ID: 1136081783

View in Genome Browser
Species Human (GRCh38)
Location 16:27856981-27857003
Sequence TGCCAGGCTGGAAGAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 294}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136081783_1136081789 2 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081789 16:27857006-27857028 AGATTGGTCTCTCTTCGATTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1136081783_1136081790 11 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081783_1136081791 15 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081791 16:27857019-27857041 TTCGATTGGGCACCAGAGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1136081783_1136081793 17 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081793 16:27857021-27857043 CGATTGGGCACCAGAGGAAGGGG 0: 1
1: 0
2: 0
3: 23
4: 169
1136081783_1136081788 1 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081788 16:27857005-27857027 CAGATTGGTCTCTCTTCGATTGG 0: 1
1: 0
2: 0
3: 0
4: 56
1136081783_1136081792 16 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081792 16:27857020-27857042 TCGATTGGGCACCAGAGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1136081783_1136081794 21 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081794 16:27857025-27857047 TGGGCACCAGAGGAAGGGGTTGG 0: 1
1: 8
2: 21
3: 58
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136081783 Original CRISPR TGCCAGGCTGGAAGAAAGCT GGG (reversed) Intronic