ID: 1136088852

View in Genome Browser
Species Human (GRCh38)
Location 16:27904000-27904022
Sequence CCCCAAGGCAAGAGTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 6, 3: 68, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136088852 Original CRISPR CCCCAAGGCAAGAGTGTGCC TGG (reversed) Intronic
900095654 1:939123-939145 CCTCAAGGTAAGAGCGTGGCTGG + Exonic
900105219 1:978185-978207 TCCCAGGCCAAGAGTGTGCAGGG - Intronic
900457300 1:2783517-2783539 CCCCAAGGAGAGAGGGAGCCGGG - Intronic
900470963 1:2854775-2854797 CCCAGAGGCAAGGGAGTGCCTGG - Intergenic
901593812 1:10368976-10368998 CCCCAAGGCAGGAATGAGCCGGG - Intronic
903208854 1:21803912-21803934 CCCTGAGGCAGGAATGTGCCTGG - Intergenic
903479086 1:23639967-23639989 ACCCAGGGCAAGAGTGTGTCTGG - Intronic
903649797 1:24915699-24915721 CCCCGAGGCAGGAGTGTCCCTGG + Intronic
904052952 1:27651305-27651327 TCCCAAGGCGAGAGTCTGCCTGG + Intergenic
904706990 1:32398635-32398657 CCCCAAGTCAGGAGAGTCCCGGG - Intergenic
905713660 1:40129467-40129489 CTCCAAGGAAAAAGTGAGCCTGG + Intergenic
905862268 1:41359724-41359746 TCCCAAGGCAAGGGTGGGCATGG - Intergenic
907045681 1:51298726-51298748 CCCCAAGCCAAGAGGGCGGCAGG - Intronic
907287621 1:53392012-53392034 GCCCATGGAGAGAGTGTGCCAGG - Intergenic
907327046 1:53645111-53645133 CCCCGAGGCCAGACTGTGCTTGG - Intronic
907867348 1:58410921-58410943 CCCCAAAGCACAAGTGTGACTGG + Intronic
909323179 1:74316483-74316505 TCCCAAGGCAGGAGCATGCCTGG - Intronic
910537168 1:88311517-88311539 CACTAAGGCCAGAATGTGCCTGG - Intergenic
912302238 1:108530063-108530085 CTGCAAGGAAGGAGTGTGCCTGG - Intergenic
913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG + Intergenic
913438993 1:118877381-118877403 CCTCAAGGCAGGAGTGTGGAAGG - Intergenic
915211571 1:154313405-154313427 CCCCCAGACATCAGTGTGCCTGG + Intergenic
915523493 1:156462496-156462518 CCCCAGGGCACGGCTGTGCCAGG + Intergenic
915565597 1:156711028-156711050 CCCCAAGGAAAGGGCCTGCCCGG - Intergenic
916620316 1:166489687-166489709 CCCTGAGTCAGGAGTGTGCCTGG + Intergenic
917169761 1:172158199-172158221 CCCTGAGGCAAGAGTGTGCCTGG + Intronic
919879325 1:201891694-201891716 CCCATAGGGAAGAGTGGGCCTGG - Intronic
920159624 1:203986389-203986411 CCTCAAGGCAGGAGCATGCCTGG + Intergenic
921740602 1:218680519-218680541 CCTCAAGGCTGGAGTGTGCCCGG + Intergenic
922633562 1:227140512-227140534 CCCCGAGACAAGAGTATGTCTGG + Intronic
922909088 1:229200314-229200336 GCCCAGGGCAAGAGGGGGCCAGG - Intergenic
923052753 1:230400156-230400178 GCCCGAGGCAGGAGTGTGCCTGG - Intronic
923401954 1:233624297-233624319 CCCCAAGTCCTGTGTGTGCCTGG - Intronic
1064989388 10:21242928-21242950 TCCCAAGGCAGGGGTGTGCTTGG - Intergenic
1065318453 10:24486585-24486607 GCCCAAGGCAGGAGCATGCCTGG - Intronic
1067328028 10:45288194-45288216 CGCTAAGGCAGGAGTGTTCCTGG - Intergenic
1068894239 10:62181774-62181796 CCCTGAGGCAAGAGCATGCCAGG + Intergenic
1068916841 10:62442104-62442126 CTCCAAGGCAAGAGTGTCACTGG - Intronic
1069390288 10:67928116-67928138 CCCTAAGACTGGAGTGTGCCTGG + Intronic
1069667626 10:70174090-70174112 CCCTAAGGCAGGAGTGTGCCTGG + Intergenic
1072205885 10:93204996-93205018 CCCCCATGGACGAGTGTGCCAGG + Intergenic
1072745616 10:97937201-97937223 CCCTGAGGCAAGAAAGTGCCTGG - Intronic
1074622664 10:115142334-115142356 CCCTAAGGCAAGAGCAAGCCAGG + Intronic
1074783721 10:116820683-116820705 CCCCAAGGAAAGAGTGTAGATGG - Intergenic
1076876461 10:133218540-133218562 CTCAAAAGCAAGATTGTGCCTGG - Intronic
1077104086 11:834464-834486 CCCAAGGGCCAGAGTGGGCCGGG - Intronic
1077351005 11:2093168-2093190 AGCCGAGGCCAGAGTGTGCCTGG + Intergenic
1077542533 11:3154033-3154055 CCCCAAGGAAGGTCTGTGCCCGG + Intronic
1078001980 11:7504237-7504259 CCCCAAGGCAGGAGTGTGTTTGG + Intronic
1078013837 11:7595139-7595161 CACTGAGGCAAGAGTGTGCTTGG + Intronic
1078539477 11:12201528-12201550 TCCTAAGGCAGGAGTTTGCCTGG - Intronic
1080124957 11:28722141-28722163 TCCTAAGGCAGGAATGTGCCTGG - Intergenic
1081590315 11:44418269-44418291 CCCCAAGGCAGAAGCGTGCTTGG + Intergenic
1081620195 11:44614840-44614862 CCCCAAGGCAGGAGTGTGCCTGG + Intronic
1083257230 11:61504114-61504136 CCCTAGGGCAAGAGTATGCCTGG - Intergenic
1083682732 11:64358867-64358889 CCCCAAGCCAGGAATCTGCCCGG - Intergenic
1084358054 11:68652438-68652460 CGCCAAGGCCAGGGTGTCCCAGG - Intergenic
1085391709 11:76185530-76185552 CTCCAAGGCAGGAGTGCCCCAGG + Intergenic
1086190691 11:84075036-84075058 CCCTAAGGCAGGAGTGAGCTAGG - Intronic
1086283660 11:85220391-85220413 CCCTAGAGTAAGAGTGTGCCTGG + Intronic
1086753544 11:90529744-90529766 CCCCAAGGCCACAGTGGGGCAGG - Intergenic
1089228706 11:116950090-116950112 ACCCAAGGCAAGAGTGATCTGGG + Intronic
1089505539 11:118959541-118959563 CCCTGAGGCAAGAGGGAGCCTGG - Intergenic
1090583474 11:128184990-128185012 CCCCAAGGCAGGAGCATGCTTGG - Intergenic
1090596336 11:128324671-128324693 CCCCGTGGCAGGAGTGTGGCAGG + Intergenic
1091116538 11:133018727-133018749 CCAGAGGGCAAGAATGTGCCGGG + Intronic
1091773475 12:3169022-3169044 CCCCCTGGCAACAGTCTGCCAGG + Intronic
1092630307 12:10369646-10369668 CCCCAAGGCCACAGAGTGCAGGG + Intergenic
1093329026 12:17812879-17812901 CCCCAAGGCTAGACTGTCCTAGG + Intergenic
1093585668 12:20832671-20832693 CCCCAAGTCAGAAGTGTGCTTGG - Intronic
1094376461 12:29795001-29795023 CCCCAAGGCCATTGTTTGCCAGG - Intergenic
1095487940 12:42703771-42703793 TCCCAAGGCAGGAGTAGGCCTGG + Intergenic
1095606056 12:44069467-44069489 ACTCAAGGCAGGAGTGTGCCTGG + Intronic
1096745366 12:53723592-53723614 CCCCAAGGCAACTGTGTTACAGG - Exonic
1096791126 12:54046004-54046026 CCCCAGGGCAAGAGGCTGACAGG + Intronic
1097678248 12:62625409-62625431 CCACAGGGAAAGAGTGAGCCTGG + Intergenic
1098174963 12:67780864-67780886 CCCTGAGGCAAGAATGTGCTTGG - Intergenic
1098285944 12:68907035-68907057 CCCCATGGCTAAAGTTTGCCAGG + Intronic
1098593095 12:72237913-72237935 CCTTGAGGCAGGAGTGTGCCTGG + Intronic
1100364153 12:93903994-93904016 CCCTGAGGCAGGAGAGTGCCTGG + Intergenic
1100364249 12:93904610-93904632 CCCTGAGGCAGGAGAGTGCCTGG - Intergenic
1100472834 12:94908944-94908966 GCCCAATGCAGGAGTGTGCTTGG - Intronic
1100866823 12:98866191-98866213 CCCTAAAGCAAGAGTGTCCCTGG + Intronic
1101304635 12:103515443-103515465 CCCCAAAGCAAATCTGTGCCAGG - Intergenic
1102617908 12:114170721-114170743 TCCCAAGGCAGGAATGAGCCTGG - Intergenic
1102789073 12:115629225-115629247 CCCCAAGGCAGGACCATGCCTGG + Intergenic
1103162598 12:118742466-118742488 TCCCAGGGCAGGTGTGTGCCTGG + Intergenic
1103940368 12:124498259-124498281 CACCATGGTAAGCGTGTGCCAGG - Intronic
1104695757 12:130862444-130862466 CCCCAAGGCGGGAGACTGCCTGG - Intergenic
1104704727 12:130934439-130934461 CCCCATGGCAAGAATGAGCCTGG - Intergenic
1104738859 12:131157952-131157974 CCCCGAGGCAGGAGCCTGCCTGG - Intergenic
1105772413 13:23625221-23625243 ACCCAAGGCAATAGAATGCCAGG - Intronic
1106314193 13:28578951-28578973 CCCCAATGCAACAGTGTGGGAGG + Intergenic
1106362017 13:29039394-29039416 CCCTATGGCCAGAGGGTGCCCGG - Intronic
1106816093 13:33408809-33408831 CCTCAAGGTAAGAGTAAGCCTGG - Intergenic
1108531178 13:51328727-51328749 CCCCAAGGCTAGCGTGGGACAGG + Intergenic
1111641421 13:90975388-90975410 GCCCGAGGCAAGAGTTTGCAGGG - Intergenic
1116461897 14:45186740-45186762 CCCCGAGTCAGTAGTGTGCCTGG + Intronic
1116655799 14:47652066-47652088 GCCCAAGGCAAGAGGGTGCATGG + Intronic
1116827337 14:49685533-49685555 CCCTAAAGCAGGAGAGTGCCAGG - Intronic
1119142654 14:72281732-72281754 CCCTAAGGCAAGAATGAGCTTGG + Intronic
1119150561 14:72355856-72355878 GCCCAAGGCAAGAGAGTTCCTGG + Intronic
1119859768 14:77927742-77927764 CCCCTTGGCTTGAGTGTGCCTGG - Intronic
1122293645 14:100693096-100693118 CCCTGGGGCAAGAGTGTGGCCGG - Intergenic
1124035538 15:26050636-26050658 CCCCAAGCCACCAGGGTGCCCGG - Intergenic
1125059847 15:35406337-35406359 CCCCAAGGACAGATTGTGTCAGG + Intronic
1125712291 15:41796685-41796707 CCCACAGGCAGGAGTTTGCCTGG - Intronic
1125756655 15:42069761-42069783 CTCCAAGGCCTGAGTGGGCCTGG + Intronic
1128779783 15:70351778-70351800 ACCCAGGGGAAGAGTGTTCCAGG - Intergenic
1129449454 15:75642293-75642315 CCTTAAGGCAGGAATGTGCCTGG + Intronic
1131225566 15:90622118-90622140 CCCCAAGGCAGGAGTGGGCCTGG + Intronic
1131554899 15:93388912-93388934 CACCAAGGCAAAAGTGTCCAGGG - Intergenic
1132380109 15:101360476-101360498 CCCCCGGGCAGGAGTGTGTCTGG - Intronic
1132380122 15:101360521-101360543 CCCCCGGGCAGGAGTGTGTCTGG - Intronic
1132380136 15:101360566-101360588 CCCCCGGGCAGGAGTGTGCCTGG - Intronic
1132380149 15:101360611-101360633 CCCCTGGGCAGGAGTGTGCCTGG - Intronic
1132380163 15:101360656-101360678 CCCCCGGGCAGGAGTGTGCCTGG - Intronic
1132380177 15:101360701-101360723 CCCCCGGGCAGGAGTGTGCCTGG - Intronic
1134423110 16:14112718-14112740 CCCCAAGGCAAAAATATCCCTGG - Intronic
1135305544 16:21364667-21364689 TCCCAAGGCAGGGGTGTGGCAGG - Intergenic
1136088852 16:27904000-27904022 CCCCAAGGCAAGAGTGTGCCTGG - Intronic
1136302285 16:29343820-29343842 TCCCAAGGCAGGGGTGTGGCAGG - Intergenic
1136857733 16:33674308-33674330 TCCCAAGACAACAGTGTGACAGG + Intergenic
1138143508 16:54588300-54588322 CCCCATGGCAGGAGCGTGCTGGG - Intergenic
1141619260 16:85228121-85228143 CCCCGAGGCAGGAGTGAGCCTGG + Intergenic
1203119314 16_KI270728v1_random:1522791-1522813 TCCCAAGACAACAGTGTGACAGG + Intergenic
1142511103 17:393978-394000 AGCCAGGGCAAGAGTGTTCCAGG + Intergenic
1142858035 17:2743627-2743649 CCCCGAGGCAAGAGTGTGCTGGG - Intergenic
1143326480 17:6101773-6101795 ACGCAAGGCAAGAGTGAGCAGGG + Intronic
1143511062 17:7395161-7395183 CCCCAAGGCAGGACTGGTCCTGG - Intronic
1143764910 17:9131061-9131083 CCCTGAGTTAAGAGTGTGCCTGG - Intronic
1143984101 17:10896248-10896270 CCCCAAGGCAGGAATGAGCTTGG + Intergenic
1144754001 17:17668566-17668588 TCCTGAGGCAGGAGTGTGCCGGG - Intergenic
1146485400 17:33238627-33238649 CCCTGAGGCAGGAGTGGGCCCGG - Intronic
1146661894 17:34670411-34670433 GCCTGAGGCAAGAGTGTGCCTGG + Intergenic
1148047486 17:44753113-44753135 TCCCAAAGGATGAGTGTGCCTGG + Intergenic
1148695472 17:49555794-49555816 CCCCAAGGCTAGAATATCCCTGG - Intergenic
1148995614 17:51706795-51706817 CCCTCAGGCAGGAGTGTGCCTGG - Intronic
1150173355 17:63023058-63023080 CCCCATGGCAAGTTTTTGCCTGG - Intronic
1150501439 17:65654494-65654516 CTCCAAGGCAAGCGGGTGGCTGG + Intronic
1150899428 17:69255060-69255082 CCCAAAGAAAAGAGTATGCCTGG + Intronic
1151284551 17:73100556-73100578 CCCTGAGGCAGGAGTGTGCTTGG - Intergenic
1151670042 17:75567058-75567080 CTCCAAGGCTTGAGGGTGCCCGG - Intronic
1151758817 17:76089359-76089381 CCCCCAGCCAGGAGTGTGGCTGG - Intronic
1152152232 17:78609365-78609387 CCCCCAGGCAAGTGCGTGCAGGG - Intergenic
1152467194 17:80473073-80473095 CCCCAAGGAAAGTGTTTGCCAGG - Intronic
1152798521 17:82320474-82320496 CCCTGAGGCCAGAGCGTGCCTGG + Intergenic
1154229304 18:12540086-12540108 ACCTAAGGAAAGAGTGTCCCAGG + Intronic
1154502738 18:15004701-15004723 CCCCACGGCCAGGGTGTGCTGGG - Intergenic
1155001609 18:21693052-21693074 CCCAGAGACAACAGTGTGCCTGG - Intronic
1155036731 18:22030743-22030765 CCCCGAGGCAGGAGGGTGCCTGG - Intergenic
1155774204 18:29738029-29738051 CCCCAAGGCTAGAGTGTCCTAGG + Intergenic
1157828604 18:50835478-50835500 CCCCAAGGCAAGTGTGTCCAGGG + Intergenic
1158602068 18:58863935-58863957 CCCCAAGGCCAGGGTGGGACAGG - Intronic
1159135020 18:64327314-64327336 CCCCAAGGCAATAGTGGCCCAGG - Intergenic
1159270282 18:66140352-66140374 CCCCAATGCAACAGTGTGGGAGG - Intergenic
1159477802 18:68945864-68945886 CCCCAAGCCAGTAGTGTGCAAGG - Intronic
1160791473 19:925635-925657 CCCCAAGCGCAGAGGGTGCCGGG - Intergenic
1161028647 19:2048054-2048076 CCCACAGGCGCGAGTGTGCCAGG + Intronic
1161069416 19:2252846-2252868 CCCCAAGGAAAGAAGGAGCCCGG - Intronic
1161482739 19:4518928-4518950 CCCTAAGGCAGGACCGTGCCAGG - Intergenic
1161496249 19:4587502-4587524 CCCCGAGGCAGGAGTGAGCTGGG - Intergenic
1161718343 19:5890032-5890054 CCCTAGGGCAGGACTGTGCCAGG + Intronic
1161777399 19:6271039-6271061 CCCCGAGGCAGGAGTGAGCTGGG - Intronic
1162152952 19:8658335-8658357 CCCCAAGACAAAAGACTGCCTGG - Intergenic
1162869703 19:13576197-13576219 CCCTGAGGCAGGAATGTGCCTGG - Intronic
1163233605 19:16019175-16019197 CCACAGGGCAAGGGGGTGCCTGG + Intergenic
1163526557 19:17824908-17824930 CCCCAGGGCCAGAGTGGGGCTGG + Exonic
1163544275 19:17931899-17931921 CCCTGAGGCAAGACTGCGCCTGG + Intergenic
1165396901 19:35569420-35569442 CCCCAAGGCCAGCCTGGGCCAGG - Intergenic
1165723109 19:38093625-38093647 CCCCAAGGCATGTGTGTGTGTGG - Intronic
1165739736 19:38198075-38198097 CCCTGAGGCAGGAGTGTGCCTGG - Intronic
1166142005 19:40810305-40810327 CACCAAGGAAAGATTGTGGCCGG + Intronic
1167171722 19:47836608-47836630 GCCCAAGGCAGGAGGGTGCTTGG - Intronic
1167447165 19:49544383-49544405 CCCTGAGGCAGGAGTGGGCCTGG + Intronic
1167637510 19:50663417-50663439 GCCCAGGGCAAGAGTGAGCCAGG - Intronic
1168275709 19:55277219-55277241 CCCTGAGGCCAGAGTGTGCCTGG - Intronic
1168453452 19:56484824-56484846 CCCCAAGGGAAGAGCATTCCAGG - Intergenic
925091668 2:1161483-1161505 CCCCTAGGCAGGTGTGGGCCAGG + Intronic
925258649 2:2511066-2511088 ACCCCAGGGAAGAGTGTGCAAGG + Intergenic
925288468 2:2730846-2730868 TCGCAGGGCAGGAGTGTGCCTGG - Intergenic
925918822 2:8625648-8625670 CTCCCAGGGGAGAGTGTGCCTGG + Intergenic
926185356 2:10686339-10686361 TCCTACGGCAGGAGTGTGCCTGG + Intronic
927393494 2:22622860-22622882 CCCCAAGGCTGGAATGTGCCTGG + Intergenic
927697157 2:25246476-25246498 CCCCAGGGCAAGAGAGACCCCGG + Intronic
928586286 2:32761589-32761611 CCCTGAGGCAGGAATGTGCCTGG - Intronic
929244374 2:39686017-39686039 CACCAAGGCACGAATGTGCAGGG - Intronic
929818549 2:45255802-45255824 CCCCAAGGCACGAGTATGTCTGG - Intergenic
932768847 2:74489352-74489374 CCCCAAGGCTGGAGGGAGCCTGG + Intronic
933856590 2:86420085-86420107 CTGTAAGGCAGGAGTGTGCCTGG - Intergenic
934059867 2:88283857-88283879 CCCCTAGGAAAAAGCGTGCCCGG + Intergenic
934920008 2:98335454-98335476 CCCTGAGGCAGAAGTGTGCCTGG + Intronic
935524810 2:104152683-104152705 AACCCAGGGAAGAGTGTGCCAGG + Intergenic
935979817 2:108615627-108615649 CCCAAAGGCATCAGTGTGCCAGG - Intronic
936284860 2:111174023-111174045 CCCCAGAGCAAGGGTGAGCCAGG - Intergenic
938066765 2:128285677-128285699 CCCCCAGGCAGGAGTCAGCCTGG - Intronic
938501905 2:131834869-131834891 CCCCACGGCCAGGGTGTGCTGGG - Intergenic
942232967 2:173876990-173877012 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
942883786 2:180896882-180896904 TCCCAAGGCAGGAGGGTGCCTGG - Intergenic
944677991 2:202050032-202050054 CTCCAAGGCAGGAGTGTGGGAGG + Intergenic
944894636 2:204151471-204151493 CCCTGAGACAAGAGTGAGCCTGG - Intergenic
946162309 2:217842806-217842828 CCCCGAGGCAGGAGTGTGCCTGG - Intronic
946549574 2:220786441-220786463 CGCCAGGACAAGAATGTGCCTGG + Intergenic
947466343 2:230350906-230350928 CCCTAAGGCTAGAGTATGTCTGG + Intronic
947655312 2:231821546-231821568 CCCCATGGCAAAACTGTCCCTGG - Intergenic
948026751 2:234784523-234784545 CCACAAGCCAAGATTGTGACAGG + Intergenic
948068963 2:235104508-235104530 TCCCTAGGCAAGAGTGGGGCAGG - Intergenic
948788064 2:240363363-240363385 CCCAGAGGCAGGAGTGTGCCTGG - Intergenic
948924181 2:241083267-241083289 CCCCAAGTCAGGAGTGTCCCTGG + Intronic
1168980431 20:1998895-1998917 CCCCGAGGCAGGAATGTGCTTGG - Intergenic
1169782173 20:9321594-9321616 CCCCAAGGAAAGTGTTTACCAGG + Intronic
1171320334 20:24237675-24237697 CCCTAAGGCAAGAAAGTGCCTGG + Intergenic
1172114670 20:32566578-32566600 CCCCGAGGCAGGAGTGTGTCTGG - Intronic
1172626332 20:36349574-36349596 CCCTGAGGCAGGAGTGCGCCTGG + Intronic
1172934456 20:38609745-38609767 CTCCAGGGCAAGAGGGAGCCTGG + Intronic
1173293220 20:41732715-41732737 CCCCAAGACAGGTGTGTGCCTGG + Intergenic
1173374396 20:42470533-42470555 CCACAAGGCAAGAGGCAGCCTGG + Intronic
1173611317 20:44370358-44370380 CCCAATGGCAGGAGTGTGCTTGG - Intronic
1173659439 20:44723165-44723187 CCCTGAGGCACGAGTGTGCCTGG - Intronic
1174094623 20:48078449-48078471 CCCCGAGGCAAGACCATGCCTGG + Intergenic
1174200671 20:48804495-48804517 CCCTGAGGCAGGAGTGTGCTGGG + Intronic
1174202856 20:48819312-48819334 CCCTGAGGCAGGACTGTGCCAGG - Intronic
1175281232 20:57805265-57805287 CCCTGAGGCCACAGTGTGCCTGG - Intergenic
1175917882 20:62435544-62435566 GCCGAAGGCAGGAGTGTGCCTGG - Intergenic
1177082545 21:16658490-16658512 CCAGAAGGCCAGACTGTGCCTGG - Intergenic
1181577419 22:23803739-23803761 ACCCAAGGCAGGTGTGTGCAGGG - Intronic
1181751076 22:24989615-24989637 GCCCAAGGCAAGAGTGTGGGAGG + Intronic
1182352702 22:29707707-29707729 CCCCAGGGCAGGAGGGTGCTGGG + Intergenic
1182951831 22:34383309-34383331 CCCCAAAGCAAAAGTGTTTCTGG + Intergenic
1184165600 22:42725570-42725592 CCCTTAGGCAAGGCTGTGCCTGG - Intergenic
1184537812 22:45099569-45099591 CCCAAAGGGAAGAGGGAGCCGGG + Intergenic
1185231483 22:49686640-49686662 TCCCAAGGCAGGAGGGGGCCTGG - Intergenic
1185280942 22:49969601-49969623 TGCCAAGGCTACAGTGTGCCAGG + Intergenic
949413958 3:3797326-3797348 CCCCAAGGCAAGAGTGAGAAAGG - Intronic
950457206 3:13099875-13099897 CCCCAAGGGAGCAGTGTGCCTGG + Intergenic
950535775 3:13577366-13577388 CCCCAGGGCAGGAAGGTGCCTGG + Intronic
951220938 3:20068371-20068393 CGCAAAGGCAAGAGAGTGCCTGG - Intronic
952391237 3:32882434-32882456 TCACATGGCAAGAGTGTGACAGG - Intronic
953196695 3:40740925-40740947 CCCCAAACCAGGAGTCTGCCTGG - Intergenic
953409578 3:42682868-42682890 TCCTGAGGCAAGAGAGTGCCTGG - Intergenic
953879223 3:46683118-46683140 CCCCACGGCAAGTGAGTGGCTGG - Exonic
954155105 3:48681062-48681084 CCACAAGGCAGGACTGAGCCTGG - Intronic
954366432 3:50148738-50148760 CCCTGAGGCTGGAGTGTGCCTGG + Intergenic
954436238 3:50497849-50497871 CCCCAAGGGAAGTGTGTGTGTGG - Intronic
954817064 3:53291000-53291022 TCCCAAGGGAAGAGTCTGACAGG + Intronic
955381497 3:58442008-58442030 CCCCAAGGCAAGGCTTTGCAGGG + Intergenic
956410592 3:68974323-68974345 CCCCAAGGCAGAAGCATGCCTGG - Intergenic
956754734 3:72373498-72373520 TCCCATGGCTAGAGTGTGACAGG - Exonic
957516923 3:81267110-81267132 ACCCAAGGCAATGATGTGCCAGG - Intergenic
957738039 3:84227157-84227179 CCCCAAGGCAAAAGTCTGGCAGG + Intergenic
959334965 3:105052541-105052563 TCTTAAGGCAGGAGTGTGCCTGG - Intergenic
959894441 3:111590622-111590644 CCCAAAGTCAAGATTTTGCCAGG + Intronic
960739966 3:120822318-120822340 CCACAGGGCAACAGTGTTCCTGG + Intergenic
960970884 3:123139334-123139356 CCCCAAGACAGGAGGGTGTCTGG + Intronic
961029198 3:123587151-123587173 CCCAGAGACAAGAGTTTGCCTGG - Intergenic
961756260 3:129128829-129128851 CCCCTGGGCAAGATGGTGCCTGG - Intronic
962387117 3:134940554-134940576 CCCCAGGGCAAGAAGGTGCCTGG - Intronic
962402500 3:135072581-135072603 CCCCCAGGCAGGAGTGAGGCTGG - Intronic
962578819 3:136779051-136779073 CCCCATGGCAAGGGAGTGGCTGG - Intergenic
962744010 3:138384030-138384052 CCCCGAGGCAGGGGTGTGCCTGG + Intronic
965539045 3:169854006-169854028 GCCCAAGGCCAGAGCATGCCTGG + Intronic
966137863 3:176720732-176720754 CCCCAGGCCAACAGTTTGCCAGG + Intergenic
968040856 3:195588158-195588180 CACCAAAGGAAGAGTGTTCCAGG + Intergenic
968734231 4:2287035-2287057 CCACAAGGCAAGGAAGTGCCAGG + Intronic
968801630 4:2746851-2746873 GCCCAAGGCATCTGTGTGCCAGG - Intronic
969004662 4:4009671-4009693 CCCCACGGCATGTGTGTGACTGG + Intergenic
969370288 4:6727534-6727556 CACCAAGGCCACAGGGTGCCGGG + Intergenic
970378744 4:15484220-15484242 CCCCAAGGGGAGAATGTTCCAGG + Intronic
970721554 4:18995217-18995239 CCCCATGGCAAGTGTCTGCCTGG - Intergenic
971190226 4:24421057-24421079 CCCCAATGCAATAGTGTGAGAGG - Intergenic
972311180 4:37885021-37885043 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
973278162 4:48332138-48332160 CCCTGAGGCAATAATGTGCCTGG - Intergenic
973779724 4:54277066-54277088 CCCGAAGGCAAGAGGATCCCAGG + Intronic
974191502 4:58509933-58509955 CTCTAGGGCAAGAGTGTGCAGGG - Intergenic
976428770 4:84937799-84937821 CCCCAAGGCAAGGATGTGCCTGG - Intronic
978189239 4:105894442-105894464 CCCCAAGGCAGGGGCATGCCTGG + Intronic
978354556 4:107857928-107857950 CCCTGAGGCAAGAATGAGCCAGG - Intronic
980212840 4:129812031-129812053 CCCCAAAGCCAGAGGGTACCAGG + Intergenic
980954110 4:139410798-139410820 CCCCAAGGCAGGAGTATGCTTGG + Intronic
981610551 4:146589746-146589768 CCCTGAGGCAAGAGTATGCCTGG + Intergenic
981998005 4:150995645-150995667 CCCTAAGGTAAGACTGTGCTTGG + Intronic
982552969 4:156825679-156825701 CCCAATGGCAAGAGTGTTCCAGG + Intronic
984583423 4:181535708-181535730 CTCCGAGGCAAGAGCTTGCCTGG - Intergenic
985041868 4:185898914-185898936 CCCCTAGGCAAGAGTGGATCAGG - Intronic
986287798 5:6372835-6372857 CCCAAAGGCACCAGTGTGACAGG + Intronic
986330003 5:6711099-6711121 CCCTGAGGCAGGAGTGTGCCAGG + Intergenic
986728494 5:10617802-10617824 CCCCAACTCAGGACTGTGCCTGG - Intronic
986799754 5:11246841-11246863 CTCTGAGGCAGGAGTGTGCCTGG + Intronic
989062728 5:37425500-37425522 CCCTAAGGCAGTAATGTGCCTGG + Intronic
989481685 5:41937915-41937937 CCCCAATGCAAGAGTGTTGCAGG - Intronic
994055895 5:95414657-95414679 CCCCAAGGCCAGAATGTGTTTGG - Intronic
994908171 5:105867801-105867823 CACCAGGGCAGGAGTGTGACTGG - Intergenic
997867792 5:137480010-137480032 CCACAAGTCAAGACTGTGCAGGG + Intronic
998514143 5:142737478-142737500 CCCCAAGGCAGGAAGGTGCTGGG + Intergenic
999638838 5:153650568-153650590 ACCCAAGGCAAAAGTGTGTCTGG - Intronic
999992700 5:157063897-157063919 CCCTAAGGCAGGAGGGTGCCTGG + Intergenic
1000207452 5:159075887-159075909 CCGCCAGGCAAGAGTCGGCCAGG - Intronic
1000851059 5:166340843-166340865 CCCCAAGCCAAGTCTGTGCTGGG - Intergenic
1001016881 5:168149859-168149881 CCCCTAGGCATGAGAGTGCTTGG - Intronic
1001762796 5:174222000-174222022 CCCCAAGGGAAGGGTCAGCCTGG - Intronic
1002111965 5:176921997-176922019 CCCTAAAGCAAGAGTGTGTTTGG - Intronic
1002192350 5:177484879-177484901 GCCCAGGACAGGAGTGTGCCTGG - Intronic
1006164194 6:32054844-32054866 CGCCAAGACCAGACTGTGCCAGG - Intronic
1006751836 6:36383171-36383193 GCCCAAGGCCAGAGTGAGTCAGG - Intronic
1007474460 6:42109580-42109602 CCCCAAGGCGGAAATGTGCCTGG + Intronic
1011440294 6:87380247-87380269 TCCTAAGGCAAGAGTGTGTCTGG + Intronic
1012422013 6:99076060-99076082 CCACAAGGCAAGAGTGAACCAGG + Intergenic
1014111065 6:117619014-117619036 CCCCAAGGCCACAGTGTGCAGGG + Intergenic
1014796936 6:125736067-125736089 CCACAAAGCAATAGTGTGCAAGG + Intergenic
1018468921 6:164079631-164079653 CCCCAAGGCCAATGTGTGGCAGG - Intergenic
1018846623 6:167561323-167561345 CCCCAAGGCAGGACTGGACCCGG + Intergenic
1019034480 6:169042971-169042993 CCCTAAGGCATGAGGGTGCTGGG - Intergenic
1019513475 7:1429746-1429768 CCCCATGGCAGGAGTGGGCAGGG - Intronic
1020257193 7:6508883-6508905 CTGCAAGGCAACAGTGTTCCTGG - Intronic
1022312551 7:29210854-29210876 TCCCAATGCGAGAGTGTACCTGG + Intronic
1023836601 7:44072381-44072403 ACCTGAGGCCAGAGTGTGCCTGG + Exonic
1024272532 7:47653560-47653582 CCCCAAGGCCAGAGGGTCCAAGG - Intergenic
1024526357 7:50353310-50353332 CATCATGGCAAGAGTGTGGCTGG - Intronic
1024606275 7:51025025-51025047 CCCACAGGCAAGCGTGTCCCTGG + Intronic
1026880772 7:73905413-73905435 CCACAAGGCAAGAGGAGGCCTGG - Intergenic
1028508796 7:91599010-91599032 CCCCAAGGCAAGAATGAGTTTGG + Intergenic
1029158556 7:98534729-98534751 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
1029191340 7:98774344-98774366 ACCCAAGGCATGAGGGTCCCCGG - Intergenic
1029609276 7:101618126-101618148 CAGCAAGGCCAGTGTGTGCCAGG - Intronic
1030537704 7:110789792-110789814 CCCTGAGGTATGAGTGTGCCAGG - Intronic
1031060425 7:117045398-117045420 CCCTAAGGCAGCAGTGTACCTGG - Intronic
1033156084 7:138958234-138958256 CCCCAAGGCAAGACTGGGGTGGG - Intronic
1033157034 7:138965983-138966005 CCTTGAGGCAGGAGTGTGCCTGG - Intronic
1033665925 7:143440419-143440441 GCCCAAGGGAAGAGTCTTCCAGG - Intergenic
1034148532 7:148894031-148894053 TCCCAAGGCCAGAGTGAGCTGGG + Intergenic
1034250758 7:149688719-149688741 CCCCAATGCAACAGTGTGGGAGG - Intergenic
1034263179 7:149769600-149769622 CACTAAGGCAGGAATGTGCCTGG - Intronic
1034564177 7:151900100-151900122 CCCCAAGGCAGGAGGGAGCCTGG - Intergenic
1037509225 8:19564561-19564583 CCCCAAGGCAAGAATGAGTGTGG - Intronic
1037757886 8:21723137-21723159 CCCCATGGGAAGAGTCTACCTGG - Intronic
1038679385 8:29652842-29652864 CCCCAAGGGAAGAATGTACCAGG + Intergenic
1038996643 8:32930387-32930409 CAAGAAGGCAAGAGCGTGCCTGG - Intergenic
1039989159 8:42473429-42473451 CCCTGAGGTGAGAGTGTGCCTGG - Intronic
1040957144 8:52990987-52991009 TCCTCAGGCAAGAGTGTGCTTGG + Intergenic
1041892926 8:62891362-62891384 GCCAAAGGCCAGAGTGTCCCTGG - Intronic
1042126713 8:65545274-65545296 CCCAAATCCAGGAGTGTGCCTGG + Intergenic
1042197651 8:66246256-66246278 CCCCAATGCAACAGTGTGGGAGG - Intergenic
1043308015 8:78821199-78821221 CCCTAAGGCAAGTGCCTGCCTGG + Intergenic
1044795961 8:95897921-95897943 ACCCATCTCAAGAGTGTGCCTGG + Intergenic
1045036581 8:98180892-98180914 CCCTGAGGCAGGAGTGTGCCCGG + Intergenic
1045099562 8:98830411-98830433 CCCAGAGGCAGGACTGTGCCTGG + Intronic
1046338783 8:112825376-112825398 CCAGAAGGCCAGAGTGTCCCTGG - Intronic
1049289188 8:141792458-141792480 CCCCAGGGCCACAGTGGGCCGGG + Intergenic
1049396154 8:142402100-142402122 CCCCAAGCCAGGAGCGAGCCAGG + Intronic
1049649188 8:143756291-143756313 CCTTAAGTCAGGAGTGTGCCTGG - Intergenic
1049738172 8:144221154-144221176 CCCCAAGGCAGGAGCTTCCCTGG - Intronic
1049821242 8:144634935-144634957 ACCCAAGGCCAGAATGTGCAGGG - Intergenic
1050166362 9:2768870-2768892 CACGAAGGCAAGAGCCTGCCTGG + Intronic
1050552115 9:6757864-6757886 GCCCAAAGCAAGAGCGTGCCGGG + Intronic
1051042217 9:12825444-12825466 TCCAAAGGCAAGAGTGTACTTGG + Intergenic
1051504430 9:17812106-17812128 GCCCAAGGCAGGAGAGTGCCTGG + Intergenic
1051532223 9:18117409-18117431 CTCTGAGGCAGGAGTGTGCCTGG - Intergenic
1051681357 9:19611195-19611217 CCCTGAGGCAGGAGTGTGCTTGG + Intronic
1052672911 9:31581075-31581097 CCCCAAGGAAATAGGGTCCCAGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057194787 9:93110885-93110907 CCCCGAGGGGAGAGTGTGGCAGG + Intronic
1057870313 9:98711746-98711768 CTCCGAGACAGGAGTGTGCCTGG + Intergenic
1057988058 9:99737772-99737794 CCCCAAAGCAGGTGTGTGCTTGG - Intergenic
1058475459 9:105328474-105328496 CCCCACGGTGAGAGTGTGCCAGG + Intronic
1059569605 9:115420514-115420536 AGCCAAAGCAAGAGTGTGCATGG - Intergenic
1059670908 9:116491483-116491505 CCTCAAGCTAAGAGTGTGGCGGG - Intronic
1060222870 9:121773679-121773701 CCCCAAGGCTACAGTGTCCCTGG - Intronic
1060225649 9:121788757-121788779 CCCCAAGTCCAGAGTATACCTGG - Intergenic
1060258320 9:122052286-122052308 TCCATAGGCAAGAGTGAGCCTGG - Intronic
1060545830 9:124458463-124458485 CCCTAAGGCAAGACTGAACCAGG + Intronic
1060729890 9:126030683-126030705 CCCCAAGGCAAAAGTGTTGCGGG - Intergenic
1062497542 9:136838799-136838821 CCCCACGGCCAGGGTGTGCTGGG + Intronic
1062539750 9:137036320-137036342 CCCCCAGGCAAGGCTGAGCCAGG + Exonic
1186329577 X:8517984-8518006 TCCCAAGGCAAGTATGTGCGTGG - Intergenic
1187127435 X:16467207-16467229 CCCCTTGGCATGACTGTGCCTGG - Intergenic
1187392031 X:18892363-18892385 CCCCAAGGTAAGACAATGCCCGG + Exonic
1189301848 X:39957990-39958012 CCCTGAGGCAGGAATGTGCCTGG + Intergenic
1189353089 X:40291762-40291784 CCCAAAAGCAAGAGAGAGCCAGG - Intergenic
1190118911 X:47644686-47644708 GCCCAAGGCTGGAGAGTGCCTGG + Intronic
1190262178 X:48804339-48804361 ACCAGAGGCAAGAGGGTGCCTGG - Intronic
1190738344 X:53270397-53270419 CCCCGAGGCAAGAGTGTGTTTGG - Intronic
1192084761 X:68085228-68085250 GCCCAAGGCAGCAGTGTGCTTGG - Intronic
1192157020 X:68754239-68754261 CCCTGAGGCAGGAGTATGCCTGG - Intergenic
1192174133 X:68875339-68875361 CGCTGAGGCAAGAGAGTGCCTGG + Intergenic
1193934602 X:87601279-87601301 CCCCAAGTCAAGAGTTGGACAGG - Intronic
1195345710 X:103949106-103949128 TCCTATGGCAAGAGTGAGCCCGG + Intronic
1196874498 X:120145447-120145469 CCCCAAGGCCACAATGTGCAGGG + Intergenic
1197694694 X:129538594-129538616 CCCTGAGGTAAGAGTGTGCCTGG + Intergenic
1198397203 X:136231969-136231991 CCCCAAGGCAGGTGTGGGCATGG - Exonic
1198985385 X:142446253-142446275 CCACAAGGCAGGAGCATGCCTGG - Intergenic
1200179249 X:154140485-154140507 CCCCAAGGAAAGAGGGCCCCTGG - Intergenic
1200709475 Y:6470614-6470636 CCTCAAATCAAGAGTTTGCCAGG + Intergenic
1200829706 Y:7678776-7678798 CCCCATGGCGAGTGTGTGGCAGG + Intergenic
1200921430 Y:8616856-8616878 CCTCAAATCAAGAGTTTGCCAGG - Intergenic
1201024637 Y:9694094-9694116 CCTCAAATCAAGAGTTTGCCAGG - Intergenic
1201315461 Y:12641396-12641418 CGCCAAGGCTAGAGTGTACGGGG + Intergenic
1201624735 Y:16002299-16002321 CCCCAAAGCAGGTGTGTGGCAGG + Intergenic
1201714089 Y:17024327-17024349 CCCCCAGGCATGGGTTTGCCAGG + Intergenic