCCCTGAGGATGCGG + Intronic
1005979675 6:30827361-30827383 TAAATTGCCCACTGAGGTGGGGG - Intergenic
1010538657 6:77063614-77063636 GAACATGCCAACTAAGGAACTGG - Intergenic
1012210894 6:96517544-96517566 GAAAAAGACCACTGAAAAAGAGG - Intergenic
1012524750 6:100164084-100164106 GAACTGGACCACTGAGGAAGAGG - Intergenic
1012730280 6:102872934-102872956 GTAACTGTGCACTGAGGAAGGGG + Intergenic
1013542399 6:111123502-111123524 GAAATTAGACACTGAGGAAGTGG - Intronic
1014074970 6:117225197-117225219 GAGAATACCCAATGAGGATGTGG - Intergenic
1014124286 6:117759207-117759229 GATGATGCCCCCAGAGGAAGGGG + Intergenic
1016166939 6:140957664-140957686 GAACTTCCCTACTGAGGAAGAGG + Intergenic
1016959593 6:149659665-149659687 GAAAAAGCCCAAAGAGTAAGAGG + Exonic
1017260689 6:152383351-152383373 GTAAATGGCAAGTGAGGAAGAGG - Intronic
1017542675 6:155418674-155418696 GACGCTTCCCACTGAGGAAGTGG + Intronic
1017753610 6:157511073-157511095 GAAGATGCCTACTAAGGAAGAGG - Intronic
1019392395 7:795689-795711 GACAATGTCCAGTGAGGCAGTGG + Intergenic
1020099542 7:5387480-5387502 GAAAATGCCCATCAAGGGAGTGG + Intronic
1020967371 7:14888387-14888409 TAAGATGCCCAGTAAGGAAGAGG - Intronic
1024306451 7:47933341-47933363 AAAAATGACGACTCAGGAAGGGG - Intronic
1024431475 7:49293123-49293145 GAAAATGTTTACTGAGGAAAGGG + Intergenic
1027875033 7:83758020-83758042 GAAAATGCCTATGTAGGAAGTGG - Intergenic
1029358840 7:100073269-100073291 GAAAATGCCCACTAAGAGTGGGG + Intronic
1029982918 7:104896011-104896033 GAAAAAGCCATCTGAGGACGCGG - Intronic
1030345706 7:108430793-108430815 TAAAATCACCACAGAGGAAGTGG - Intronic
1032565731 7:132940982-132941004 GAAACTGGCCACTGAGAAAGTGG - Intronic
1034746569 7:153528674-153528696 GAAAAGGCCCACTGGAGAAGTGG - Intergenic
1036499907 8:9304076-9304098 ATTAATGGCCACTGAGGAAGTGG + Intergenic
1037047502 8:14326475-14326497 GATAATGACCACAGAGTAAGAGG + Intronic
1037391809 8:18400768-18400790 TAAAACTCTCACTGAGGAAGAGG + Exonic
1037650010 8:20827683-20827705 GAAAATGACCAGTGAGATAGAGG - Intergenic
1037652036 8:20847670-20847692 AAAATTGCCCCCAGAGGAAGGGG - Intergenic
1038543211 8:28406173-28406195 GAAAATGCTCACTGCAAAAGAGG + Intronic
1041313112 8:56536389-56536411 GAAAGAGGCCACTGAGCAAGAGG - Intergenic
1043368770 8:79566219-79566241 GAAAATGCCCACTTATGAAGAGG + Intergenic
1043461812 8:80467972-80467994 GCAAAGACCCACAGAGGAAGGGG - Intergenic
1043527663 8:81113338-81113360 GGAAAAGCCCATTGGGGAAGCGG + Intergenic
1043982280 8:86656968-86656990 GAATATGTACACTGGGGAAGGGG + Intronic
1045492475 8:102680752-102680774 GGAAATGCCATCTGAGGGAGGGG - Intergenic
1045532796 8:103000535-103000557 GAGGATGAGCACTGAGGAAGTGG - Intergenic
1047477784 8:125251300-125251322 GAAAATGCCCACAAATGAACTGG + Intronic
1049606824 8:143533409-143533431 GAAAATGCCTTCTGAGGAACAGG - Intronic
1057529580 9:95832121-95832143 TAAAATGGTCAGTGAGGAAGGGG + Intergenic
1057646299 9:96877748-96877770 GAAAATTCCGTCTGATGAAGAGG - Intergenic
1061712484 9:132497803-132497825 GCAAGTGCCCACTGATGCAGCGG + Intronic
1062212464 9:135372399-135372421 GAAAACGCCCCCTGAGAAGGGGG + Intergenic
1185946800 X:4385776-4385798 GAAGATGCCCACAGAGGAACGGG - Intergenic
1186669407 X:11755005-11755027 GATAACACCCAGTGAGGAAGAGG + Intergenic
1186757854 X:12691680-12691702 GGAAATACCCACAGAGGAATGGG + Intronic
1189558286 X:42166934-42166956 GAACACTGCCACTGAGGAAGTGG - Intergenic
1190223458 X:48528189-48528211 GAGAAGCCCCAGTGAGGAAGGGG - Intronic
1190650365 X:52563262-52563284 GAACATGCGCACTGAGGCAGGGG + Intergenic
1191249603 X:58254115-58254137 AAGAATGCCCCCGGAGGAAGGGG - Intergenic
1191251408 X:58261833-58261855 AAGAATGCCCCCGGAGGAAGGGG + Intergenic
1192373022 X:70531287-70531309 GGAAATCCTCACTGAGGAGGTGG - Intronic
1194048131 X:89034599-89034621 GAAAATTGGCACTGAGGAACAGG - Intergenic
1194995198 X:100584351-100584373 TAAAAAGCAGACTGAGGAAGAGG + Intergenic
1197153277 X:123243407-123243429 GAACATGGCCAGTGAGGAAGAGG - Intronic
1199966710 X:152826325-152826347 CAAATTGCCCGATGAGGAAGTGG + Intergenic
1199975471 X:152892687-152892709 GGAAATGCCCACCTGGGAAGAGG - Intergenic
1201148159 Y:11077860-11077882 GAAAATGCAGTCTGAGGATGGGG + Intergenic
1202198638 Y:22324113-22324135 GAAAATGCTCACTTAAAAAGAGG + Intronic