ID: 1136101218

View in Genome Browser
Species Human (GRCh38)
Location 16:27997782-27997804
Sequence GGACACTGCTTGGGTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136101218 Original CRISPR GGACACTGCTTGGGTAATGG GGG (reversed) Intronic
900325725 1:2107866-2107888 GGACACTGCCGGGGTGTTGGGGG - Intronic
902678217 1:18023810-18023832 GTACACTGCTTAAGTGATGGGGG + Intergenic
902751907 1:18521649-18521671 GTACACTGCTTTGGTGATGGGGG - Intergenic
903919128 1:26787306-26787328 AGAAACTGCTTGGGTGAGGGAGG + Intergenic
905304858 1:37010582-37010604 GGAGACTGCTGGGGTAATCCTGG - Intronic
905882505 1:41473996-41474018 TGAGACTCCTTGGGTAATGTTGG + Intergenic
906104229 1:43282427-43282449 GGAAACTGCATGGGAAGTGGTGG + Exonic
906569123 1:46821076-46821098 GGGCAGTGTTTGGGTCATGGGGG + Intergenic
910157859 1:84240657-84240679 GTACACCGCTTGGGTGATGAGGG - Intergenic
910708044 1:90150586-90150608 GTACACTGCTTGGGTGATGGTGG - Intergenic
912299912 1:108504179-108504201 GGCCACTGGTAGAGTAATGGTGG - Intergenic
915848131 1:159290406-159290428 TGACACTGCTAGGGTACTGATGG - Intronic
916021866 1:160799564-160799586 AGACAGTGTTTGGGGAATGGAGG + Intronic
917448460 1:175126688-175126710 GGAACCTGCCTGGGAAATGGGGG + Intronic
917907447 1:179601358-179601380 GTATACTGCTTGGGTGATGGGGG - Intronic
920194094 1:204214509-204214531 GGACGCCGCTTGGGGAAAGGAGG - Intergenic
921665687 1:217868162-217868184 GAACACTGATTGGATATTGGTGG + Exonic
921828696 1:219702844-219702866 GGAAAATGCATGGGTAAGGGAGG - Intronic
1063675881 10:8140560-8140582 GGACACTCCTGGGGAAATGTGGG + Intergenic
1064335177 10:14433889-14433911 GGGAAGTGCTTGGGTCATGGGGG + Intronic
1069837399 10:71318132-71318154 GGCCAGTGTTTGGGGAATGGTGG + Intergenic
1071017754 10:81018487-81018509 GGAAGGTGCTTGGGTCATGGGGG + Intergenic
1072868342 10:99088300-99088322 GTATACTGCTTGGTTGATGGGGG - Intronic
1074445310 10:113516653-113516675 GTACACTACTCAGGTAATGGGGG + Intergenic
1075067203 10:119297105-119297127 GGACACTGCATGGAGACTGGAGG + Intronic
1075573128 10:123559446-123559468 GGACACAGCCTGGGTATTGTGGG - Intergenic
1076411606 10:130255338-130255360 GGTCACTGATTGGGTGAGGGAGG + Intergenic
1076704489 10:132293785-132293807 AGCCACTGCCTGGGGAATGGGGG + Intronic
1077899764 11:6478955-6478977 GTGCACTGATTGGGAAATGGGGG + Exonic
1078826601 11:14935884-14935906 GGACAGTGCTTGGGCAACAGAGG + Intronic
1079145738 11:17850197-17850219 GGAAGCTGATTGGGTCATGGGGG - Intronic
1079553219 11:21727137-21727159 GGAAGGTGTTTGGGTAATGGGGG + Intergenic
1079833113 11:25295926-25295948 GGACAATGCCTGGTTGATGGTGG - Intergenic
1080907352 11:36560284-36560306 GATCAGTCCTTGGGTAATGGGGG + Intronic
1081599114 11:44480148-44480170 GGGCATTGCTTGAGGAATGGGGG + Intergenic
1083289379 11:61681172-61681194 GGACACTGCCTCTGTCATGGGGG + Intronic
1085345095 11:75763510-75763532 GGACACTGCAGGTGCAATGGGGG - Intronic
1086171719 11:83843709-83843731 GTTCCTTGCTTGGGTAATGGAGG + Intronic
1086767417 11:90714883-90714905 GGAAAGTGATTGGATAATGGGGG + Intergenic
1088554425 11:111047598-111047620 GGGCAGTGCTTGGGTCATGGGGG - Intergenic
1089169680 11:116503286-116503308 GAACTCTGGTTTGGTAATGGTGG - Intergenic
1089622123 11:119728340-119728362 GGTCACGGCTTGGGTAAAGGGGG - Intronic
1091220944 11:133929753-133929775 GGACACTGCCCGGGGCATGGGGG + Exonic
1091486793 12:897290-897312 GAACATGGCTTGGGTAATGCAGG + Intronic
1091496513 12:977722-977744 GAACACTGCTTTGGGAATGTTGG + Intronic
1094304703 12:29005786-29005808 GGAAAGTGTTTGGGTCATGGAGG + Intergenic
1094470324 12:30796413-30796435 GGACACTGCTTGGGCCATGCGGG - Intergenic
1096145497 12:49276077-49276099 GCACCCTGCTTGGGAAATGCTGG - Intergenic
1096656623 12:53096570-53096592 GGACACTGCCTGGGGAAGGCGGG + Intergenic
1096792025 12:54051448-54051470 GGCTACTGCTTGGTTAATAGTGG - Intronic
1097832859 12:64243980-64244002 GGTCACAGCGTGTGTAATGGAGG + Intergenic
1098647906 12:72928030-72928052 GTACATTGTTTGGGCAATGGAGG - Intergenic
1104809029 12:131609439-131609461 GGACACCCCTTGGGTGACGGGGG - Intergenic
1107048406 13:36019932-36019954 GGAAAGTGTTTGGGTCATGGGGG + Intronic
1107178436 13:37427220-37427242 GTACACTGCTCAGGTGATGGGGG + Intergenic
1109144890 13:58767091-58767113 GGACACTGTTTTGATAGTGGTGG + Intergenic
1109168868 13:59071460-59071482 GGACACTGCTGGGGGAATTAGGG - Intergenic
1109181114 13:59215154-59215176 GTTCACTGCCTGGGTGATGGGGG - Intergenic
1109319579 13:60793287-60793309 GGATACTGCTGGGATAATGGAGG + Intergenic
1112928813 13:104710780-104710802 ATACACTACTTGGGTGATGGGGG + Intergenic
1113661419 13:112108474-112108496 GGACAGTGCCTGGCTAATTGTGG + Intergenic
1114760667 14:25310210-25310232 ATGCACTGCTTGGGTGATGGTGG + Intergenic
1115825307 14:37265320-37265342 GGACTATGCTTGGGCTATGGAGG - Intronic
1116303323 14:43215649-43215671 GGAAGGTGTTTGGGTAATGGGGG + Intergenic
1118276969 14:64394055-64394077 GCACAGTGCAGGGGTAATGGGGG - Intronic
1121924606 14:97916162-97916184 CCACAGTGCTTGGGTGATGGAGG + Intergenic
1122082083 14:99273404-99273426 GGCCACAGCCTGGGGAATGGGGG - Intergenic
1122375271 14:101253035-101253057 GGTCACTGCATGGGTAAAGTTGG + Intergenic
1122717237 14:103703029-103703051 GAACACAGCATGGGTCATGGGGG - Intronic
1124117055 15:26854523-26854545 GGGCAGTGTTTGGGTTATGGGGG + Intronic
1126964238 15:54033035-54033057 GTATGCTGCTTGGGTGATGGGGG + Intronic
1127504193 15:59582311-59582333 GGGCACTGACTGGGTAAAGGAGG - Intergenic
1132111158 15:99103170-99103192 GGACAATGATGGGGTGATGGGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135917373 16:26617143-26617165 GTATACTGCTTGGGTGATGGGGG - Intergenic
1136101218 16:27997782-27997804 GGACACTGCTTGGGTAATGGGGG - Intronic
1138142658 16:54582253-54582275 GGCCAGTCCTTGGGTAAGGGTGG + Intergenic
1139206197 16:65031312-65031334 GGTCACTGATAGGCTAATGGTGG + Intronic
1141177771 16:81732032-81732054 GGACACTGCTTGGCACAAGGAGG - Intergenic
1141420038 16:83908717-83908739 GGACACTCCTTGGCGAGTGGAGG + Intronic
1142073647 16:88104901-88104923 GGACACTTCTTGGGTATTAAGGG + Intronic
1145947678 17:28789526-28789548 GGACACTGAGTTGGTAAGGGAGG - Intronic
1146124121 17:30218660-30218682 GGAGACTGCTTGAGTAATTAAGG - Intronic
1146482926 17:33219613-33219635 GGACACAGTTTGGGAAATGCAGG - Intronic
1146521452 17:33528590-33528612 GAATAATGCTTGGGTAAAGGTGG + Intronic
1146557073 17:33834836-33834858 GGACACTGCCTGGGCATAGGAGG - Intronic
1147549023 17:41425222-41425244 GCACACTGCCTGAGTTATGGGGG - Intergenic
1148480918 17:47958911-47958933 GCACACAGCTTGGCCAATGGTGG - Intergenic
1148763630 17:50022786-50022808 GGACAATGCTCTGGGAATGGGGG - Intergenic
1148868408 17:50641274-50641296 GGAAACTGTGTGGGTGATGGTGG + Intronic
1149084370 17:52696798-52696820 GGAGACCGGTGGGGTAATGGAGG - Intergenic
1152135802 17:78502713-78502735 GCTCACTGCGTGGGCAATGGGGG - Intronic
1156066763 18:33151140-33151162 GTACACTGCTTGGGTGATTTTGG + Intronic
1157912043 18:51625408-51625430 GGGCACTGCCTGGTTAATGCTGG + Intergenic
1158910954 18:62061929-62061951 GGAAAAGGCTTGGATAATGGTGG - Intronic
1159021459 18:63146357-63146379 GGACACTGATGGGGAAATGGCGG + Intronic
1159257115 18:65961128-65961150 GAACAATGCTGGGGTAAAGGAGG + Intergenic
1159787875 18:72736957-72736979 GTACACTGCTCGGGAGATGGAGG - Intergenic
1160929421 19:1563176-1563198 GGACAGTGCTGGGGTGTTGGTGG - Intronic
1161420051 19:4171638-4171660 GAACACTGATTGGGGAAGGGGGG - Exonic
1164763331 19:30744373-30744395 GTACACTGCTTGGGTGACGACGG - Intergenic
1167411959 19:49349512-49349534 GGGAAGTGCTTGGGTCATGGGGG + Intronic
1168228473 19:55013540-55013562 GCACACAGCTTGGGTGAAGGGGG - Intergenic
926197380 2:10772099-10772121 GGACAGTGGTTGGGTGATGGTGG + Intronic
927240520 2:20916357-20916379 GGACCCTGCTAGAGTAATGGAGG - Intergenic
927722707 2:25396609-25396631 GTACACTGCTTGGGTGACGGGGG + Intronic
928843699 2:35642929-35642951 ATACACTGCTTGTGTAATCGTGG - Intergenic
929547155 2:42863159-42863181 AGACACTGCTTTGGAGATGGAGG + Intergenic
929556150 2:42926831-42926853 GGACACAGCTGGGGTTTTGGCGG - Intergenic
930612484 2:53558489-53558511 GGGAAGTGCTTGGGTATTGGGGG - Intronic
931526454 2:63160532-63160554 GGCCACTGTTTGGGTAGTAGGGG - Intronic
931650878 2:64467682-64467704 ACACACTGCTTGGGAAATGCAGG - Intergenic
932451734 2:71814939-71814961 GGACAGTGCTTGGGTAAAAGAGG + Intergenic
933097814 2:78209763-78209785 GGAGATTGTTTGGGTCATGGAGG - Intergenic
934578996 2:95423275-95423297 GTACACTCCTTGGGTAATGGGGG + Intergenic
934600451 2:95653428-95653450 GTACACTCCTTGGGTAATGGGGG - Intergenic
935264551 2:101383363-101383385 GCACACTGCTTGGTGAGTGGTGG + Intronic
936026948 2:109039075-109039097 GGATTCTGCTTGCCTAATGGAGG - Intergenic
940436855 2:153666109-153666131 GCACCCTGGTTGGGTAATGAAGG - Intergenic
941827545 2:169916894-169916916 GGCAACTGCTGGGGTAATTGAGG - Intronic
942184367 2:173410580-173410602 GGAGAATGCTTGGGAAATAGTGG - Intergenic
946622807 2:221576997-221577019 GTATACTGCTCGGGTGATGGGGG - Intergenic
1169416590 20:5422418-5422440 GTACACTATTTGGGTGATGGGGG + Intergenic
1172793817 20:37523767-37523789 GCACACTGCTTGGGGGAGGGAGG + Intronic
1175026463 20:55907698-55907720 GCACACAGCTTGGGTAACAGAGG + Intergenic
1175260492 20:57670910-57670932 GGACACTGGTTGGGGGTTGGGGG - Intronic
1177088894 21:16741502-16741524 GGACAGTGCATGGGGAATGTGGG + Intergenic
1177720655 21:24902705-24902727 GGACACTGCTCTGGTTATGATGG - Intergenic
1179000669 21:37455096-37455118 GGACAATTCTTGGGAGATGGGGG + Intronic
1181634894 22:24169953-24169975 AGACACAGCCTGGGTTATGGGGG + Intronic
1181931365 22:26404180-26404202 GGAAAATGCTTGAGAAATGGAGG + Intergenic
1183159960 22:36106242-36106264 GAACACTGCCTGGCTCATGGTGG - Intergenic
1184287959 22:43482650-43482672 GCACACTGCTTGGCACATGGTGG + Intronic
1184633708 22:45807784-45807806 GGTCACTGCTTGGCTGGTGGTGG + Intronic
949274671 3:2264952-2264974 GTACACTGCCTGGGTGATGGGGG - Intronic
950443957 3:13025483-13025505 GGACCCTGCTTGGGGAAATGAGG + Intronic
951363478 3:21751672-21751694 GACCACTGCTAGGGTAATAGAGG + Intronic
951619053 3:24580762-24580784 GAACACTGCTTGGGAGATGATGG - Intergenic
952037018 3:29214962-29214984 GGATAGTGCTTGGGTATTCGAGG + Intergenic
952121243 3:30247017-30247039 GGACGCTGCATGGGTTTTGGAGG - Intergenic
953507688 3:43502315-43502337 GGACAGTGTTTGGGTCATGGGGG + Intronic
953822539 3:46220902-46220924 GTACACTGCTTAGGTGATGGGGG + Intronic
955797882 3:62656642-62656664 GCACATTGTCTGGGTAATGGTGG - Intronic
956480389 3:69668246-69668268 GTACAATGCTTTGTTAATGGAGG + Intergenic
956748062 3:72325111-72325133 GGAAACTGCTGTGGTAATGCAGG + Intergenic
959530482 3:107430279-107430301 TGACACTGCTTCGGTGAAGGCGG + Intergenic
961362360 3:126376005-126376027 GGCCCCTGCTGGGGGAATGGCGG - Intergenic
963766660 3:149343290-149343312 GGAAACTGGTTGGGCCATGGTGG + Intergenic
965708227 3:171531183-171531205 GAACACAGAATGGGTAATGGAGG - Intergenic
967294817 3:187954634-187954656 AGAACCTGCTTGGGAAATGGGGG + Intergenic
969535518 4:7754381-7754403 GGACACTGCCCGTGAAATGGGGG - Intergenic
970955082 4:21801547-21801569 GAACACTGCTTGGAAAATGGTGG + Intronic
971062687 4:22990382-22990404 TGCAACTGCTTTGGTAATGGAGG + Intergenic
972407414 4:38760219-38760241 GTACACTGGTTGGGTTATGAGGG - Intergenic
975670457 4:76775047-76775069 GTACAGTGCTCGGGTGATGGAGG - Intronic
976676268 4:87707246-87707268 GGCCACAGCTTGGGGAAAGGGGG + Intergenic
976876037 4:89854779-89854801 GGAAGGTGTTTGGGTAATGGGGG - Intergenic
977975626 4:103262943-103262965 GTACACTGCTCGGGTGATGGAGG - Intergenic
978201148 4:106024688-106024710 GTATACTGCTTGGGTGATGGAGG - Intergenic
978266931 4:106838621-106838643 GGAAGCTGATTGGGTCATGGGGG - Intergenic
979129643 4:117026325-117026347 GGACAGTACTGGGGGAATGGTGG + Intergenic
982672745 4:158341381-158341403 AGACACAGCTTGGGTAACAGTGG + Intronic
982757060 4:159233671-159233693 GTATACTGCTTGGATGATGGGGG + Intronic
983662526 4:170144253-170144275 GTATACTGCTCGGGTGATGGGGG - Intergenic
984389634 4:179112156-179112178 GGGAAGTGTTTGGGTAATGGGGG - Intergenic
989115455 5:37948349-37948371 AGACAATGCTTGGGTTACGGTGG + Intergenic
989223384 5:38995466-38995488 GTACACTGCTTGGGTGACAGGGG + Intronic
989644711 5:43618512-43618534 GGGTAGTGCTTAGGTAATGGGGG - Intronic
990127823 5:52539927-52539949 GTACACTGCTCAGGTGATGGGGG + Intergenic
991488542 5:67163186-67163208 GGACCCTGCTGGGGAATTGGGGG - Exonic
993607193 5:90006263-90006285 GTACATTGCTTGAGTGATGGGGG + Intergenic
995444665 5:112229502-112229524 GTACACTGCTTGGGTGATGAGGG - Intronic
997431679 5:133845192-133845214 TGACACTGCTGGGGTTATTGTGG + Intergenic
998072074 5:139205745-139205767 TGACAGTGTTTGGGTCATGGGGG + Intronic
1001743832 5:174074766-174074788 GGACACTGCATGGGCAATGCTGG - Intronic
1004227111 6:13795784-13795806 GTACGCTGCTAGGGTGATGGGGG + Intronic
1005522682 6:26614165-26614187 GGACAGAGCTTGGGTACAGGGGG + Intergenic
1005919090 6:30382723-30382745 GGAAGCTGTTTGGGTCATGGGGG - Intergenic
1007215138 6:40231223-40231245 GGGAAGTGCTTGAGTAATGGGGG - Intergenic
1007800311 6:44386805-44386827 GGAGACTGCATGAGTAATTGGGG + Intergenic
1007899178 6:45394298-45394320 GGAAAGTGTTTGGGTCATGGGGG - Intronic
1008034664 6:46733690-46733712 GGAATCTGCCTGGGTGATGGAGG + Intronic
1008552480 6:52646441-52646463 AGACACAGCCTGGGCAATGGAGG + Intergenic
1009867580 6:69416484-69416506 GTATACTGCTTGGGTGATGGGGG + Intergenic
1010366501 6:75058256-75058278 GGACCCTGATTGGATCATGGGGG - Intergenic
1010528772 6:76941310-76941332 GGCCACTGCTGGGGTAGGGGAGG - Intergenic
1010568719 6:77451762-77451784 GGACAGTGTTTGGGTTATTGTGG + Intergenic
1011502554 6:88006952-88006974 AGCCAATGCTTGGGAAATGGGGG + Intergenic
1013930776 6:115529843-115529865 GTACACTGCTCGGGTGAAGGAGG - Intergenic
1017563661 6:155661049-155661071 GGAGACTGCTTGGATAGTGTGGG - Intergenic
1018636013 6:165860090-165860112 GTATACTGCTTGGGTGATGGGGG + Intronic
1018744692 6:166752839-166752861 GGATACTCTTGGGGTAATGGTGG + Intronic
1022941955 7:35249886-35249908 GGACACTCCCTGGGTAGTTGAGG - Intronic
1023537418 7:41228114-41228136 GTACACTGCTCGGGTGATGAGGG - Intergenic
1024822531 7:53350109-53350131 GAACACATCTTGGGTAATGAAGG + Intergenic
1025867302 7:65395559-65395581 GGAAGGTGCTTGGGTCATGGGGG + Intronic
1026023770 7:66729671-66729693 GGAGACTGGATGGGTGATGGTGG - Intronic
1026258773 7:68736062-68736084 GGAAAGTGTTTGGGTCATGGGGG + Intergenic
1026678456 7:72447548-72447570 GGACACTGCCTGGGGAAAGTGGG + Intergenic
1028607606 7:92672037-92672059 GTACACTACCTGGGTGATGGGGG + Intronic
1028646804 7:93107587-93107609 GGAGACAGCCTGGGGAATGGTGG + Intronic
1033378839 7:140792429-140792451 GGAGAAGGCTTGGGGAATGGTGG - Intronic
1034065922 7:148136292-148136314 GGACAGTATTTGGGTCATGGGGG + Intronic
1034208141 7:149336522-149336544 GTACATTGCTTGGGTGTTGGGGG + Intergenic
1035283015 7:157788990-157789012 GGTGACAGCTTGGGAAATGGAGG - Intronic
1036404346 8:8441606-8441628 GGGCAATGCTTGAGTCATGGAGG - Intergenic
1037068118 8:14608662-14608684 GGAAGCTGTTTGGGTCATGGGGG + Intronic
1038748370 8:30273755-30273777 GGAAAGTGATTGGGTTATGGGGG + Intergenic
1039164206 8:34658626-34658648 GTGCACTACTTGGGTGATGGGGG + Intergenic
1040772519 8:50994808-50994830 GCACACTGCCTGTGTACTGGAGG + Intergenic
1042429559 8:68689307-68689329 GTACACTGCTTTGGTGATGGGGG + Intronic
1042862337 8:73327163-73327185 GGACCCAGCTTGGGGAATGTGGG + Intergenic
1043616850 8:82135946-82135968 GTACACTGCTTGGGTGATGAGGG + Intergenic
1045878429 8:107010044-107010066 GTACACTGCTTGGGTGGTGGGGG + Intergenic
1047092247 8:121587133-121587155 GCTCACTGCTTAGGTAAAGGAGG - Intergenic
1051102308 9:13535375-13535397 GGACACTGGTGGGGCAGTGGTGG + Intergenic
1051800939 9:20933287-20933309 GTATACTGCTTGGGTGATGGGGG - Intronic
1053167193 9:35853245-35853267 GGCCACAGCCTGGGTAAGGGTGG + Exonic
1056073034 9:83008417-83008439 GGATACGGCTTGGGGAAAGGTGG - Intronic
1056206080 9:84320637-84320659 GGACACTGCTTTGGGTGTGGGGG + Intronic
1057772271 9:97979165-97979187 GGATGCTGCTTGGGTAAGGAAGG + Intergenic
1058094689 9:100846455-100846477 GTACACTGTTCGGGTGATGGGGG - Intergenic
1061364988 9:130168006-130168028 GGGAACTGCTTGGGGAAGGGTGG - Intergenic
1062619346 9:137412523-137412545 TGACACTGTTTGGGGAGTGGTGG - Intronic
1062657730 9:137612945-137612967 TGACACAGCGTGGGTAGTGGAGG + Exonic
1186158696 X:6753064-6753086 ATATACTGCTTGGGTAATGGAGG - Intergenic
1190882023 X:54498299-54498321 GGTGACTGCATGGGTGATGGAGG - Intergenic
1191692591 X:63956321-63956343 GTATACTGCTTGGGTAATGGGGG + Intergenic
1192841065 X:74856801-74856823 AGCCACTGCTGGGGGAATGGGGG - Intronic
1194192194 X:90851067-90851089 GGACAGTGATTGGATCATGGGGG - Intergenic
1195739817 X:108052154-108052176 GTACACTGTTCGGGTAATGGGGG + Intronic
1198174817 X:134144920-134144942 GGACACTACTTGAGAAATGGTGG - Intergenic
1199090986 X:143692181-143692203 GTATACTGCTTGAGTGATGGGGG - Intergenic
1199904960 X:152216661-152216683 GGAGAGAGCTTGGTTAATGGAGG + Intronic
1200538829 Y:4433514-4433536 GGACAGTGATTGGATCATGGGGG - Intergenic
1201592703 Y:15633038-15633060 GAACACTGATGGGGTCATGGTGG - Intergenic