ID: 1136081790

View in Genome Browser
Species Human (GRCh38)
Location 16:27857015-27857037
Sequence TCTCTTCGATTGGGCACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136081787_1136081790 -5 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081784_1136081790 10 Left 1136081784 16:27856982-27857004 CCAGCTTTCTTCCAGCCTGGCAA 0: 1
1: 0
2: 4
3: 23
4: 284
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081786_1136081790 -1 Left 1136081786 16:27856993-27857015 CCAGCCTGGCAACAGATTGGTCT 0: 1
1: 0
2: 2
3: 13
4: 297
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081783_1136081790 11 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136081790 Original CRISPR TCTCTTCGATTGGGCACCAG AGG Intronic