ID: 1136096467

View in Genome Browser
Species Human (GRCh38)
Location 16:27960621-27960643
Sequence ATGGAGAAGCTGAGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 384}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136096460_1136096467 10 Left 1136096460 16:27960588-27960610 CCTCGTCTCTCTGCCCTCAGATT 0: 1
1: 0
2: 1
3: 26
4: 286
Right 1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG 0: 1
1: 0
2: 3
3: 41
4: 384
1136096459_1136096467 11 Left 1136096459 16:27960587-27960609 CCCTCGTCTCTCTGCCCTCAGAT 0: 1
1: 0
2: 3
3: 36
4: 322
Right 1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG 0: 1
1: 0
2: 3
3: 41
4: 384
1136096462_1136096467 -4 Left 1136096462 16:27960602-27960624 CCTCAGATTCCTCTGTGAAATGG 0: 1
1: 0
2: 8
3: 66
4: 420
Right 1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG 0: 1
1: 0
2: 3
3: 41
4: 384
1136096461_1136096467 -3 Left 1136096461 16:27960601-27960623 CCCTCAGATTCCTCTGTGAAATG 0: 1
1: 0
2: 3
3: 26
4: 286
Right 1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG 0: 1
1: 0
2: 3
3: 41
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136096467 Original CRISPR ATGGAGAAGCTGAGTGTGGT GGG Intronic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901114886 1:6835405-6835427 AAGGAGAAGCTGAGCCTGGTTGG + Intronic
901850067 1:12009388-12009410 GTGGTGATGCTGAGTGTGTTTGG + Intronic
902527149 1:17066588-17066610 ATGCAGTTGCTGAGTGTGTTGGG + Intergenic
902583339 1:17423104-17423126 AATGAGAGGCTCAGTGTGGTAGG + Intronic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902609707 1:17589796-17589818 GTGGAGAAACTCAGTCTGGTGGG + Intronic
902631912 1:17709839-17709861 ATGGAGGAGCTCAGAGGGGTGGG + Intergenic
905988335 1:42309264-42309286 GTGGAGGAGGTCAGTGTGGTTGG - Intronic
907622132 1:55992240-55992262 ATGTTGAAGGTGGGTGTGGTGGG - Intergenic
908587015 1:65580892-65580914 CTTGAAAAGTTGAGTGTGGTGGG + Intronic
908968173 1:69791892-69791914 ATTGAGAAGATGAGTATGGAGGG + Intronic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
909572715 1:77136076-77136098 ATGCAAAAGCTGAGAGTGTTTGG - Intronic
909683783 1:78322654-78322676 ATGGAGAAGCTGAGTTCAGTGGG - Intronic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
910352206 1:86310748-86310770 ATGGAGAAGCTAAGTATATTTGG + Intergenic
911584091 1:99670131-99670153 AAGGAGACCCTAAGTGTGGTTGG - Intronic
911635918 1:100236239-100236261 GTATAGAAGCTGGGTGTGGTGGG - Intronic
913082700 1:115403566-115403588 ATGGAGGAGCTCAGTCTGGAGGG - Intergenic
913317165 1:117563076-117563098 ATGAGGAAGCTGTGTGTGGGAGG - Intergenic
913514854 1:119596060-119596082 GGGGAGAATCTCAGTGTGGTGGG + Intergenic
915030629 1:152877796-152877818 GTGGAAAAGCTCAGTGTGGCTGG - Intergenic
915330054 1:155105816-155105838 ATGAAGAAGCCCAGTGTGGCTGG + Intergenic
917505241 1:175621409-175621431 AGTGAGTAGCTGAGTGTGGTGGG - Intronic
918120829 1:181538642-181538664 AAGGAGAAGGTGACTGTGTTTGG + Intronic
918133148 1:181646517-181646539 GTGGGGAGGCTGAGTGTGTTGGG - Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918645114 1:186895026-186895048 ATGGAGAAGCTGAGAGTTAAGGG - Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
921531714 1:216291029-216291051 TTGGAGAAGGTTAGAGTGGTTGG - Intronic
921750136 1:218782622-218782644 CTGCAGAAGCTGAGAGTTGTTGG + Intergenic
921797615 1:219365482-219365504 AAGGAGAACCTGAGTTTTGTGGG + Intergenic
921873295 1:220165599-220165621 ATGGTGGAGCTGAGACTGGTTGG + Intronic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923053923 1:230410923-230410945 AAAGAAAAGGTGAGTGTGGTGGG + Intronic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923809257 1:237294272-237294294 ATGGAGAGACTGACTGTGCTTGG + Intronic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
1062987805 10:1785625-1785647 ATGGAGCAGGTGAGTCTGCTCGG + Intergenic
1063427235 10:5959998-5960020 ATGGAGGAGCTGAGGGTAATGGG - Intronic
1063428005 10:5964835-5964857 ATGGGAAAGCTGAGCGTGGCGGG - Intronic
1064569867 10:16681683-16681705 ATGGGGAAGCTGAGGTGGGTGGG + Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1066095147 10:32065212-32065234 TTTGAGAAGCTGAGGCTGGTGGG - Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067554100 10:47255720-47255742 ATGGAAAAGCTGAGAGTCATGGG - Intergenic
1069412303 10:68166376-68166398 ATGGAGGCTCTGAGTGGGGTGGG - Exonic
1069961042 10:72079671-72079693 ATGGAGAAGCTGGGAGAGATTGG - Intronic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1071345709 10:84690194-84690216 CTGGAGAAGCTGAGCCTGCTGGG + Intergenic
1071416477 10:85446426-85446448 AATGAGCAGCCGAGTGTGGTGGG + Intergenic
1072971634 10:100022394-100022416 ATGGACAAAATGAGTCTGGTTGG - Intergenic
1073645129 10:105293838-105293860 ATGAAGAAGCTGGATATGGTAGG - Intergenic
1073906595 10:108287731-108287753 AGGAAGAAGCTGAGTGTTGGGGG + Intergenic
1074238941 10:111617118-111617140 ATGGAGAAGCTCAGTACAGTGGG - Intergenic
1075680384 10:124326969-124326991 AAGGAGAAGCTCACTCTGGTCGG - Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076734818 10:132453901-132453923 ATGGCTAAGCTGAGTGAGGCAGG + Intergenic
1076881731 10:133242678-133242700 ATGGGGATGTTGAGTGGGGTGGG - Intergenic
1077368910 11:2172537-2172559 ATAGAGGGGCTGAGTGGGGTGGG - Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1080317903 11:30970813-30970835 ATGCAGATGCTGGCTGTGGTAGG - Intronic
1080680510 11:34471064-34471086 ATGCAGAGGCTGTGTGTGCTGGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082892479 11:58154863-58154885 ATGGAAAAGCCCAGTGTAGTGGG - Intronic
1084876733 11:72138906-72138928 ATGGAGGAGATGGCTGTGGTGGG + Intronic
1085639812 11:78186416-78186438 CTGGAGAGGCTGTGTGGGGTAGG + Intronic
1085944697 11:81254197-81254219 ATGGAGAAAATGTGTGTGGTAGG + Intergenic
1087093418 11:94298412-94298434 AGGGAGTAGCTCAGTGTGGCTGG + Intergenic
1087257510 11:95973035-95973057 AGGAAGAAGGTGAGTGTGTTTGG + Intergenic
1088816079 11:113421927-113421949 AAGGTGAAGCTGAGTGTGTCAGG - Intronic
1089090424 11:115869878-115869900 ATGCAGATGCTGTCTGTGGTAGG + Intergenic
1089472811 11:118734444-118734466 ATGGAGATGCTGAGTGGGAAAGG + Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1090397599 11:126429450-126429472 ATGGAGATGCTGTGGGTGTTTGG + Intronic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1090978274 11:131694419-131694441 GTCTAGAAGCTGAGTCTGGTGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091661655 12:2388528-2388550 ATGAAGAATCTGAGAGAGGTAGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091728402 12:2861892-2861914 ATGTAGAGGCTGGGCGTGGTGGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093710191 12:22321202-22321224 ATGGTGAGGCTGAGAGGGGTGGG + Intronic
1094774918 12:33714601-33714623 ATGGAGAGGCTGACTGTATTTGG - Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095910780 12:47424499-47424521 ATGCAGATGCTGGCTGTGGTAGG - Intergenic
1096596337 12:52698175-52698197 ATGGATAAATTGAGTGTGGAGGG - Intronic
1096832485 12:54325164-54325186 ATGGAGGCGCTGATTTTGGTAGG + Exonic
1097053635 12:56237884-56237906 ATAGAAAACCAGAGTGTGGTGGG + Exonic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099148711 12:79081041-79081063 GTGCAGAGGCTGAGGGTGGTGGG + Intronic
1099498017 12:83376973-83376995 AAGGGGAAGCTTAGTTTGGTTGG + Intergenic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1101821205 12:108185499-108185521 AGGAGGAAGCTGTGTGTGGTAGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102535920 12:113581131-113581153 ATGGAGAACCTACTTGTGGTTGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1104377679 12:128279184-128279206 ATGGAGATAATGAGTGTGCTTGG - Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1105928329 13:25028679-25028701 ATGGAGGATCTGATAGTGGTAGG + Intergenic
1105942566 13:25162406-25162428 ATGGAGGATCTGATAGTGGTAGG - Intronic
1106645046 13:31625135-31625157 AGGAAGAACCTGTGTGTGGTTGG + Intergenic
1107244125 13:38272028-38272050 AAGGAGAATCTGTGTGTGGTGGG + Intergenic
1107400077 13:40060985-40061007 ATGGGGAAACTGAGTCTGGGAGG + Intergenic
1107461205 13:40605523-40605545 ATTGAGAAGTACAGTGTGGTTGG - Intronic
1107725297 13:43293026-43293048 ATGGTGAAGGTGGCTGTGGTGGG - Intronic
1112010940 13:95293380-95293402 ATGGAAAAGCTGTGTGAGGGTGG - Intronic
1112116568 13:96361733-96361755 ATGGAGAAACTGAGTTTTGTTGG - Intronic
1112879931 13:104094452-104094474 TTTGAGAAGCTAAGTGTGATGGG - Intergenic
1112879935 13:104094484-104094506 TTTGAGAAGCTAAGTGTGATGGG - Intergenic
1114183178 14:20382116-20382138 AAGGAGAGACTGGGTGTGGTGGG - Intronic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1116757965 14:48971670-48971692 ATAAAGAAGCTGAGTATGGGAGG + Intergenic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1117959966 14:61153140-61153162 ATGAAAAAGCTGTGTGTGGGAGG + Intergenic
1118242578 14:64074300-64074322 AGGGAGAAGATCAGTGTGGCTGG + Intronic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1119944503 14:78678433-78678455 CTGGAGTAGCTGGGTGTGGTGGG - Intronic
1120058658 14:79955444-79955466 ATGATGAAGCTTAGTGTGGCTGG - Intergenic
1120648479 14:87101950-87101972 CTGGAGAGTCTGAGTGAGGTGGG - Intergenic
1120743989 14:88137472-88137494 TTGGAGAGCCTGAGTGTGGAAGG - Intergenic
1121554406 14:94825367-94825389 ATGGGGAAGATGAATGGGGTGGG + Intergenic
1122388887 14:101367035-101367057 ATTGAGAAGCTGGGTGGTGTCGG + Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127462343 15:59211046-59211068 AAAAAGAAGCTGAGTGTGGTGGG + Intronic
1127490332 15:59456309-59456331 CTGGAGCAGGTGATTGTGGTAGG + Intronic
1131604391 15:93885748-93885770 ATGGACAAGCTGAGTTTGTAGGG + Intergenic
1132567855 16:631416-631438 AGGGACCAGGTGAGTGTGGTCGG + Exonic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1134491852 16:14701594-14701616 ATGGAGAGGCTGGGTGTGTGTGG + Intergenic
1134497233 16:14740712-14740734 ATGGAGAGGCTGGGTGTGTGTGG + Intronic
1135290682 16:21235333-21235355 CTAGAGAAGCTGAGTATGGCTGG + Intronic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136133439 16:28239578-28239600 AGGGAGATTCTCAGTGTGGTGGG + Intergenic
1138197035 16:55059440-55059462 ATCAAGAAGCCTAGTGTGGTTGG + Intergenic
1138958190 16:61996825-61996847 TTTGAGAGGCTGAGTGAGGTCGG - Intronic
1139685432 16:68599606-68599628 ATGGAGAAACTGAGTCCTGTGGG + Intergenic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1141444101 16:84047131-84047153 ATAGAGAAACTGCTTGTGGTCGG + Intergenic
1141463026 16:84189165-84189187 ATGTAGAATATTAGTGTGGTAGG - Intergenic
1141477466 16:84283517-84283539 ATGGAGAGGGTCAGTGTGCTGGG + Intergenic
1141690633 16:85594292-85594314 ATGGAGAAGCTGACCGCGGTGGG - Intergenic
1143035125 17:3990697-3990719 ATGAGAAAGCTGAGTGTGGGCGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1144154473 17:12485661-12485683 ATGGTGAAGCTGTGTCAGGTTGG - Intergenic
1145008487 17:19352454-19352476 ATGGGGAGGCTGAGTGAGGCAGG - Intronic
1145113915 17:20190568-20190590 ATGAGGAGGCTGAGTGTGTTTGG - Intronic
1145362423 17:22222900-22222922 ATGAATTAGCTGGGTGTGGTGGG + Intergenic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146730187 17:35186437-35186459 CTGGAGATCCTGACTGTGGTGGG + Exonic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG + Intronic
1148624985 17:49062411-49062433 AACTCGAAGCTGAGTGTGGTGGG + Intergenic
1149668947 17:58387975-58387997 ATGGAGGGGGTGTGTGTGGTGGG - Intronic
1150106783 17:62468010-62468032 ATGGAGAAACTGAGTCTTGGAGG - Intronic
1151216346 17:72579341-72579363 ATGAAGAAGGTGTGTGAGGTTGG - Intergenic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1152539681 17:80968677-80968699 AAGGAGATGCTCAGTGGGGTTGG + Intergenic
1154375084 18:13802471-13802493 ATGGAGAAGCTGAGGTTTGGTGG - Intergenic
1156233459 18:35178440-35178462 ATGGAGAGGCTTGGTGTTGTGGG - Intergenic
1156625433 18:38902260-38902282 ATTGAGAAACTGACAGTGGTAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1161852224 19:6743590-6743612 GTGGAGAAGGTGTGTGTGGCGGG + Exonic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1162567545 19:11452763-11452785 ATGGGGCCGCTGAGTGGGGTGGG + Exonic
1163204373 19:15791631-15791653 ATGGAACAGCTGTCTGTGGTGGG - Intergenic
1165207255 19:34200561-34200583 ATGGAGAAACAGAGTGGGTTTGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG + Intronic
1168080778 19:54008589-54008611 AGAGAAAAGCTGAGTGTGGTGGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925198577 2:1947756-1947778 TTGGAGAAGGTGAGTGTGTGTGG + Intronic
925224062 2:2167362-2167384 AAGGTGAAGGTGTGTGTGGTGGG - Intronic
925292345 2:2756154-2756176 AGGCAGAAGCTGAGGGTGGCAGG - Intergenic
925310795 2:2880168-2880190 ATGGAGCAGCTAAGATTGGTAGG - Intergenic
926072045 2:9904170-9904192 ATGGGTAAATTGAGTGTGGTGGG + Intronic
926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG + Exonic
926877471 2:17497814-17497836 AAGCAGAAGCAGAGTGTTGTAGG - Intergenic
926941144 2:18138375-18138397 ATGGAGCACCTGTGTGTGTTTGG - Intronic
927878105 2:26672347-26672369 ACGGAGAAACTGTGTGTGCTGGG - Intergenic
931796112 2:65711720-65711742 TTGGAGAAGCTGATTGGGTTGGG + Intergenic
933014407 2:77105983-77106005 AGGAAGAAGGTGAGTGTAGTTGG - Intronic
933689085 2:85165574-85165596 TTGGAGACGCTGAGGCTGGTTGG + Intronic
933765497 2:85705860-85705882 ATGGAAAACCTGAGTGTGCTTGG - Intergenic
935369705 2:102332423-102332445 ATGGATAAACAAAGTGTGGTAGG + Intronic
935707018 2:105865666-105865688 ACTGAGAAGCTGAGTGTCATAGG + Intronic
936662602 2:114559083-114559105 ATACCGAAGCTTAGTGTGGTGGG + Intronic
937820774 2:126308159-126308181 AAGGAGAGGCTGAGTTTGGCTGG - Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938607963 2:132915815-132915837 ATTAAGAAACTGAGTGTGGCTGG - Intronic
938945241 2:136206572-136206594 GTGGAGGAGCTGAGCATGGTAGG + Intergenic
939267057 2:139887835-139887857 TGGGAGAAGTTGAGTGTGATAGG + Intergenic
939892055 2:147747945-147747967 ATGAATAATCTGATTGTGGTGGG - Intergenic
939995576 2:148916111-148916133 ATGCAGGAGCTGACTGTGGGAGG + Intronic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
940905012 2:159161082-159161104 ATGGAGCAGCTGAGGATGGCTGG - Intronic
941678324 2:168367957-168367979 AGGGAGAGGCTGAGTGCTGTGGG + Intergenic
945543613 2:211121338-211121360 GTGGAGCAGATAAGTGTGGTAGG + Intergenic
946341459 2:219071866-219071888 ATAGAGAAACTGAGTGGGGTGGG + Intergenic
946448148 2:219757437-219757459 AGAGAGATGCAGAGTGTGGTGGG + Intergenic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169408249 20:5344217-5344239 ATGGGAAACCTGACTGTGGTGGG + Intergenic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1170937188 20:20820623-20820645 ATGTGGAAAGTGAGTGTGGTTGG + Intergenic
1171112893 20:22500611-22500633 AGAGACAAGCAGAGTGTGGTGGG - Intergenic
1172012781 20:31856116-31856138 ATGGTTAAGCTGAGGATGGTGGG + Intronic
1172013070 20:31857708-31857730 ATGGTTAAGCTGAGGATGGTGGG - Intronic
1172027753 20:31960642-31960664 ATGGAGAGGCTATGGGTGGTGGG + Intergenic
1173304617 20:41836347-41836369 ATCGTGAAGCCCAGTGTGGTGGG - Intergenic
1174276334 20:49407295-49407317 ATGGGGAAACTGAGACTGGTGGG + Intronic
1174881986 20:54289858-54289880 ATGGAGAAACTGCGTGTGATTGG - Intergenic
1176304025 21:5114144-5114166 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304038 21:5114184-5114206 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176304063 21:5114264-5114286 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304076 21:5114304-5114326 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304088 21:5114344-5114366 GTGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1177763513 21:25430277-25430299 CTGGAGAAGGTAATTGTGGTGGG - Intergenic
1178752301 21:35316583-35316605 GTGGAGGAGCTGACTTTGGTTGG + Intronic
1179852968 21:44147686-44147708 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179852981 21:44147726-44147748 GTGGAGCAGCTGGGAGTGGTGGG - Intergenic
1179852993 21:44147766-44147788 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179853006 21:44147806-44147828 GTGGAGGAGCTGGGAGTGGTAGG - Intergenic
1180020358 21:45120691-45120713 GTGGAGAAGCTGTGTGTGCTGGG + Intronic
1180077017 21:45468127-45468149 AAGGAGAAACTGAGTCTGGGAGG - Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180715866 22:17871923-17871945 ATGGAGAGGCTGAGTGCCGAGGG - Exonic
1181478611 22:23183334-23183356 ATGGAGGAGTTGAATGTGCTTGG + Intronic
1182619093 22:31608665-31608687 ATGGAGGAGCTTGGGGTGGTTGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183027213 22:35074313-35074335 CTGGAGCAGCTGTGTGTGCTTGG + Intronic
1183117950 22:35706378-35706400 TTGAAGAGGCTGGGTGTGGTGGG - Intergenic
1183356370 22:37361978-37362000 AAGGAGTAGCTGCGTGTGGGAGG - Intergenic
1183861458 22:40673378-40673400 GGGGAGATGCTCAGTGTGGTGGG + Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184505596 22:44899574-44899596 AAGAAGAGGCTGGGTGTGGTAGG - Intronic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950155042 3:10715690-10715712 ATGCTGGAGCTGAGTGTGGTGGG + Intergenic
951735105 3:25854888-25854910 ATGAAGAAGCTGAGAGTAGGAGG + Intergenic
952756686 3:36875047-36875069 ATCGAGAATCTCACTGTGGTAGG + Intronic
953538005 3:43790465-43790487 GTGGGGAAGAAGAGTGTGGTGGG - Intergenic
954395693 3:50292203-50292225 GTGGAGGAGGTGAGTGGGGTGGG - Exonic
954692697 3:52404161-52404183 ATGGAGGAGATGTGGGTGGTGGG - Intronic
960619049 3:119621728-119621750 ATGGAGAGGCTCAGTGTCTTAGG + Intronic
965275746 3:166679634-166679656 ATGGAGAAGGACGGTGTGGTTGG - Intergenic
967031848 3:185615299-185615321 ATGGTGAAGCTGTGTGCAGTGGG + Intronic
968516323 4:1017126-1017148 CTGGAGAAGCTGAGTGGCCTGGG - Intronic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969537363 4:7764857-7764879 TTGGAGAGGCTGAGTGAGGTGGG + Intronic
971370830 4:26017457-26017479 ATGGAGAAGTTGGTTGGGGTTGG - Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971703720 4:30012903-30012925 ATGCAGAAGCTGGCTGTAGTAGG + Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
974067067 4:57088455-57088477 AAGCAGAAACTGAGAGTGGTAGG - Intronic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
974704841 4:65499698-65499720 ATGGAGACAATGAGTATGGTAGG - Intronic
974994171 4:69131968-69131990 ATGGAGTCACTGAGTGTGATAGG - Intronic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
976569300 4:86590495-86590517 CTGGATAGGCTGGGTGTGGTGGG + Intronic
976600039 4:86929638-86929660 ATCTAGAAGGAGAGTGTGGTAGG - Intronic
977063423 4:92284223-92284245 ATGGAGAAGTAGGGGGTGGTAGG - Intergenic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
978937417 4:114395010-114395032 CTGGAGAAGCTGTGTCTGGATGG - Intergenic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
980552340 4:134355513-134355535 ATGGAGGAGCTGAGAGTCGATGG + Intergenic
981483030 4:145257052-145257074 ATGGAGAATCTGTTTGTAGTTGG + Intergenic
981678504 4:147366844-147366866 ATGGAGAAGGTGAGAGATGTAGG + Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985808607 5:2067038-2067060 CTGCAGAAGGTGAGTGAGGTCGG + Intergenic
985887871 5:2694222-2694244 CTGGAGAAACTGAGTTTGTTTGG + Intergenic
986688640 5:10295814-10295836 AATGAGAAGCAGAGTGTTGTGGG - Intronic
987046460 5:14113634-14113656 ATTACGAAGCTGAGTGTGGCAGG - Intergenic
988777964 5:34494223-34494245 AGGGAGGAGCTGAGAGAGGTGGG + Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
989305176 5:39946877-39946899 AAGGAGAAGCTGAGTTTGAGAGG - Intergenic
992110462 5:73487817-73487839 ATGGTGAAGCTGTGTCTTGTGGG - Intergenic
992202925 5:74401734-74401756 ATGGGGAAGCTGAGTCAGGGAGG - Intergenic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
992896897 5:81253438-81253460 ATGCAGAAGCACAGGGTGGTCGG + Intronic
993251561 5:85531322-85531344 CTGGAGAGGCTGAGTGGGGGAGG - Intergenic
997385025 5:133465629-133465651 ATGGAGGAGCACAGTGGGGTTGG + Intronic
998830492 5:146152586-146152608 ATGGACCAGCAGGGTGTGGTAGG - Intronic
999142109 5:149369231-149369253 TTGGAGGAGATGACTGTGGTAGG + Exonic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
1000951182 5:167485202-167485224 AGGGAGAAGCTCAGAGTGCTGGG + Intronic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001567080 5:172706819-172706841 CTGGAGCAGCTGAGTGTTGCTGG - Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1004862454 6:19819033-19819055 CTAGAGAAGCTCACTGTGGTAGG + Intergenic
1005107185 6:22236375-22236397 ATGAGGAGGCTGAGTGTGCTAGG - Intergenic
1005742354 6:28803852-28803874 ATGGAGAAGATGAGTTAGTTTGG + Intergenic
1005743918 6:28818178-28818200 ATGGAGAAGATGAGTTAGTTTGG + Intergenic
1006756080 6:36416812-36416834 ATGGAAGAGCTGACTGTGGCTGG + Intronic
1007067221 6:39003085-39003107 ATGAAAAAGCTGCGTGTGGTGGG - Intronic
1008893582 6:56525122-56525144 CTTGAGAAGTTGACTGTGGTTGG - Intronic
1011217692 6:85022421-85022443 TGGGAGAAGCTGAATCTGGTGGG + Intergenic
1012442150 6:99270622-99270644 AGGGAGGGGCTGAGTGTGGGAGG - Intergenic
1013971798 6:116029026-116029048 ATGGAGGAGCTTGGTGTGGCTGG - Intronic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1016436695 6:144045440-144045462 ATGAAGAAGCTTAGTTTGGCTGG + Intronic
1016524886 6:144990455-144990477 GTGGAGAAGCTGGGTGTAGGAGG + Intergenic
1016983937 6:149880094-149880116 ATGGACAAGCTTATTGTGGATGG + Intergenic
1017518690 6:155182167-155182189 TTGGAGAAATTCAGTGTGGTGGG + Intronic
1017983750 6:159424809-159424831 ATGGAGAAGATGAGGCTGTTTGG - Intergenic
1018008249 6:159643293-159643315 ATCCAGCAGCTCAGTGTGGTTGG - Intergenic
1018054028 6:160036241-160036263 ATGGAGAAGCTGAGGGGTGCAGG - Intronic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018672308 6:166189760-166189782 TTGGAGCAGCTGAGTGAGGGAGG - Intergenic
1018828018 6:167422828-167422850 AGGGAGACGCCGTGTGTGGTGGG - Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019373184 7:674209-674231 TTGGAGTAGCTGGGTGTGGCTGG - Intronic
1019758342 7:2789719-2789741 AGGGAGATGCTGTGCGTGGTTGG - Intronic
1021930272 7:25574067-25574089 ATGGAGAAGCTGAAAATTGTGGG + Intergenic
1022190275 7:28010697-28010719 TTGGAGAAGCTGAGTCTGTTGGG - Intronic
1022400973 7:30037004-30037026 CTAGAGAAGCTGAGTGGGGGAGG + Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1026176363 7:68001288-68001310 ATTGGGAGGCTGAGTGAGGTGGG + Intergenic
1026997101 7:74624637-74624659 AAAAAGAGGCTGAGTGTGGTGGG + Intergenic
1027065095 7:75117519-75117541 ACTGGGAAGCTGTGTGTGGTGGG - Intronic
1027139654 7:75648158-75648180 TTGGAGTAGCTGAGGCTGGTTGG + Intronic
1027139689 7:75648349-75648371 TTGGAGTAGCTGGGTCTGGTTGG + Intronic
1028073992 7:86488047-86488069 AAGGAGACACTGACTGTGGTTGG - Intergenic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1031287257 7:119885839-119885861 GTGGAGAATCTGTGTGTGGGGGG + Intergenic
1032035828 7:128520552-128520574 ATGGAGAAACTGAGTCTTGGAGG - Intergenic
1034353438 7:150432299-150432321 ATGGAGAAACACAGTCTGGTGGG + Intergenic
1034491471 7:151395304-151395326 ATTCAGAAGCTGAGTGTTATGGG + Intronic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1034907026 7:154958260-154958282 ATGGAGATGCTGACTGTGGTAGG - Intronic
1035342696 7:158174326-158174348 ATGGTGAAGATGATGGTGGTGGG - Intronic
1035644063 8:1205054-1205076 ATGGGGAACCGGAATGTGGTTGG + Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037610108 8:20468935-20468957 ATGGAGAGGCTGAGTGTAAAAGG - Intergenic
1038252146 8:25914977-25914999 TTTGAGAAGTTGAGTGTAGTTGG - Intronic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038613780 8:29075267-29075289 ATGGAGGAGGTGAGTCTGTTGGG - Exonic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039641790 8:39230935-39230957 TTGGAGAAGGTAACTGTGGTAGG + Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040897540 8:52384436-52384458 ATGGAGAGGATGAGTGAAGTGGG - Intronic
1042601858 8:70506633-70506655 ATGGAGGAGTTAAGGGTGGTTGG - Intergenic
1043251823 8:78084297-78084319 ATGAAGAAGCTGTTTGTTGTGGG - Intergenic
1044564829 8:93651760-93651782 ATGGGTAATCTAAGTGTGGTAGG - Intergenic
1045066919 8:98456487-98456509 ATAAAGAAGATGACTGTGGTAGG + Intronic
1045492337 8:102679625-102679647 ATGAGGGAGCTGGGTGTGGTTGG - Intergenic
1045539241 8:103066850-103066872 ATGGCGTAGCTGGGCGTGGTGGG + Intronic
1045871042 8:106927410-106927432 ATGGAGCATCCAAGTGTGGTAGG + Intergenic
1046719667 8:117605234-117605256 TTGGAGTAGCTGAGCATGGTGGG - Intergenic
1047714743 8:127585198-127585220 AGAGAGAAGCTCAGTGTGGCTGG - Intergenic
1048841486 8:138570437-138570459 CTGGAGAGGCAGAGTGTGCTGGG - Intergenic
1048982603 8:139711041-139711063 ATGGAGAAGCTGGGGATGCTGGG - Intergenic
1049025070 8:139982879-139982901 ATGGTGGAGGGGAGTGTGGTGGG - Intronic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049542389 8:143214530-143214552 AGGGAGGGGCTGTGTGTGGTGGG - Intergenic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1052708325 9:32020771-32020793 AGGGAGAATCTATGTGTGGTAGG + Intergenic
1055481984 9:76717686-76717708 ATGCAGAAGGTGTGTGTGGCTGG - Intronic
1055592293 9:77829687-77829709 ATGCAGAAGCTGCTTGTGGGTGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058070047 9:100592436-100592458 ATGGAGAAGCTAGGTTCGGTGGG - Intergenic
1058447200 9:105064618-105064640 CTGGAGACAGTGAGTGTGGTTGG + Intergenic
1058666061 9:107317012-107317034 ACCGGGAAGATGAGTGTGGTGGG + Intronic
1058986496 9:110212787-110212809 ATGCAGAAGCTGTTTGTGGCTGG - Intergenic
1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG + Intronic
1060316486 9:122516259-122516281 ATCAAGAGGCTGAATGTGGTGGG + Intergenic
1060402164 9:123355550-123355572 TGGGAGGAGCTGTGTGTGGTCGG + Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203361215 Un_KI270442v1:220423-220445 ATGGAGCAGCTCAGTGCGGTGGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1186500401 X:10046084-10046106 CTGGAGAGGCTCAGTGTGGATGG + Intronic
1187282461 X:17868241-17868263 ATGGACACGCTGAGGGTGGTAGG - Intergenic
1187567306 X:20464074-20464096 ACTGAGAAGCTTAATGTGGTTGG + Intergenic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1189237833 X:39501872-39501894 AGGCAGAAGGGGAGTGTGGTGGG + Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1192449558 X:71235424-71235446 GTGGAAAGGCTGAGGGTGGTGGG - Intergenic
1194936133 X:99951184-99951206 ATGTAGCAGCTAAGTGTGGGAGG - Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1197309262 X:124883944-124883966 ATGCAGGTGCTGACTGTGGTCGG + Intronic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1199397685 X:147358823-147358845 GAGGAGAAGATGAGTGTGTTTGG - Intergenic