ID: 1136081790

View in Genome Browser
Species Human (GRCh38)
Location 16:27857015-27857037
Sequence TCTCTTCGATTGGGCACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136081787_1136081790 -5 Left 1136081787 16:27856997-27857019 CCTGGCAACAGATTGGTCTCTCT 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081784_1136081790 10 Left 1136081784 16:27856982-27857004 CCAGCTTTCTTCCAGCCTGGCAA 0: 1
1: 0
2: 4
3: 23
4: 284
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081783_1136081790 11 Left 1136081783 16:27856981-27857003 CCCAGCTTTCTTCCAGCCTGGCA 0: 1
1: 0
2: 4
3: 28
4: 294
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49
1136081786_1136081790 -1 Left 1136081786 16:27856993-27857015 CCAGCCTGGCAACAGATTGGTCT 0: 1
1: 0
2: 2
3: 13
4: 297
Right 1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136081790 Original CRISPR TCTCTTCGATTGGGCACCAG AGG Intronic
901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG + Intronic
902004863 1:13224187-13224209 TCTCTTCCACTGGGCTCCTGTGG - Intergenic
902024081 1:13369922-13369944 TCTCTTCCACTGGGCTCCTGTGG - Intronic
902343717 1:15800739-15800761 ACTCTTGGACTGAGCACCAGAGG + Intergenic
904246393 1:29191212-29191234 GCTCTTAGAGTGGGCACCAGGGG + Intergenic
907369451 1:53991423-53991445 TCTCTTCAATGTGGCACCAGCGG - Intergenic
909027273 1:70496768-70496790 TCTCTTTGCTTTGGCAGCAGTGG - Intergenic
909629260 1:77753677-77753699 TCTCCTAGATTTGGGACCAGTGG + Intronic
911474471 1:98358734-98358756 TGTCTTGGATTGGGGACCGGGGG + Intergenic
912686660 1:111773285-111773307 TCTGTTTGATAGGGCACCAAGGG - Intronic
912795410 1:112690055-112690077 TCTATCCGATTGGTCACCACAGG - Exonic
915849956 1:159310743-159310765 TGTCTTCCATTGGCCACCAGTGG - Intergenic
916995044 1:170287647-170287669 TCTCTGAGATAGGGCTCCAGTGG + Intergenic
919559005 1:199095008-199095030 TCTAGTAGATTGGGAACCAGAGG + Intergenic
1070792804 10:79199704-79199726 TCTCCTAGAAAGGGCACCAGGGG + Intronic
1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG + Intergenic
1075623310 10:123943854-123943876 TCTATTCCATGGGGCAGCAGGGG - Intergenic
1076379630 10:130016028-130016050 TCTCTCAGAGTGGACACCAGAGG - Intergenic
1079730892 11:23937108-23937130 TCTAGTCGAATGGGAACCAGAGG - Intergenic
1082239422 11:49855276-49855298 TCTTTTGGAGTGGGCAGCAGAGG + Intergenic
1083027073 11:59559976-59559998 TCTCTCCGATTGGGTGCCTGAGG - Intergenic
1090970432 11:131637694-131637716 TCTTTTGGCTTGGGCACCACAGG - Intronic
1102126842 12:110489672-110489694 TCTCTTCTATTGGGGACCACAGG - Intronic
1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG + Intergenic
1125300570 15:38250902-38250924 TCTCTTTAATGTGGCACCAGCGG + Intergenic
1136081790 16:27857015-27857037 TCTCTTCGATTGGGCACCAGAGG + Intronic
1142900829 17:3010532-3010554 CCTCCTCCATTGGGCACCATGGG - Intronic
1145985977 17:29046598-29046620 TCTGTTCCATTGAGCAACAGTGG + Intronic
1161828830 19:6588296-6588318 CCACATCGATGGGGCACCAGGGG - Intronic
1165550213 19:36577426-36577448 TCTATTCTAGTGGTCACCAGAGG + Intronic
928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG + Intronic
930857795 2:56037835-56037857 TCCTTTCACTTGGGCACCAGAGG - Intergenic
934791572 2:97066859-97066881 TCCCTTTGGTTGGGCACCAGTGG + Intergenic
934814866 2:97315684-97315706 TCCCTTTGGTTGGGCACCAGTGG - Intergenic
934822829 2:97392799-97392821 TCCCTTTGGTTGGGCACCAGTGG + Intergenic
936535989 2:113311650-113311672 TCTCTTCTGTTGGGGGCCAGGGG - Intergenic
944945292 2:204677231-204677253 TCTTTTCAGTTGAGCACCAGAGG - Intronic
948319115 2:237055488-237055510 TCCCTTCCATTGGGGGCCAGAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1181872426 22:25910674-25910696 TCTCTTCTACTGGGGACCTGGGG + Intronic
950158107 3:10739063-10739085 CCTCTTTCATTGGACACCAGGGG - Intergenic
951391840 3:22114615-22114637 TGTCTTCTAATGGCCACCAGTGG - Intronic
961413905 3:126743672-126743694 TCTGTTCCCTTGGGCTCCAGTGG - Intronic
967969780 3:194990454-194990476 GTTCTTCGATTGAACACCAGAGG - Intergenic
972527664 4:39931627-39931649 TCTCTTGGATCTTGCACCAGGGG - Intronic
976285037 4:83363098-83363120 TCTCTGCGGTTGGGCTCCATGGG + Intergenic
977594607 4:98865153-98865175 TCTCTGAGATTTGCCACCAGTGG - Intergenic
979475537 4:121152870-121152892 ACTCCTCCATTAGGCACCAGAGG - Intronic
988690247 5:33564660-33564682 TCTCATCTATTGGGCACCATTGG + Intronic
998793202 5:145788362-145788384 TATCTTCTATTGGCCACCACGGG + Intronic
1023556126 7:41424647-41424669 AGTCTTTCATTGGGCACCAGTGG - Intergenic
1024862553 7:53862349-53862371 TCTCTTTGATTGTGCAACACAGG - Intergenic
1025567244 7:62451291-62451313 AATCTTCGAATGGGCCCCAGTGG - Intergenic
1026670823 7:72389211-72389233 TCTCTGGGATTGGTCCCCAGGGG - Intronic
1036479367 8:9124640-9124662 TCTCTTAGAGGGGGCTCCAGTGG - Intergenic
1041336274 8:56788093-56788115 TCTCTTCTTTTGGGCGCCACAGG + Intergenic
1051621890 9:19058869-19058891 TCTCTTTGATTGTGCAACACAGG + Exonic
1061974299 9:134060714-134060736 TCTCTTGGATGGGGCATGAGTGG - Intronic
1188998107 X:36911016-36911038 CCTCTTCTATTGGGCAAAAGGGG - Intergenic