ID: 1136081787

View in Genome Browser
Species Human (GRCh38)
Location 16:27856997-27857019
Sequence AGAGAGACCAATCTGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136081787_1136081800 28 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081800 16:27857048-27857070 CTCAACTTTGGGGGCCCATGTGG 0: 1
1: 0
2: 1
3: 16
4: 141
1136081787_1136081790 -5 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081787_1136081796 16 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081796 16:27857036-27857058 GGAAGGGGTTGGCTCAACTTTGG 0: 1
1: 0
2: 2
3: 11
4: 123
1136081787_1136081799 19 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081799 16:27857039-27857061 AGGGGTTGGCTCAACTTTGGGGG 0: 1
1: 0
2: 1
3: 1
4: 113
1136081787_1136081797 17 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081797 16:27857037-27857059 GAAGGGGTTGGCTCAACTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1136081787_1136081791 -1 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081791 16:27857019-27857041 TTCGATTGGGCACCAGAGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 67
1136081787_1136081793 1 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081793 16:27857021-27857043 CGATTGGGCACCAGAGGAAGGGG 0: 1
1: 0
2: 0
3: 23
4: 169
1136081787_1136081792 0 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081792 16:27857020-27857042 TCGATTGGGCACCAGAGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1136081787_1136081794 5 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081794 16:27857025-27857047 TGGGCACCAGAGGAAGGGGTTGG 0: 1
1: 8
2: 21
3: 58
4: 541
1136081787_1136081798 18 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081798 16:27857038-27857060 AAGGGGTTGGCTCAACTTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136081787 Original CRISPR AGAGAGACCAATCTGTTGCC AGG (reversed) Intronic