ID: 1136101764

View in Genome Browser
Species Human (GRCh38)
Location 16:28001908-28001930
Sequence GCCTATGTATAGGCAAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136101757_1136101764 23 Left 1136101757 16:28001862-28001884 CCCGCTGCTTGGCAACCTTCAAA 0: 1
1: 0
2: 2
3: 28
4: 167
Right 1136101764 16:28001908-28001930 GCCTATGTATAGGCAAGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1136101758_1136101764 22 Left 1136101758 16:28001863-28001885 CCGCTGCTTGGCAACCTTCAAAT 0: 1
1: 0
2: 0
3: 14
4: 210
Right 1136101764 16:28001908-28001930 GCCTATGTATAGGCAAGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1136101759_1136101764 8 Left 1136101759 16:28001877-28001899 CCTTCAAATTATCATCTACAAGG 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1136101764 16:28001908-28001930 GCCTATGTATAGGCAAGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1136101756_1136101764 26 Left 1136101756 16:28001859-28001881 CCACCCGCTGCTTGGCAACCTTC 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1136101764 16:28001908-28001930 GCCTATGTATAGGCAAGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136101764 Original CRISPR GCCTATGTATAGGCAAGAAT GGG Intronic
901288920 1:8106563-8106585 GCCTGTGTAATGACAAGAATTGG + Intergenic
902979928 1:20115357-20115379 GGCTGTGAAGAGGCAAGAATGGG - Intronic
906559058 1:46741136-46741158 GTGTATGTATAGGGAAAAATAGG + Intergenic
906750614 1:48255916-48255938 GCCACGGTATAGCCAAGAATGGG + Intergenic
910606190 1:89087412-89087434 GCCTAATTAAAGGCAGGAATGGG + Intergenic
913140450 1:115936066-115936088 GCATATGTATAGGCCAGCATTGG - Intergenic
915924837 1:160008888-160008910 GGCTTTGTATAGGCAAGAAGGGG + Intergenic
917767498 1:178237877-178237899 GCCTAGGGTGAGGCAAGAATGGG - Intronic
918856842 1:189766413-189766435 GCTTATGTATAAGAAAGTATAGG - Intergenic
920867686 1:209767011-209767033 GCCTATGTATGGCAAAGAATTGG + Intronic
924372345 1:243364549-243364571 GTGTTTGTATAGGCAAGAAGAGG + Intronic
1063634841 10:7772043-7772065 GCAGATGTAAAGGCAAGAAAGGG + Intronic
1070907666 10:80087803-80087825 GCCTATAAACAGGTAAGAATAGG - Intronic
1073172506 10:101522765-101522787 ACCTATGTATGGGTAAAAATAGG - Intronic
1074220516 10:111432899-111432921 CCCAATGTAGAGGCAAAAATGGG + Intergenic
1074612302 10:115034048-115034070 GCACATCTATAGGCAAGACTAGG - Intergenic
1075544564 10:123345224-123345246 TCCTATATAGAAGCAAGAATAGG + Intergenic
1080019451 11:27544743-27544765 GCTTATGTAAAGGGAAAAATTGG - Intergenic
1082195015 11:49293349-49293371 GCAAATGTACAGGCAAGAAATGG - Intergenic
1082852395 11:57777009-57777031 GGCTATGCATAAGGAAGAATTGG + Intronic
1086660914 11:89416205-89416227 GCAAATGTACAGGCAAGAAATGG + Intronic
1089669081 11:120039957-120039979 GCCTGAGTAGAGGAAAGAATAGG - Intergenic
1097786483 12:63765585-63765607 GCCTTTATACAGGCAAGACTGGG + Intergenic
1100723051 12:97378941-97378963 GCCTTAGTATAGGCAAGTTTTGG + Intergenic
1107642504 13:42457845-42457867 CCCTAAGGATAGGCAAGAAAGGG + Intergenic
1107647611 13:42511687-42511709 CCCTAAGGATAGGCAAGAAAAGG - Intergenic
1110962075 13:81639367-81639389 GCCAATGTTTAGGAAGGAATAGG - Intergenic
1118456744 14:65951797-65951819 GCCTGAGTAAAGGCAAGAGTGGG - Intergenic
1119519336 14:75274329-75274351 GGATATGAATAGGCAAAAATTGG - Intergenic
1121772085 14:96554864-96554886 TTCTTTGTATAGGAAAGAATAGG + Intronic
1121891005 14:97590501-97590523 GCTTATGCATGGGCAGGAATTGG + Intergenic
1125869713 15:43088667-43088689 GTCTATGTTTAGGGAAGCATAGG - Intronic
1128158729 15:65409221-65409243 GCCCATGTGTAGGTAAGGATGGG - Intronic
1130251809 15:82304671-82304693 GCCTTTGTATGGGGGAGAATTGG + Intergenic
1134884587 16:17778345-17778367 AAATATGTATGGGCAAGAATTGG + Intergenic
1135895357 16:26396158-26396180 TCCTCTGTATGGGCAAGAATTGG + Intergenic
1136101764 16:28001908-28001930 GCCTATGTATAGGCAAGAATGGG + Intronic
1138311323 16:56025955-56025977 GCATATGGATAGGAAAGACTGGG - Intergenic
1140222651 16:73055320-73055342 GCCTATGTCTATGCAGGCATAGG + Intronic
1141986990 16:87586508-87586530 GCCTATGACGTGGCAAGAATGGG + Intergenic
1149971970 17:61227867-61227889 GCCTCTCTAAAGGGAAGAATAGG + Intronic
1150021419 17:61617971-61617993 CCCCATGTATAGGCAAGAGAAGG + Intergenic
1155522532 18:26683452-26683474 ACCTACGTAAAGGCAAGGATCGG - Intergenic
1158982373 18:62776017-62776039 GCCTATGTATAGACATAGATAGG - Intronic
925088872 2:1136691-1136713 ACCTATGTGAAGGCAAAAATTGG + Intronic
939768754 2:146288583-146288605 GACTATATATAGGAAAAAATGGG - Intergenic
945095909 2:206218907-206218929 ACCTAGGTATAGGCAATAAAGGG + Intergenic
1170854877 20:20042791-20042813 GCAAATGCATTGGCAAGAATAGG - Intronic
1182937200 22:34235782-34235804 GCCTTTATATAGGCACAAATGGG - Intergenic
1185375911 22:50482483-50482505 GCCTGTGTAGAGGCAAAAGTGGG + Intronic
954834079 3:53449558-53449580 TCCTATGGATAGGCATGAAAGGG + Intergenic
956888862 3:73589600-73589622 GCCTATTTATAGGTAAGTTTAGG - Intronic
957660537 3:83145879-83145901 GCAGATGTATAGGCAATAAAAGG - Intergenic
961945732 3:130685426-130685448 GCATATATATACCCAAGAATGGG - Intronic
964063454 3:152553755-152553777 GCCTATGTATAGTTATCAATGGG - Intergenic
967213056 3:187185800-187185822 GCCCAAGTATAGGAGAGAATAGG + Intergenic
970380868 4:15506532-15506554 GGCTGTGTATAGGCAAGCCTTGG - Intronic
972616176 4:40700578-40700600 GCCTAAGAATATGGAAGAATAGG + Intergenic
974022543 4:56704832-56704854 GGATGTGTATAGGCAGGAATGGG - Intergenic
975922225 4:79406243-79406265 GCCTATGTTTTAGAAAGAATGGG + Intergenic
976147378 4:82055324-82055346 GCCTATGTTGAGGAAGGAATGGG + Intergenic
976712336 4:88085743-88085765 CCCTATGCATAAGCCAGAATGGG - Intergenic
983706759 4:170670624-170670646 ACCAATATATAAGCAAGAATAGG - Intergenic
986550699 5:8951500-8951522 GCCTAGTTATAGCCAAGAGTAGG - Intergenic
987579644 5:19773945-19773967 ACCTATGAAAAGGAAAGAATGGG + Intronic
992852189 5:80822094-80822116 GGCTGTGTATGGGAAAGAATAGG + Intronic
999540661 5:152568743-152568765 GCTTATGTTTGGGCAAGAATAGG + Intergenic
999810080 5:155119242-155119264 CCCTATGTACAGGCAATAAAGGG - Intergenic
1002845247 6:939581-939603 GCCGTTGTATAGACAAGAAAAGG + Intergenic
1005112781 6:22302502-22302524 ACCTATCTATGGGCAAGAAACGG - Intergenic
1005243773 6:23858702-23858724 GACTATGAATAGGAGAGAATGGG - Intergenic
1006150763 6:31986921-31986943 GCCTAATTAAAGGCAGGAATGGG + Intronic
1006157064 6:32019659-32019681 GCCTAATTAAAGGCAGGAATGGG + Intronic
1010564447 6:77392182-77392204 GCTTGAGGATAGGCAAGAATAGG - Intergenic
1011656003 6:89552608-89552630 GCCTATGTAAAGTCAACAAGAGG - Intronic
1012029685 6:94042608-94042630 GCCAATGGAGAGGGAAGAATGGG - Intergenic
1023556854 7:41432279-41432301 GCCTATGAGGAGGCAAGCATTGG + Intergenic
1024979992 7:55149930-55149952 GTCTATGTATATACAGGAATTGG - Intronic
1036930082 8:12947868-12947890 GCCTATGTATAAGGAAGCATTGG + Intronic
1038598456 8:28912725-28912747 GAGTATGTTTAGACAAGAATAGG - Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1038924308 8:32121102-32121124 GCCTATTTTTATGCAACAATAGG - Intronic
1040671043 8:49691199-49691221 GCATATGTATAGGGAGGATTAGG + Intergenic
1050896919 9:10895029-10895051 GCCTATTTTTATGCAAGACTTGG - Intergenic
1061559901 9:131395118-131395140 GCCCACCTTTAGGCAAGAATTGG + Intronic
1188622841 X:32246888-32246910 GCATATGTAGAGCCCAGAATTGG + Intronic
1191907475 X:66108577-66108599 GCCTCTGAATAAACAAGAATTGG + Intergenic
1192845472 X:74902776-74902798 GCCTTTGGATAGGCAAAAAATGG + Intronic
1195444327 X:104933861-104933883 TCCTAAGTATTGGCAAGCATGGG + Intronic
1196961489 X:121007864-121007886 GCGTATGTCTAGGCAATGATGGG - Intergenic
1198076763 X:133201036-133201058 GCCTAGGTAGAGACAGGAATGGG - Intergenic
1201565240 Y:15358550-15358572 GGCTATGAATAGGAAAGTATGGG + Intergenic