ID: 1136102139

View in Genome Browser
Species Human (GRCh38)
Location 16:28004088-28004110
Sequence CACAGCAGGGTGGAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 0, 2: 7, 3: 107, 4: 908}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136102128_1136102139 2 Left 1136102128 16:28004063-28004085 CCACTCAGCCCGAGGCGCCTGTG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG 0: 1
1: 0
2: 7
3: 107
4: 908
1136102130_1136102139 -7 Left 1136102130 16:28004072-28004094 CCGAGGCGCCTGTGTGCACAGCA 0: 1
1: 0
2: 1
3: 24
4: 166
Right 1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG 0: 1
1: 0
2: 7
3: 107
4: 908
1136102125_1136102139 27 Left 1136102125 16:28004038-28004060 CCTGCTGGGGCTGCTGGGCTGAC 0: 1
1: 1
2: 4
3: 65
4: 544
Right 1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG 0: 1
1: 0
2: 7
3: 107
4: 908
1136102129_1136102139 -6 Left 1136102129 16:28004071-28004093 CCCGAGGCGCCTGTGTGCACAGC 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG 0: 1
1: 0
2: 7
3: 107
4: 908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136102139 Original CRISPR CACAGCAGGGTGGAGGGGGC AGG Intronic
900206086 1:1432456-1432478 GAGAGCAGGGTGGGGTGGGCAGG - Intergenic
900479930 1:2893160-2893182 CAGGGTAGGGTGGAGTGGGCGGG - Intergenic
900511184 1:3061910-3061932 CACTGAAGGGTGGAGAGGGGAGG + Intergenic
900514508 1:3074859-3074881 AGCTGCAGGGTGGAAGGGGCCGG + Intronic
900532689 1:3162490-3162512 CTCAGCCGGGGGGAAGGGGCAGG - Intronic
900600938 1:3502420-3502442 CCCAGCTGGGTGGAGGGGAGTGG - Intronic
900650619 1:3728307-3728329 GAGACCATGGTGGAGGGGGCGGG + Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901063081 1:6482449-6482471 GACAGGAGGGAGGAGGAGGCCGG + Intronic
901197891 1:7450437-7450459 CAGAGGTGGGTGGAGGTGGCAGG - Intronic
901625889 1:10624868-10624890 CACTGCGGTGTGGATGGGGCTGG - Intronic
902331803 1:15734537-15734559 CACTGCCGGGTTGAGGGGACAGG - Exonic
902342430 1:15792781-15792803 CACGGCATGGTGGAGGTGGCTGG - Intergenic
902403852 1:16172538-16172560 AACAGTAGGGTGGAGGGCCCAGG - Intergenic
902410890 1:16210964-16210986 GACAGCAGGGTGAAGGGAGCAGG - Intronic
902628546 1:17690786-17690808 CCCAGCATGGTGGCTGGGGCTGG - Intronic
902642588 1:17776239-17776261 CAAAGCCTGGTGGAAGGGGCAGG - Intronic
902748629 1:18490608-18490630 CACTCCAGGGTTGAGGGAGCTGG - Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903003472 1:20282864-20282886 GACAGCAGGGTGCAGGGCACAGG + Intergenic
903790105 1:25886971-25886993 CAGAACAGGGTGGTGGGGACCGG - Intronic
904160565 1:28519330-28519352 CTCTGCGGGGTGGAGGAGGCAGG + Intronic
904248979 1:29209025-29209047 CACCGCAGGGTGGAGAGTGATGG + Intronic
904295365 1:29516785-29516807 CACTGCAGCCTGGTGGGGGCAGG + Intergenic
904409714 1:30318185-30318207 CACAGCAGGAAGGGGCGGGCTGG + Intergenic
904463515 1:30694290-30694312 CACAGCAGGAAGGGGTGGGCTGG + Intergenic
904585434 1:31577213-31577235 CCCAGCAGGGTCGTGGGCGCCGG + Exonic
904905447 1:33894407-33894429 CACAGCAGGCTGGAAGGGCTAGG + Intronic
905016422 1:34781707-34781729 CACAGCAGAGGCGAGGGCGCCGG - Exonic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
905411018 1:37767951-37767973 TGCAGAAGGGTGGAGGGGCCTGG + Intergenic
905825769 1:41025004-41025026 CACATCAGGGAGAAGGGGGTTGG - Intergenic
905895179 1:41541119-41541141 CACAGCTGGTCGGAGGAGGCAGG - Intronic
906100238 1:43255721-43255743 GCCAGCAGGGGGGAAGGGGCTGG - Intronic
906666124 1:47623334-47623356 CACAGGAGCAGGGAGGGGGCCGG + Intergenic
906668908 1:47640809-47640831 CACATCAGGGTGGGGCGGGGTGG + Intergenic
907303768 1:53502916-53502938 GACAGGAGAGGGGAGGGGGCAGG + Intergenic
907409651 1:54275083-54275105 CATAGTCTGGTGGAGGGGGCAGG - Intronic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
907668071 1:56450545-56450567 CACAGCAGGGTGGGGAAGGGAGG + Intergenic
907920869 1:58910600-58910622 CAGAGCAGGGTGTGGGGGGATGG - Intergenic
908085023 1:60622710-60622732 CTCAGGAGGCTGGAGTGGGCTGG + Intergenic
909499522 1:76318562-76318584 CACAGCAGGGAGGCGAGGGCAGG - Intronic
909720878 1:78767834-78767856 CACAGGTGGGTGGAGGTAGCTGG - Intergenic
909995143 1:82269778-82269800 TACAGTGGGGTAGAGGGGGCAGG + Intergenic
910225420 1:84931171-84931193 CACAGCAGGGTGGATTGGTTTGG - Intronic
911181307 1:94862972-94862994 CACAGCAGGGGAGAGGTGGTAGG + Intronic
912063982 1:105712489-105712511 GACAGCGGGGTGGAGAGGGAGGG - Intergenic
912233373 1:107821631-107821653 CAGAGGAGGTTGGAGGGGCCAGG + Intronic
912255890 1:108057780-108057802 AACAGCAGAGAGGAGGAGGCAGG - Intergenic
912410639 1:109478575-109478597 CAGAGCAGGGCTGAGGTGGCTGG - Intronic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
912435110 1:109656268-109656290 CGCAGCGGGGCCGAGGGGGCGGG + Exonic
912445148 1:109730068-109730090 CAAAGCAGGGGGGAGGGGGTTGG + Intronic
912495044 1:110086121-110086143 CCCAGCCGGGTGGAGGGGACTGG - Intergenic
912747813 1:112260193-112260215 CAGAGCAGGGTGGAGAAGGGTGG - Intergenic
912777821 1:112517104-112517126 CACAGCCTGGGGGAGGGGGAAGG - Exonic
914171962 1:145233453-145233475 TGCAGTAGGCTGGAGGGGGCGGG - Intergenic
914942775 1:152037219-152037241 CAGGACGGGGTGGAGGGGGCCGG - Intronic
915130762 1:153693867-153693889 TACTGCTGGGTGGAGGGGGTCGG - Exonic
915323479 1:155068896-155068918 CACATCAGGGTGGCGAGGGGGGG + Intronic
915520270 1:156437714-156437736 GACAGCTTGGTGGAGGGTGCTGG + Intergenic
915564506 1:156706175-156706197 CGAAGCAGGGTGGAGGGGTGGGG - Intergenic
915611724 1:156999035-156999057 CCCAGCAGGAGGGAGGGGGCGGG + Intronic
917351309 1:174080950-174080972 CACAGCAGGCAGGGAGGGGCAGG + Intergenic
917641819 1:176990227-176990249 CACAGCAGGGGTGGGGGGGTGGG + Intronic
917660823 1:177175280-177175302 AAAAGCGGGGTGGGGGGGGCAGG + Intronic
918070814 1:181132183-181132205 AACAGGTGGGTGGAGGGGACAGG - Intergenic
918205026 1:182300495-182300517 AACAGCAGGGAGGAAAGGGCAGG + Intergenic
919887203 1:201943492-201943514 CACAGCACCGTGCTGGGGGCAGG - Intronic
920645810 1:207803663-207803685 CAAAACAGGGTGGGTGGGGCAGG + Intergenic
920657734 1:207888898-207888920 CACAGAGGGCTGGAGCGGGCTGG - Intronic
921882683 1:220272383-220272405 CGCAGTGGGGTGGAGGGGGCAGG - Exonic
922214334 1:223508384-223508406 GACAGGAGGGAGGAGAGGGCTGG - Intergenic
922440761 1:225653375-225653397 CCCAGAGGGGTGCAGGGGGCGGG - Intergenic
922746946 1:228049593-228049615 CACAGCTGGATGGAGGGGAAAGG - Intronic
922875606 1:228937627-228937649 CAGTGCAGGGGGGAGGGTGCTGG - Intergenic
923706638 1:236349529-236349551 CAAAGCGGGGTGGCGGGGGTGGG + Intronic
924021295 1:239786682-239786704 CACCGCAGGGTGCCGAGGGCAGG + Intronic
924511615 1:244732700-244732722 CAGAGCAAGGTGGAAGGGCCAGG - Intergenic
1062768525 10:82738-82760 CACGGCAGGGCGTTGGGGGCAGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063124963 10:3129485-3129507 CAGAGCAGCGTGGAGTGAGCTGG + Intronic
1063615585 10:7597245-7597267 GACACCAGTGGGGAGGGGGCAGG + Intronic
1063962224 10:11316021-11316043 CAGAGCAGCGTGGACAGGGCGGG - Intronic
1064139296 10:12777163-12777185 GACATCAGGGTGGAGAGGTCAGG + Intronic
1064661660 10:17613996-17614018 TAGATCAGGGTGGAGGTGGCAGG + Intronic
1065047637 10:21758460-21758482 CTCAGATGGGAGGAGGGGGCGGG - Intronic
1065111602 10:22445327-22445349 AAACGCAGGGTGGTGGGGGCGGG - Intronic
1067039873 10:42943625-42943647 CACCACGGGGTGGAAGGGGCTGG - Intergenic
1067087366 10:43249997-43250019 CACAGCAGGGTCCAGCGGCCAGG + Intronic
1067343804 10:45423925-45423947 CAGAGCTGCCTGGAGGGGGCGGG + Intronic
1067348887 10:45457869-45457891 CACTGCAAGCTGGAGGCGGCTGG + Exonic
1067557408 10:47282544-47282566 CGCAGGAGGGTGGAGGGGTGTGG + Intergenic
1067681655 10:48445541-48445563 AACAGCAGGGAAGCGGGGGCTGG + Intergenic
1067803393 10:49376064-49376086 CAATACAGGGTGTAGGGGGCTGG + Intronic
1068008851 10:51422437-51422459 CAAAGCAGAGGGGATGGGGCCGG - Intronic
1068701772 10:60027877-60027899 CACACCTGGCTGGAGAGGGCAGG + Exonic
1069617345 10:69814421-69814443 TACAGCAGGTGGGAGGAGGCAGG + Intronic
1069624184 10:69857300-69857322 CAGAGCAGGCTGGACAGGGCTGG - Intronic
1069662189 10:70131351-70131373 CACAGCAGGATGGAGACGGTTGG + Intronic
1069719757 10:70541853-70541875 CACAGCTGGGTTGAAGGTGCTGG - Intronic
1069746364 10:70717384-70717406 CACAGCAAGGTTGTGGGGGTAGG + Intronic
1069861616 10:71475262-71475284 CCCAGCAGGCTGGAGAGGTCAGG - Intronic
1069887399 10:71632660-71632682 CACAGCAGGGTGGTGGCAGATGG - Intronic
1069910737 10:71757667-71757689 CACAGCAGGGTGGGATGGGAGGG + Intronic
1070997282 10:80796889-80796911 CACAGCAAGGTGGAAGGCGCTGG - Intergenic
1071334379 10:84589255-84589277 GACACCAGGGATGAGGGGGCTGG - Intergenic
1072472914 10:95731211-95731233 CAGAGCAGGGTGGAGGAGAATGG - Intronic
1073216447 10:101839490-101839512 CTCACAATGGTGGAGGGGGCGGG - Intronic
1073217362 10:101843834-101843856 GACAGCCGCGGGGAGGGGGCGGG - Intronic
1073594796 10:104789036-104789058 TTCAGCAGGGTGAGGGGGGCAGG + Intronic
1074061430 10:109969650-109969672 AACAGCAGGGTGGAAAGGGTGGG + Intergenic
1074153491 10:110779194-110779216 CACAGCAGGATGGAAGGGTTGGG + Intronic
1074306055 10:112279654-112279676 CACATGAAGGTGGAGGGGGAGGG - Intergenic
1074364247 10:112845365-112845387 CACAGGTGGCTGGAGAGGGCGGG + Intergenic
1074549724 10:114431235-114431257 CACAGCAGCGCGGAGCCGGCAGG + Intronic
1074845036 10:117390312-117390334 CACACCAAGGTGGAGATGGCTGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075207937 10:120462829-120462851 CACCGCAGGGTGGAGGCAGCAGG + Intronic
1075278039 10:121112959-121112981 GTCAGCAGAGTGGAGAGGGCTGG + Intergenic
1075538730 10:123294644-123294666 CACAGCAGGGTGGTTGTGGCCGG + Intergenic
1075556480 10:123436087-123436109 CACAGCAGGGTGGGTGTGGAGGG - Intergenic
1075777356 10:124997405-124997427 TTCAGCAGGGTGGTAGGGGCCGG - Intronic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1076047259 10:127304175-127304197 CACAGGATGGGGGTGGGGGCCGG + Intronic
1076061410 10:127416895-127416917 CTCAGCAGGGTGCACGTGGCTGG + Intronic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076614454 10:131746672-131746694 CAGAGCTGGGGGGAGGGGACAGG + Intergenic
1076696634 10:132250350-132250372 CACTGCAGAGAGGAGAGGGCAGG + Intronic
1076696642 10:132250398-132250420 CACTGCAGAGAGGAGAGGGCAGG + Intronic
1076696650 10:132250446-132250468 CACTGCAGAGAGGAGAGGGCAGG + Intronic
1076696658 10:132250494-132250516 CACTGCAGAGAGGAGAGGGCAGG + Intronic
1076696666 10:132250542-132250564 CACTGCAGAGAGGAGAGGGCAGG + Intronic
1076732773 10:132446711-132446733 GACAGGAGGGTGGGGTGGGCAGG + Intronic
1076793013 10:132786607-132786629 CACAGGAGGGCGGAGGACGCGGG + Intergenic
1076858302 10:133128011-133128033 CAGAGCTGGGTGGGTGGGGCTGG - Intronic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1076948049 10:133665207-133665229 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076949039 10:133668517-133668539 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
1076950023 10:133671816-133671838 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076951007 10:133675115-133675137 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076951997 10:133678425-133678447 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076952986 10:133681735-133681757 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076953970 10:133685034-133685056 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076954954 10:133741386-133741408 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076955943 10:133744696-133744718 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076956933 10:133748006-133748028 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076957920 10:133751315-133751337 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076958905 10:133754614-133754636 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076959894 10:133757924-133757946 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076960878 10:133761223-133761245 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1077051537 11:568934-568956 CCCAGCGGGTTGGGGGGGGCGGG - Intergenic
1077161043 11:1113047-1113069 CACAGCAGGGAAGAGCAGGCAGG - Intergenic
1077339473 11:2019608-2019630 CAGAGCAGGGTGGGGGTGCCAGG + Intergenic
1077341181 11:2027099-2027121 CACAGCTGGGTGGGCTGGGCAGG - Intergenic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1077413217 11:2413096-2413118 CCAGGCAGGGTGGAGGGGACTGG - Intronic
1077433043 11:2525534-2525556 CAAAGCAGTGTGGAGGGTGGGGG + Intronic
1077538773 11:3136721-3136743 CACATAGGCGTGGAGGGGGCTGG - Intronic
1077540177 11:3142980-3143002 CAGAGCAGGGCAGAGGAGGCAGG + Intronic
1077914077 11:6599782-6599804 GACAGCAGAGTGGAGATGGCAGG + Exonic
1077920691 11:6639930-6639952 CAGAGGAGGCTAGAGGGGGCAGG + Exonic
1078057006 11:8017227-8017249 CAAGGCAGGCTGCAGGGGGCTGG + Intergenic
1078559836 11:12361840-12361862 CTCAGCAGGGCAGAGGTGGCAGG + Intergenic
1078570270 11:12452042-12452064 CCCTGCAGGGTGGTGGTGGCAGG - Intronic
1079154796 11:17935898-17935920 GGCAGCAGAGTGGAGGGAGCAGG + Intronic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080504137 11:32895333-32895355 CAAAGCAGGCTGGCGGGGGAGGG - Intronic
1080587400 11:33694486-33694508 CACCTGTGGGTGGAGGGGGCGGG - Intergenic
1080875354 11:36269935-36269957 CACTGCAGGTTGGAGGAGGAGGG - Intergenic
1081675005 11:44963510-44963532 CACAGCAGGCTGCTGGGGGAAGG + Intergenic
1081752051 11:45518261-45518283 CACAGGAGCTAGGAGGGGGCGGG + Intergenic
1081970506 11:47195087-47195109 GTCAGAAGGGTGGAGTGGGCAGG + Intergenic
1082782981 11:57301430-57301452 AACAGCAGAGTGGAGGGGGATGG - Intronic
1083201544 11:61123840-61123862 CACATCAGAGTGGTGGGGGCAGG - Intronic
1083285935 11:61658922-61658944 CGCAGCAGTATGGAGGGAGCTGG + Intergenic
1083446994 11:62714827-62714849 CACAGCAGGTAGGAGCAGGCAGG - Exonic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1083612989 11:64013259-64013281 CACAGCAGGGTGGGGGCCGGGGG + Intronic
1083671663 11:64303553-64303575 CAGAGCAGGGTTGGAGGGGCTGG + Exonic
1083742835 11:64720282-64720304 CCCATCAGTGTGGAAGGGGCAGG + Intronic
1083802350 11:65053867-65053889 AACAGCTGGGTGAAGGGGCCTGG + Intronic
1083906213 11:65673072-65673094 GACAGCAGGTTGGAGAGGACAGG - Intergenic
1083959604 11:66007281-66007303 CTCAGCAGGCTGCCGGGGGCAGG - Intergenic
1083983222 11:66191419-66191441 GACATCTGGGTGGTGGGGGCTGG + Intronic
1084302618 11:68261395-68261417 CACCTCAGGGTGGGGCGGGCAGG - Exonic
1084490888 11:69477707-69477729 CCCTGCAGGGTGCAGGGTGCTGG - Intergenic
1084555889 11:69875587-69875609 CAGAGCAGGGTGCAAGGGTCTGG - Intergenic
1084567301 11:69938447-69938469 CAGAGCGGGGTGGAGGGATCTGG - Intergenic
1084677929 11:70647397-70647419 CACAGGAGGGTGGTTGGAGCAGG + Intronic
1084726249 11:70944271-70944293 CACAGGAGGGTGGATGGCTCTGG - Intronic
1085043160 11:73338673-73338695 CACACCAGGGAGGTGGGGGTTGG + Intronic
1085386665 11:76161700-76161722 CAGAGCAGAGGGGAGGGGGTGGG - Intergenic
1085444049 11:76589087-76589109 CACAGCAGCGTGGAGAGGGCTGG + Intergenic
1085847776 11:80085383-80085405 CACAGCAGGCTGGAGGGCTGGGG + Intergenic
1086001559 11:81990908-81990930 CACGGCTGGGGGGAAGGGGCAGG + Intergenic
1086932025 11:92704258-92704280 CAGAGCTGGGTGGATGGGGCAGG - Intronic
1088618902 11:111662451-111662473 CAGAGCAGGGTAAAGGGGCCAGG + Intronic
1089014928 11:115157909-115157931 CCCATCAGGGTGGATGGGGCGGG - Intergenic
1089465115 11:118679882-118679904 CAGAGCATGGTGGTGGGGGTGGG + Intergenic
1089660654 11:119983092-119983114 AACAGGAGGGAGGAGGGGGCTGG - Intergenic
1089728440 11:120503721-120503743 CTCAGAAGGGTGGAGGGGGAGGG + Intergenic
1090776925 11:129973984-129974006 CAGTGCAGAGTGGAGGGGCCAGG + Intronic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090875635 11:130786451-130786473 CACAGCAGGAAGGTGGGGGCAGG - Intergenic
1090911933 11:131128978-131129000 AACAGCAGGTTGGATGGGCCTGG + Intergenic
1091349439 11:134881299-134881321 CACAGCAGGGAGGTGGGGAAGGG - Intergenic
1091366127 11:135022180-135022202 CAGAGCAGGGTGGTGGTGGCAGG + Intergenic
1202822458 11_KI270721v1_random:74797-74819 CAGAGCAGGGTGGGGGTGCCAGG + Intergenic
1202824166 11_KI270721v1_random:82288-82310 CACAGCTGGGTGGGCTGGGCAGG - Intergenic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1091601228 12:1918716-1918738 GACAGCAGGGAGGGGGTGGCAGG + Exonic
1093048054 12:14474248-14474270 AAAAGCAGATTGGAGGGGGCAGG - Intronic
1093293377 12:17357327-17357349 AGCAACAGGGTGGTGGGGGCGGG + Intergenic
1095415137 12:41968331-41968353 CACAGCGGGGTGGGGTGGGAGGG - Intergenic
1095947685 12:47763129-47763151 CTCAGCAGGGTGGAAGGGAGAGG + Intronic
1096085513 12:48862844-48862866 TTCCCCAGGGTGGAGGGGGCAGG - Intronic
1096100783 12:48969552-48969574 CACAGCACAGAGGAGGGGACTGG + Intronic
1096192793 12:49631285-49631307 CAGAGCAGGGTGGAGGGTTGGGG + Intronic
1096240498 12:49957343-49957365 TACAGCAGGCTGGAGAGGGAAGG - Exonic
1096298070 12:50400894-50400916 CACTGCCGGGTGGAGGGGCAAGG + Exonic
1096515576 12:52153347-52153369 CATAGGAGGGTGGTGGGGGGAGG + Intergenic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096677557 12:53233772-53233794 CTCAGCAGTGTGGGAGGGGCGGG + Intergenic
1097379556 12:58878591-58878613 CTCTTCAGGATGGAGGGGGCAGG + Intronic
1097949287 12:65408763-65408785 CAGAGAAGGCTGGAGTGGGCTGG + Intronic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098366827 12:69712219-69712241 CAGAGCAGGGTGGAGAAGACTGG + Intergenic
1100605590 12:96149676-96149698 CACGGCGGGGTGGTGGGGGTCGG - Intergenic
1100985566 12:100199433-100199455 GAAAGGAGGGTGGATGGGGCAGG + Intronic
1102201935 12:111063337-111063359 GACTGCAGGGTGGTGGGGGGAGG - Intronic
1102506126 12:113385488-113385510 CAGAGCAGGGTGGTGTGGGGTGG + Intronic
1102525548 12:113510100-113510122 CACCCCAGGATGGAGGAGGCAGG - Intergenic
1102670540 12:114615157-114615179 CATCACAGGGTGGAGAGGGCAGG + Intergenic
1102767994 12:115450200-115450222 GACAGCAGGCTGGAGGAGGGAGG - Intergenic
1102809901 12:115815162-115815184 CACAGCAGGGTCAAGGGTCCAGG - Intergenic
1102879328 12:116472231-116472253 CAGAGCAAGCTGGAAGGGGCTGG - Intergenic
1103352241 12:120292252-120292274 AACAGCAGGGTGGGGGGAGTTGG + Intergenic
1103520924 12:121536814-121536836 CACAGCAGAGAGGAGAGGACAGG + Intronic
1103763502 12:123267009-123267031 CACATCAGAGTGGAGGGCACTGG - Intronic
1104423208 12:128653959-128653981 CACAGCAGAGTAGAAAGGGCTGG - Intronic
1104423211 12:128653988-128654010 CACAGCAGAGTAGAAAGGGCTGG - Intronic
1104678861 12:130734943-130734965 CACAGCAGCTTGGATGGAGCGGG - Intergenic
1104896626 12:132168055-132168077 CACAGCTGAGTGTAGGGGTCGGG + Intergenic
1106209742 13:27630867-27630889 GACAGCAGGGTGGGGGAGGCGGG - Intronic
1106230467 13:27817318-27817340 GACAGCTGGGTGGAGAGGGCCGG + Intergenic
1106431542 13:29685355-29685377 CACAGCAGGGTAGGGGGTGCTGG - Intergenic
1106529960 13:30581488-30581510 CAGAGCTGGGTGGTTGGGGCAGG + Intronic
1107035839 13:35901675-35901697 GACAGCCTGGTGGAGGAGGCTGG - Intronic
1107412292 13:40169020-40169042 CACAGCAGTGTGGAGGAGGGTGG + Intergenic
1107423665 13:40272590-40272612 CACAGCTCGGTGGGGGAGGCAGG - Intergenic
1107604953 13:42048380-42048402 GACAGGAGGGTGGGGGAGGCAGG - Intronic
1108518735 13:51225713-51225735 CACAGCGGGGTGGTGGAGGCAGG + Intronic
1108522659 13:51259671-51259693 CACAGCGAGGTGAAGGGGACGGG - Intronic
1110182976 13:72639196-72639218 CGCAGGATAGTGGAGGGGGCTGG - Intergenic
1112030790 13:95454532-95454554 CACAGCAGGGTGGGGAGAGAGGG - Intronic
1112379220 13:98872855-98872877 CACAGCATAGTGGTGGGGCCAGG - Intronic
1112806406 13:103167795-103167817 CACAGCAGGGAGGAGAAGGGCGG + Intergenic
1113655623 13:112066721-112066743 CAAAGCAGGAAGGAGGGGGGAGG - Intergenic
1113695416 13:112342610-112342632 CACAGGAGGCTGGAAGGGGCAGG + Intergenic
1113879422 13:113615431-113615453 CACATCAGGGAGGAGAGTGCAGG - Intronic
1114263963 14:21060312-21060334 CAGGGCAATGTGGAGGGGGCTGG - Intronic
1116633957 14:47369529-47369551 GACTGCAGGGTGGAGGGTGGTGG - Intronic
1116795377 14:49384603-49384625 ATGAGCAGGGTGGTGGGGGCGGG - Intergenic
1117070180 14:52049059-52049081 CACAGCAGGAGGGTGGAGGCTGG + Intronic
1117519038 14:56531838-56531860 GGCAGCAGAGTGGAGGGGGTGGG - Intronic
1117802567 14:59460139-59460161 GCCAGCAGGGTGGAAGGGCCAGG + Intronic
1118858436 14:69642643-69642665 CCCAGCAGGGGGGCGGGGGGCGG - Intronic
1119201424 14:72755694-72755716 GGCAGCATGGTGGATGGGGCAGG - Intronic
1119483751 14:74975294-74975316 CACAGCAGGATGGTGGGGGTAGG + Intergenic
1119835559 14:77746895-77746917 CACAGAAGGGGGGAGGGGGAGGG - Intronic
1120847419 14:89138760-89138782 CACTAGAAGGTGGAGGGGGCTGG + Intronic
1121240132 14:92423739-92423761 CACAGCAGGGAAGAAAGGGCAGG + Intronic
1121422356 14:93824610-93824632 CCCAGCAGGGGAGAGGGAGCTGG + Intergenic
1121432214 14:93895553-93895575 TACTGCGGGGTGGAGAGGGCAGG + Intergenic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122053110 14:99073616-99073638 CACAGCAGGGAGGCTGGGGGCGG + Intergenic
1122414383 14:101541875-101541897 TGCAGCTGGGAGGAGGGGGCTGG - Intergenic
1122540195 14:102493727-102493749 CACAGCAGGGAGGCTGGGGCGGG - Intronic
1122638032 14:103139239-103139261 CGCAGGAGGAAGGAGGGGGCCGG + Intergenic
1122799403 14:104222127-104222149 CAAAGCGGGGAGGAGGGGCCTGG - Intergenic
1122861913 14:104586585-104586607 CACTGGGGGCTGGAGGGGGCAGG + Intronic
1123049657 14:105534847-105534869 CAATGCAGGGTGGCGGGGGTGGG - Intergenic
1123114935 14:105890353-105890375 CACTGCAGGGTGGCTGGGCCTGG + Intergenic
1123117122 14:105899801-105899823 CACTGCAGGGTGGCTGGGCCTGG + Intergenic
1123119204 14:105909111-105909133 CACTGCAGGGTGGCTGGGCCTGG + Intergenic
1202848671 14_GL000225v1_random:1954-1976 GTCAGCCCGGTGGAGGGGGCTGG - Intergenic
1202852781 14_GL000225v1_random:31427-31449 GTCAGCCCGGTGGAGGGGGCAGG - Intergenic
1202864055 14_GL000225v1_random:104192-104214 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1202922177 14_KI270723v1_random:36030-36052 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1202922756 14_KI270724v1_random:1584-1606 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1123997813 15:25731023-25731045 GACACCAGGCAGGAGGGGGCAGG + Intronic
1124251010 15:28106609-28106631 CACAGCAGGGTGGGGGCACCGGG + Intergenic
1124341864 15:28894902-28894924 CACAGGAGGGTGGCGGGGGCAGG + Intronic
1124347939 15:28934815-28934837 CACAGCAAGGTGTAGGTGGCAGG - Intronic
1124965312 15:34429046-34429068 CGCAGGAGGGTGGCGGGGGCAGG - Intronic
1124981928 15:34575248-34575270 CGCAGGAGGGTGGCGGGGGCAGG - Intronic
1125281355 15:38045223-38045245 CAGAGCAGGGTGGAGAAGGATGG - Intergenic
1125514317 15:40309228-40309250 CAGGGCAGGGTGGAGGGTGAGGG + Intergenic
1125588136 15:40836683-40836705 CACATGAGGGTGGAGGGTACAGG - Intergenic
1125793841 15:42389878-42389900 CACAGAAGGGTGGAAAGGGAAGG - Intronic
1125832604 15:42727568-42727590 CAGAGCAGGGGGGTGGGAGCAGG + Intronic
1126434145 15:48618687-48618709 CACAGCAGGGGGTAAGTGGCAGG + Intronic
1127970225 15:63952952-63952974 CTCAGAAGGGTAGAGGGGCCAGG - Intronic
1128186083 15:65644545-65644567 GACAGCAGGGAGAGGGGGGCAGG - Intronic
1128529701 15:68436084-68436106 CCCAACTGGGTGGAGGGAGCGGG + Intergenic
1128633943 15:69291068-69291090 GACTCCAGGGAGGAGGGGGCTGG - Intergenic
1128703908 15:69824203-69824225 CACAGCAGAGTTGAGGGAGAGGG + Intergenic
1128774319 15:70308168-70308190 CCCAGCAGGGTGGAAGGGTATGG - Intergenic
1128984839 15:72211982-72212004 CACAGGAGGCTGGAGGGAGCTGG + Intronic
1128999076 15:72318467-72318489 CACAGCATGGTGGTGGTGGTGGG + Intronic
1129182124 15:73884251-73884273 CAAAGTGGGGTGGAGAGGGCTGG + Intronic
1129200922 15:73998766-73998788 CACTGCTGGGTGTAGGGGGACGG + Intronic
1129674387 15:77624696-77624718 CACAGCAGGGTGGGGTGCACTGG - Intronic
1129901475 15:79154455-79154477 TACAGAAGTGTGGAGGGGGAGGG - Intergenic
1130042427 15:80415989-80416011 CACAGCAGTGGAGAGTGGGCAGG - Intronic
1130746904 15:86664073-86664095 CACAGCAGGGTTGAAGGTGTGGG - Intronic
1130885611 15:88090144-88090166 CACAGGCTGGTGGAGAGGGCTGG - Intronic
1131067759 15:89444767-89444789 GAAAGTAGGGTGGAGGGGGGAGG - Intergenic
1131197155 15:90364801-90364823 CACAAGAGGATGGAGGGGGAGGG - Intronic
1131252586 15:90840019-90840041 CAATACAGTGTGGAGGGGGCTGG - Intergenic
1131260265 15:90884292-90884314 AACGGAAGGGAGGAGGGGGCCGG - Intronic
1131288138 15:91080395-91080417 TAAAGCAGGGTGGAGCGGGAGGG - Intergenic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132589964 16:722275-722297 AACAGCAGAGTAGAGGGGGCGGG - Intronic
1132598345 16:763194-763216 GACAGCTTGGGGGAGGGGGCGGG - Intronic
1132691074 16:1182202-1182224 CTCTGCGGGGTGGAGGAGGCGGG + Intronic
1132709167 16:1258864-1258886 CTCAGGATGGAGGAGGGGGCAGG - Exonic
1132785224 16:1653287-1653309 CGCAGCAGTGTGGAGGCGACTGG + Intronic
1132897587 16:2236358-2236380 CCCAGCTGAGTCGAGGGGGCGGG + Exonic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133198808 16:4189878-4189900 CACAGCATGGAGGAGCAGGCAGG + Exonic
1133223291 16:4328340-4328362 CCCGGCTGGGTGAAGGGGGCAGG - Intronic
1133677961 16:8093358-8093380 CATGTAAGGGTGGAGGGGGCAGG - Intergenic
1133981132 16:10634048-10634070 CACACCAGGATGGAGGGAGCAGG + Intronic
1134507900 16:14823022-14823044 CTCAGCAGGCTGGTGGCGGCAGG + Intronic
1134695601 16:16221785-16221807 CTCAGCAGGCTGGTGGCGGCAGG + Exonic
1134976228 16:18572901-18572923 CTCAGCAGGCTGGTGGCGGCAGG - Intergenic
1135325010 16:21520557-21520579 CCGAGCTGGGTCGAGGGGGCGGG - Intergenic
1135811263 16:25588743-25588765 CTCGGCAGGGGGTAGGGGGCAGG - Intergenic
1135952796 16:26930972-26930994 GGCAGCCGGGTGGAGGGGGGTGG - Intergenic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136247785 16:28985307-28985329 CCCGGCAGGGAGCAGGGGGCAGG - Intronic
1136278280 16:29192193-29192215 CACAGCAGGGAGGCGGGAGATGG + Intergenic
1136336490 16:29613825-29613847 CCGAGCTGGGTCGAGGGGGCGGG - Intergenic
1136690320 16:32024108-32024130 CCCTACAGGGTGGATGGGGCAGG + Intergenic
1136790909 16:32967672-32967694 CCCTACAGGGTGGATGGGGCAGG + Intergenic
1136878906 16:33886260-33886282 CCCTACAGGGTGGATGGGGCAGG - Intergenic
1136985780 16:35103024-35103046 CAGAGCAGTGGGGAAGGGGCAGG - Intergenic
1136995889 16:35187896-35187918 CCCAGCTGGGTGGAGGAGCCTGG - Intergenic
1137484909 16:48882722-48882744 CACAGCAGGATGGGGAGGGAGGG - Intergenic
1137551174 16:49438611-49438633 CCCAGCAGGGTGGTGGGGCAAGG + Intergenic
1137683691 16:50371809-50371831 GGCAGGAGGGAGGAGGGGGCAGG - Intergenic
1138209503 16:55151683-55151705 CACAGCCGGTTGGACGGGGGTGG - Intergenic
1138444312 16:57053918-57053940 TGCAGCAGGGTGAAGGGTGCTGG + Intronic
1138550307 16:57744146-57744168 CACAGCAGGGAAGAGGGAGGTGG + Intronic
1138594468 16:58022486-58022508 CACAGCAGGGCTGAGCAGGCAGG + Intergenic
1139356400 16:66369326-66369348 CCCACCAGGCTGGAGAGGGCGGG + Intronic
1139633896 16:68246506-68246528 CACAGAAGGGTAGAGTTGGCAGG + Intronic
1139824209 16:69744524-69744546 CACAGCACGGAAGAGAGGGCCGG - Intronic
1139851339 16:69952782-69952804 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1139880316 16:70175694-70175716 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1139915930 16:70428533-70428555 CCTAGCAGGGAGGAAGGGGCAGG - Intronic
1140372194 16:74419823-74419845 CAGGGCAGGGTGGTGGGGGCGGG - Intronic
1140450071 16:75063729-75063751 CAGAGCTTGGTGGCGGGGGCAGG - Intronic
1140930881 16:79626720-79626742 GACAGCCGGGTGGATGTGGCAGG - Intergenic
1141172873 16:81702160-81702182 CACAGAAGGACGGAAGGGGCAGG + Intronic
1141462348 16:84184956-84184978 CAATGCAGGGCGGAGGGAGCTGG + Exonic
1141729185 16:85810371-85810393 TCCAGCAGGGTGGAGGGAGGGGG + Intergenic
1141770372 16:86086068-86086090 CACAGCAAGGCGGAGGGAGCTGG + Intergenic
1141981332 16:87552121-87552143 CACAGGAGAGTGGAGGAGGCAGG + Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142082658 16:88158227-88158249 CACAGCAGGGAGGCGGGAGATGG + Intergenic
1142214229 16:88822896-88822918 CTCAGCATGGTGCAGGGCGCTGG + Intronic
1142359554 16:89619731-89619753 CACAGCAGGCTGCAGGGAGGGGG - Intronic
1203093114 16_KI270728v1_random:1229129-1229151 CCCTACAGGGTGGATGGGGCAGG + Intergenic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142604307 17:1073214-1073236 CACAGCAGGGGAGAGGGCCCTGG + Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1142978114 17:3657095-3657117 CACAGAAGGGAGGAGGGAGGAGG + Intronic
1142982447 17:3679946-3679968 GAGAGCAGGGTGGAGGATGCAGG - Intronic
1143371792 17:6444960-6444982 TGCAGCGGGGTGGCGGGGGCGGG - Intronic
1143372715 17:6450273-6450295 CACTGCGGGGTGGGGGGTGCTGG - Intronic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1144334482 17:14256527-14256549 TACAGCAGACTGGTGGGGGCAGG - Intergenic
1144621499 17:16821379-16821401 GGGAGCAGGGGGGAGGGGGCTGG + Intergenic
1144884918 17:18451334-18451356 GGGAGCAGGGAGGAGGGGGCTGG - Intergenic
1145147305 17:20493043-20493065 GGGAGCAGGGAGGAGGGGGCTGG + Intergenic
1145291849 17:21552955-21552977 GACTGCATGGTAGAGGGGGCCGG + Intronic
1145395259 17:22489305-22489327 GGCAGCAGGGTGGTGGGGCCTGG - Intergenic
1145819155 17:27818034-27818056 CAGAGCAAGGTGGGGGGGTCAGG - Intronic
1145954037 17:28842478-28842500 GACAGCTTGGTGGAGGGGGACGG - Intronic
1146263646 17:31437417-31437439 CACAGCAGGGCGCAGAGAGCCGG - Intronic
1146275402 17:31512852-31512874 CACAGCAGGCGGGAATGGGCAGG + Intronic
1146460538 17:33042750-33042772 CACAGCAGGGTGGAGTCCACAGG + Intronic
1147153176 17:38530244-38530266 CCCTACAGGGTGGATGGGGCAGG + Exonic
1147478441 17:40736444-40736466 CACAGCAGGGGGGGGGGTCCAGG - Intergenic
1147538458 17:41335719-41335741 CACAGCAGGGAGGGGTGGGCAGG + Intergenic
1147662649 17:42125237-42125259 CCCAGCAGGGAGGTGGGAGCGGG + Intronic
1147935465 17:44008099-44008121 CAGAGCAGGGTGTAGGGGTGAGG - Intronic
1148125255 17:45233382-45233404 CACAGCCTTGTGCAGGGGGCAGG - Intronic
1148131331 17:45264223-45264245 CACAGCAGCCTGGAGGGTGAGGG + Exonic
1148150008 17:45391378-45391400 CTGAGGAGGGTGTAGGGGGCAGG + Intergenic
1148680572 17:49471155-49471177 CCCACCAGGCTGGAGGGGGAGGG + Intronic
1148733306 17:49850991-49851013 CACAGCAGGGACGAGGCGGGGGG + Intergenic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148814714 17:50319226-50319248 CAGAGCGGGGTGGTGGGGGTGGG + Intergenic
1148862196 17:50610204-50610226 CACAGGAGGGAAGAGGTGGCAGG - Intronic
1150470694 17:65434925-65434947 CACCGGTGGGTGAAGGGGGCTGG - Intergenic
1150492454 17:65583874-65583896 CCCAGGAGGCTGGTGGGGGCTGG + Intronic
1150632123 17:66887169-66887191 CACAGCAGGGTGGAGGAGAAGGG + Intergenic
1151312812 17:73304645-73304667 AACATCGGGGTGGGGGGGGCGGG + Intronic
1151327471 17:73388076-73388098 CAGGCCATGGTGGAGGGGGCTGG + Intronic
1151328202 17:73391617-73391639 CCTGGCAGGGTGGAGGGGGAAGG + Intronic
1151441699 17:74133474-74133496 CTAGGTAGGGTGGAGGGGGCAGG + Intergenic
1151471402 17:74320409-74320431 GACAGCAGGGTGGTGGGAACAGG + Intergenic
1151500640 17:74486100-74486122 CATAGCAGGAGGGAGCGGGCTGG + Intergenic
1151546851 17:74798564-74798586 CAGAGCAGGGTGCTGGGGGGTGG + Intronic
1151642772 17:75408165-75408187 CATAGCTGACTGGAGGGGGCAGG + Intergenic
1151674981 17:75592648-75592670 CACAGCAGGGGTGAGGGAGCGGG - Intergenic
1151822012 17:76501567-76501589 CCCAGCTGGGTGGAGGGCGGAGG - Intronic
1151831851 17:76557444-76557466 CACAGAAAGTTCGAGGGGGCAGG - Intergenic
1151936220 17:77263297-77263319 CCCAGGAGGGATGAGGGGGCAGG + Intergenic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1152078313 17:78171704-78171726 CACAGCAGGGTACAGGTGGGTGG - Intronic
1152100807 17:78300877-78300899 AACAGGAAGGTGGAGGGGACAGG - Intergenic
1152153309 17:78616417-78616439 GACTACAGGGTGGAGAGGGCAGG + Intergenic
1152260929 17:79266701-79266723 CTCAGGAGAGGGGAGGGGGCTGG + Intronic
1152278758 17:79372991-79373013 CAGCCCAGGGTGGATGGGGCCGG + Intronic
1152307913 17:79531913-79531935 CACAGCAGGCTGGACAGTGCCGG + Intergenic
1152409682 17:80117165-80117187 ACCAACTGGGTGGAGGGGGCAGG - Intergenic
1152465206 17:80462347-80462369 GCCAGCAGGGAGGAGGGGGCTGG + Intergenic
1152526420 17:80890527-80890549 CCCAGCAGGGTGGGAGGGGCGGG + Intronic
1152598350 17:81249186-81249208 GACAGAAGGGAGGAGGGGGAGGG + Intronic
1152655864 17:81519003-81519025 CACAGCAGGGCGGGCGTGGCTGG + Intronic
1152680689 17:81666411-81666433 CACATGCGGGTGGAGGGGCCGGG + Exonic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152961411 18:82571-82593 CACGGCAGGGCGTCGGGGGCAGG - Intergenic
1152965794 18:112312-112334 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1153539713 18:6140502-6140524 CTCAGCAGGGCTGAGGGTGCAGG - Intronic
1154161575 18:11984236-11984258 CACAGAAGCATGGAGGGGGCAGG - Intronic
1154210723 18:12376927-12376949 CGAGGCAGGGTGGAGGGCGCCGG + Intronic
1154411169 18:14143036-14143058 GACAGTAGGATGGGGGGGGCGGG - Intergenic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1156451839 18:37270931-37270953 TACAGAAGGGTGGAGGAGGAGGG + Intronic
1157498379 18:48172332-48172354 CACAGCTTGGTGGAGCAGGCAGG + Intronic
1157576392 18:48746642-48746664 CATAGCAGGATGGAGGGGAGAGG + Intronic
1158602192 18:58864304-58864326 GACGGAAGGGAGGAGGGGGCTGG + Intronic
1159751929 18:72313436-72313458 CACAGCAGCATGGATGGAGCTGG + Intergenic
1160319103 18:77873664-77873686 CACAGCAGGCAGGAGAGGGTGGG + Intergenic
1160806599 19:994836-994858 CACAGCAGACCGGAGGGGCCTGG - Intronic
1160824829 19:1074674-1074696 CACAGCATGGTGCAGGCGGTGGG + Exonic
1160859587 19:1232048-1232070 CAGACCAGGGTGGAGCTGGCAGG - Intronic
1160875004 19:1292823-1292845 CACCGCAGCCTGGAGGGGCCCGG + Intronic
1160952835 19:1675812-1675834 CACAGCCTGGAGGTGGGGGCCGG + Intergenic
1161028259 19:2046517-2046539 CCCTGCAGGGGGGTGGGGGCCGG - Intronic
1161250078 19:3275763-3275785 TCCAGCAGAGTGGAGGCGGCAGG - Intronic
1161271607 19:3392743-3392765 CCCAGCTGGAGGGAGGGGGCTGG - Intronic
1161289034 19:3483082-3483104 CAGAGGAGGGTGGCCGGGGCCGG - Intergenic
1161296386 19:3522670-3522692 CCCAGGAGGGAGGCGGGGGCTGG - Intronic
1161315313 19:3614760-3614782 CACAGCGGAGGGGAGGGGGTGGG + Intronic
1161352465 19:3801627-3801649 GACACCAGGCTGCAGGGGGCTGG - Exonic
1161362642 19:3859615-3859637 CACACCCAGGTGGAGGGCGCAGG + Intronic
1161681957 19:5684608-5684630 CTGAGAAGGGTGGAGGGGGAGGG + Intronic
1161703815 19:5808519-5808541 CACAGCTGGGTGGCGGGTACAGG + Intergenic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1162384116 19:10351008-10351030 CACAGCAGGATAGTGGGGTCAGG + Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162824102 19:13241061-13241083 GACAGCAGGATGGAGAGAGCTGG + Intronic
1162927615 19:13938118-13938140 CAGAGCAGGGGTGGGGGGGCAGG + Intronic
1163161523 19:15467642-15467664 CACACAAGGGTTGAGGGAGCTGG - Intergenic
1163641928 19:18466922-18466944 CTCAGCAGGGGCGAGGGGGCAGG - Intronic
1164002265 19:21112963-21112985 CCCAGCATGGTGGTGGGTGCTGG - Intronic
1164061377 19:21678269-21678291 CACAGGATGGTGCAGGGGCCCGG + Intergenic
1164065278 19:21709443-21709465 CACAGGATGGTGCAGGGGCCTGG - Intergenic
1164558283 19:29269928-29269950 CACAGCGGGGGGGGGGGGGAAGG - Intergenic
1164596627 19:29534378-29534400 CACAGCAGAGTGGAGAAGGGTGG + Intronic
1164615047 19:29662806-29662828 GACAGCTGGGTGGAGGGTGGAGG - Intergenic
1164670610 19:30070145-30070167 CCAAGCTGGGAGGAGGGGGCCGG - Intergenic
1165110486 19:33499381-33499403 CACCGCAGGGTGGTGGTGCCTGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165118102 19:33541289-33541311 CTCAGGAGTGTGGAGGGGCCTGG + Intergenic
1165261246 19:34620511-34620533 CACACCAGGGTGGGGGGAGGGGG + Intronic
1165831371 19:38732191-38732213 CACAGCAGGTGGCAGGTGGCAGG - Intronic
1165907437 19:39202755-39202777 GACAGCAGGGTGGTTGGGCCTGG - Intergenic
1166039529 19:40193215-40193237 CATAGCTGGGGAGAGGGGGCAGG - Intronic
1166098560 19:40556943-40556965 CATTGTAGGCTGGAGGGGGCTGG + Intronic
1166159609 19:40942035-40942057 CACAGTAGGGAGGGGAGGGCAGG - Intergenic
1166291194 19:41864624-41864646 CACAGTAGAGTGGAGAGGGGTGG + Intronic
1166540982 19:43605730-43605752 CACTTCAGGCTGGAGGAGGCAGG - Intronic
1166551631 19:43669328-43669350 CCCAGCAGCGTGGAGAGCGCTGG + Intronic
1166637241 19:44461330-44461352 GACAGCAGGGTGGAAAAGGCGGG - Intergenic
1166678940 19:44756051-44756073 TAAAGCAGGATGGAGGGAGCGGG + Intronic
1166764421 19:45244521-45244543 GACAGAGGGTTGGAGGGGGCAGG - Intronic
1166894530 19:46015520-46015542 CCAGGTAGGGTGGAGGGGGCGGG + Intronic
1166939339 19:46353380-46353402 GGCAGCTGGGTGGAGTGGGCAGG - Intronic
1167072349 19:47228268-47228290 GGCAGCAGGGTGGGGGCGGCGGG + Exonic
1167322891 19:48807283-48807305 CGCAGCATGGAGGAGGGGGCGGG - Intronic
1167342296 19:48922943-48922965 CACAGCTGGGTGCCAGGGGCAGG + Exonic
1167409628 19:49337252-49337274 CCCAGCAGGGAGGAGAGGGAAGG + Intronic
1167420110 19:49397759-49397781 CTCGGCAGGCTGGAGGGGACAGG - Intronic
1167434801 19:49473305-49473327 CACATGAGGGTGGAGGTGACAGG - Intronic
1167504374 19:49863313-49863335 AACAGCAGGAGGGAGGGAGCTGG - Intronic
1167506734 19:49874832-49874854 CCCACCAGGGTGAAGGGAGCAGG + Intronic
1167643835 19:50695403-50695425 CCGGGCAGGGGGGAGGGGGCCGG + Intronic
1167765323 19:51478753-51478775 CAAAGCGGCGGGGAGGGGGCTGG + Intronic
1167889281 19:52527151-52527173 CACAGCAGAGGCGCGGGGGCGGG - Intergenic
1167994911 19:53394649-53394671 CACAGCAGGGATGTGGGCGCGGG - Intronic
1168151618 19:54452103-54452125 TACAGCATGGTGGCTGGGGCAGG + Exonic
1168348008 19:55660235-55660257 GACATCAGGGAGGAAGGGGCAGG - Intronic
1168392856 19:56025246-56025268 CACACCGGGGTGGAAGGGGGTGG - Intronic
1168545152 19:57244056-57244078 CCCTGCATGGTGGAGGGGGAAGG - Intronic
925167873 2:1729554-1729576 TACAGCAGGGTGGGGGAGGGGGG + Intronic
925189121 2:1868766-1868788 CACCGCAGGGAGGAGGGGGGAGG - Intronic
925217410 2:2109328-2109350 CACAGGAATCTGGAGGGGGCTGG - Intronic
925451453 2:3973044-3973066 CACAGCAGGCAGGAGGGTGGTGG + Intergenic
925831944 2:7904347-7904369 TACAGCAAAGTGGAGGGTGCAGG - Intergenic
926053195 2:9757660-9757682 CAGGGCTGGCTGGAGGGGGCTGG + Intergenic
926094624 2:10073210-10073232 CACAGCCGGGGGGGGGGGGGGGG - Intronic
926104519 2:10141988-10142010 GAAAGCAGGGAGGAAGGGGCGGG + Intronic
926185601 2:10688351-10688373 GAGAGCAGGGTGGATGAGGCTGG - Intronic
926234160 2:11026747-11026769 CACAGCAGGGCGGATGGAGCTGG + Intergenic
926362000 2:12097949-12097971 CACTGCTGGGAGGAAGGGGCTGG - Intergenic
927009782 2:18891143-18891165 CAGAGTAGGGTGGAGGGGAGTGG + Intergenic
927441189 2:23119222-23119244 AACAGCAGAGTTGAGTGGGCAGG + Intergenic
928022612 2:27716004-27716026 CAGAGAGGGGTGGAAGGGGCAGG - Intergenic
928245450 2:29622716-29622738 CAGAGGAGGGGTGAGGGGGCTGG - Intronic
928375609 2:30770823-30770845 CAGAGGAGAGTGGTGGGGGCAGG + Intronic
928398942 2:30964342-30964364 CACAGGGAGGTGGAGGTGGCTGG - Intronic
929145316 2:38702423-38702445 CACAGCAGGGTGGGGTGTGAGGG - Intronic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929562510 2:42964603-42964625 CAGAGCTGGGTGGAGGCGGCTGG + Intergenic
929563398 2:42969639-42969661 CACAGCCGACTGGAAGGGGCAGG + Intergenic
929893185 2:45936185-45936207 CACAGCAGGCAGGGGTGGGCAGG - Intronic
929995743 2:46825391-46825413 GACAGCGGGCAGGAGGGGGCTGG + Intronic
930025648 2:47027736-47027758 CCCAGCAGGGTGCAAGGGCCAGG + Intronic
931135425 2:59394489-59394511 GATAGCAGGGTGAAGAGGGCTGG - Intergenic
931239349 2:60438747-60438769 GACAGCAGGGAGGAGAGGGAAGG - Intergenic
931326099 2:61225536-61225558 AAAAACAGGGTGGAGGGGACAGG - Intronic
931730824 2:65151894-65151916 CGCAGGTGGGTGGCGGGGGCAGG + Intergenic
932573027 2:72947836-72947858 GCCGGCAGGGTGGAGGGGACTGG - Intronic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
934562456 2:95320386-95320408 CACGGCAGCCTGGAGGGGTCGGG + Intronic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934770279 2:96903388-96903410 CTCTGCAGGGTGGGGGAGGCTGG + Intronic
934925582 2:98379948-98379970 GACTGCAGGGTGGAGGGAGAAGG + Intronic
935145258 2:100391154-100391176 GACACCAGGGTGGGGGTGGCTGG - Intergenic
935397648 2:102624748-102624770 GACAGCAGGATGGAGGGAGGTGG - Intronic
936024119 2:109018277-109018299 CAAAGCAGGATGGAGGAAGCAGG + Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936427801 2:112435037-112435059 CTTGGCAGGGTGGAGGGGGCAGG - Intergenic
936710080 2:115121692-115121714 TACAGCAACCTGGAGGGGGCTGG + Intronic
936720919 2:115252295-115252317 CACAGCAAGGTTGAAGGGACAGG - Intronic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
937314686 2:120924123-120924145 CACACCAGGGTGCTGGGGGATGG + Intronic
937329805 2:121019380-121019402 GACGGCTGGGTGGAGGGGGCAGG - Intergenic
937409290 2:121658965-121658987 GGCAGCATGGTGGAGGCGGCTGG + Intergenic
937458551 2:122065915-122065937 CTCAGCAGGGTGGATGAGTCTGG + Intergenic
937791992 2:125971707-125971729 CACAGCATGGTGGCCGGGGAAGG + Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
938074083 2:128322729-128322751 GCCAGCAGGGCGGGGGGGGCGGG - Intergenic
938093537 2:128447942-128447964 CACAGCATTATGGTGGGGGCAGG + Intergenic
938093577 2:128448054-128448076 CACAGCATTATGGTGGGGGCAGG + Intergenic
938093604 2:128448128-128448150 CACAGCATTATGGTGGGGGCAGG + Intergenic
938645832 2:133329250-133329272 CACAGGCCTGTGGAGGGGGCAGG + Intronic
941600421 2:167536757-167536779 AGCAGCAGAGTGGAGGGGCCTGG - Intergenic
941651162 2:168094084-168094106 CACAGCATGCTGGGGAGGGCTGG - Intronic
941908293 2:170737991-170738013 CACAGCATGGTGGCTGGGCCCGG + Intergenic
942385176 2:175435100-175435122 GACAGCTGGGTTGAGGGGGTTGG + Intergenic
942457536 2:176148373-176148395 CATAGGAGGGTGGAGTGGGGTGG + Intergenic
943237998 2:185347573-185347595 CACAGCAGGCTGGTAGGGGCTGG - Intergenic
945006378 2:205411828-205411850 CACAGTAGTGTGGGGGGTGCTGG + Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945259669 2:207831906-207831928 CCCAGCAGGGGAAAGGGGGCTGG - Intronic
945283285 2:208057738-208057760 TGCAGCATGGTGGAGGTGGCTGG + Intergenic
946046668 2:216827102-216827124 CACTCCAGGCTGGAGGGGGATGG - Intergenic
946059864 2:216932765-216932787 CACAGCTAGGAGGAGGGGTCAGG - Intergenic
946455363 2:219821134-219821156 CAAAGCAGGGTTGAGGGGGCAGG + Intergenic
947496848 2:230643913-230643935 AACAGCAGGTTTGAGTGGGCAGG + Intergenic
947585504 2:231353866-231353888 GACAGTAGTGTGGAGGGGGCAGG - Intronic
947641107 2:231708289-231708311 CTCAGCAGGGCCGAGGGCGCGGG - Intronic
947717384 2:232348746-232348768 CATAGTAGGGTGGAGGGAGGTGG - Intergenic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
948055208 2:235005608-235005630 CTAAGCAGGGTGGCGGAGGCGGG - Intronic
948206918 2:236167410-236167432 CGCAGCCGGGACGAGGGGGCGGG - Intronic
948329131 2:237151266-237151288 CAGAGCAGGGTGGACAGGGCAGG + Intergenic
948793834 2:240392248-240392270 GGCGGCAGGGTGGAGGGTGCAGG - Intergenic
948844042 2:240674738-240674760 CACAGCAGGGAAGAGGAGCCAGG + Intergenic
948849768 2:240699897-240699919 CACAGCAGGGAAGAGGAGCCTGG - Intergenic
948940244 2:241191702-241191724 GACAGCAGGGTGGGCGGGGTGGG - Intronic
948991838 2:241559417-241559439 CTCAGCCGGGTGGAGGGAGGCGG - Intronic
1168773777 20:432400-432422 CACTGCAGCATGGATGGGGCAGG - Intergenic
1169392579 20:5202510-5202532 AACTGCAGGGTGGATGGAGCAGG + Intergenic
1170011032 20:11724155-11724177 CACAGCAGGCTGGAAGTGCCAGG - Intergenic
1170046505 20:12091054-12091076 CACAGCAGCTTGGAGGAGACAGG - Intergenic
1171043758 20:21791112-21791134 CACAGCAGAGCGGAAGGGGCAGG + Intergenic
1171279462 20:23883688-23883710 CACAGCCGAGTGGAGAGGACAGG + Intergenic
1171438404 20:25141515-25141537 CACTCCAGGGGGCAGGGGGCAGG + Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1172053652 20:32139049-32139071 CAAAACAGGGTGGAGGGGTGAGG + Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172161957 20:32875137-32875159 CACAGCAGTGTGGGGAGGGGAGG - Intronic
1172588647 20:36102421-36102443 CAGAGCTGGGTGGAGAGGGCTGG + Intronic
1172669376 20:36624199-36624221 CTCAGCAGGAAGGAGGGGTCAGG + Intronic
1172764328 20:37343132-37343154 GAGGGCAGGGTGGAGGGGGTAGG - Intergenic
1172776932 20:37413413-37413435 CGCAGGAGGGTGCAGGGGGGCGG - Intergenic
1173041651 20:39469766-39469788 CACAGAAGGGTGGATCGGCCAGG - Intergenic
1173256069 20:41395070-41395092 CACAGCCGTGTGGGAGGGGCAGG + Intergenic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173703504 20:45093680-45093702 CCCAGCAAGGGTGAGGGGGCTGG + Exonic
1173999283 20:47362594-47362616 CACAGGAGGGTGGAGGGAGATGG - Intergenic
1174554058 20:51381508-51381530 CCCAGCAGGGTGCAGAGGGAGGG - Intergenic
1174725128 20:52853331-52853353 GGCAGCAGAGTGGAGGGGGAGGG - Intergenic
1174862312 20:54102482-54102504 GTCAGCAGGGTGGAAGGGGTGGG + Intergenic
1175221619 20:57420656-57420678 AGCAGCAGGGTGCTGGGGGCGGG + Intergenic
1175264507 20:57694564-57694586 CACAGATGGGTGCAGTGGGCTGG + Intronic
1175319716 20:58076608-58076630 CACAGCTGGGTGGGGTGAGCTGG + Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175482149 20:59319274-59319296 CCCAGCAGGGAGGCGGGGGCGGG + Intronic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1175870212 20:62205812-62205834 CAGAGCGGGGTGGAGGTGACAGG - Intergenic
1175894375 20:62329568-62329590 ACCAGCAGGGTGCAGGGTGCAGG + Intronic
1175970734 20:62685367-62685389 CACAGCAGAGTGGAAGGGAGCGG - Intronic
1176035899 20:63036315-63036337 GACCCCAGGCTGGAGGGGGCCGG - Intergenic
1176073479 20:63238284-63238306 CACTGCAGGGTGGCGGGAGGAGG + Intronic
1176082815 20:63282415-63282437 CACAGCAGGGTAGATGGGGCTGG + Intronic
1176094246 20:63332674-63332696 CACACCAGCGTGGCGGGGGTAGG - Intronic
1176372655 21:6071706-6071728 AACAGCAGGGTGGTCGGGGGGGG + Intergenic
1176374443 21:6080174-6080196 CTTGGCAGGGTGGAGGGGGCAGG + Intergenic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1178668194 21:34567097-34567119 CACAGCAGGATTTAGGGGGTGGG - Intronic
1178879891 21:36441054-36441076 CATGGCAGGGGGGTGGGGGCGGG - Intergenic
1179032442 21:37732250-37732272 CACAGCAGGGTGTGTGGGGCTGG + Intronic
1179424787 21:41267129-41267151 CACAGCAGGATGGCGGTGGGTGG + Intronic
1179548241 21:42126282-42126304 CACAGCAGGGCGTGGGGGGCCGG + Intronic
1179613369 21:42566353-42566375 CAAAGCTGGGAGGAGGTGGCTGG - Intronic
1179627290 21:42655864-42655886 CACAGCAAGGGGCAGAGGGCGGG - Intronic
1179627773 21:42658263-42658285 CCCAGCAGGGTGCAGAGGCCTGG - Intronic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179749032 21:43458071-43458093 CTTGGCAGGGTGGAGGGGGCAGG - Intergenic
1180013240 21:45065078-45065100 CACCGCACGGTGGAGGGTGCTGG + Intergenic
1180216339 21:46325378-46325400 CCCAGGAGGGTGGAGGGGGGAGG + Intronic
1180695012 22:17746217-17746239 TACAGTAGGGAGGCGGGGGCGGG + Intronic
1180870618 22:19144676-19144698 CGTCACAGGGTGGAGGGGGCGGG + Exonic
1181038544 22:20181420-20181442 CACAGCAGTGGGGAGGGGCAGGG + Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181395153 22:22616230-22616252 CACCGAAGGGTGCAGGGAGCTGG + Intergenic
1181670129 22:24422077-24422099 CACTGCAGGGAGGAGAGGGTGGG - Intronic
1181766871 22:25098612-25098634 AACAACTGGGTGGAGGGGGCGGG + Intronic
1181880286 22:25973788-25973810 CTCCCTAGGGTGGAGGGGGCTGG + Intronic
1181916965 22:26289240-26289262 AAGAGCAGGGGGGAGGGGTCAGG - Intronic
1182472487 22:30557128-30557150 CACAGCATGGTGCAGGGTGCAGG + Intronic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1183284514 22:36953599-36953621 TGCAGCAGTGAGGAGGGGGCAGG + Intergenic
1183306727 22:37086726-37086748 TGTAGCAGGGTGGAGGGGTCTGG - Intronic
1183351019 22:37334825-37334847 CAAATCGGAGTGGAGGGGGCCGG + Intergenic
1183608604 22:38882422-38882444 CTCAGCATGGTGGCTGGGGCAGG + Intergenic
1184234288 22:43174776-43174798 CTCAGCAGATTGGAGGGAGCGGG - Intronic
1184246743 22:43239677-43239699 CACACCAGGATGCTGGGGGCTGG + Intronic
1184411767 22:44330307-44330329 CACAGCCGTGGAGAGGGGGCTGG + Intergenic
1184535361 22:45082957-45082979 CATAGCAGGCTGCAGGGGCCAGG - Intergenic
1184681274 22:46073577-46073599 CTCAGTAGGGTGGGGAGGGCAGG - Intronic
1184688731 22:46107996-46108018 CACAGCAGGGTTGGGTGTGCAGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184796406 22:46735972-46735994 CACTCCTGGGTGGAGAGGGCAGG + Intronic
1185029661 22:48435004-48435026 CACAGGATGTTGGAGGGGCCCGG + Intergenic
1185092690 22:48784906-48784928 CATAGCAGGCTGCAGAGGGCAGG - Intronic
1185120318 22:48962403-48962425 AGCAGCAGGGTGGATGGGGGAGG + Intergenic
1185148120 22:49150180-49150202 CCCAGCTGTGTGGAGGGAGCAGG - Intergenic
1185399060 22:50606687-50606709 CACAGGAGGCAGGAGGGCGCAGG - Exonic
949220901 3:1632806-1632828 CACAGCACTGTGGGGAGGGCTGG - Intergenic
950503267 3:13377603-13377625 GGCAGCAGGGTGGAGGAGGATGG + Intronic
950696655 3:14705973-14705995 CAGAGCAGGGTAGAGGGAGATGG + Intronic
951922876 3:27875189-27875211 CAAAGCAGCATGGTGGGGGCAGG + Intergenic
952283750 3:31948023-31948045 CACACCAGAGTGGAGGATGCAGG + Intronic
952852578 3:37741192-37741214 CTCAGCAGGGTGGCTGGTGCTGG - Intronic
953328405 3:42031966-42031988 CACAGCATGGGTTAGGGGGCGGG + Intronic
953374037 3:42413604-42413626 CAGGGCAGGGTGGAGTGTGCTGG + Intergenic
953422154 3:42762463-42762485 CAGGGTAGGCTGGAGGGGGCTGG + Intronic
953681990 3:45046305-45046327 CAGAGCTGGGTGGAGGTGGATGG + Intergenic
953699251 3:45183356-45183378 CAGAGCTGGGTGGAGGTGGATGG + Intergenic
954251495 3:49371096-49371118 CACCGTGGGGTGGAGGGGGCCGG - Intronic
954629780 3:52041540-52041562 CACAGCTAAGTGGAGGGGTCTGG - Intergenic
954796008 3:53161651-53161673 CACGGGCGGGTGGAGGGGCCGGG - Intronic
955093113 3:55771785-55771807 CACAGCAGGCCTGAGGAGGCAGG + Intronic
956103703 3:65794676-65794698 GACAGCAGGGTGGAGGGATAGGG - Intronic
956160795 3:66350220-66350242 CACTGCAGGGAGTAAGGGGCTGG + Intronic
956611385 3:71127075-71127097 CACAGTAGGGTGGAGGTGCCTGG - Intronic
956985770 3:74698469-74698491 TACTGCAGAGTGAAGGGGGCTGG - Intergenic
957055807 3:75442110-75442132 CCCAGCAGGTTGGAGTGCGCTGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
958867583 3:99519065-99519087 GAAAGCAGGATGGAGAGGGCAGG - Intergenic
959645522 3:108695445-108695467 CTCAGCAGGGTGGAGTGTTCTGG - Intergenic
960326349 3:116300511-116300533 CACAGCAGGAGGTAAGGGGCAGG + Intronic
961022613 3:123521660-123521682 CACCACAGGGAGGAGGGTGCAGG + Intronic
961446508 3:126983826-126983848 CCCAGCAGGGCCGCGGGGGCCGG + Intergenic
961487603 3:127227640-127227662 CCCTGCCAGGTGGAGGGGGCAGG + Intergenic
961649019 3:128408292-128408314 CACAGCAGCCTGGACTGGGCTGG - Exonic
961781924 3:129325464-129325486 GGCAGCAGGGTGGAGGAGGATGG + Intergenic
961785192 3:129343320-129343342 GACAGCAAGGTGGTGGGGGGGGG - Intergenic
962413503 3:135161943-135161965 TACTCCAGGGTGGAGTGGGCTGG + Intronic
962676232 3:137760664-137760686 CCCACCAGAGAGGAGGGGGCCGG + Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963234991 3:142947517-142947539 CACAGCTGGGCGCAGGCGGCGGG - Intergenic
963796289 3:149634051-149634073 CACAGTAGGGTGGAGGCAACAGG + Intronic
963806664 3:149729344-149729366 CTCAGCTGGGGGCAGGGGGCAGG + Intronic
965341630 3:167498436-167498458 AATGGCAGGGTGGAGGGGGGAGG + Intronic
965590471 3:170357116-170357138 CGCAGCGGGGAAGAGGGGGCAGG - Intergenic
966227126 3:177609922-177609944 CTCTTCAGGGTTGAGGGGGCTGG + Intergenic
967087488 3:186108525-186108547 CGCAGTTGGGAGGAGGGGGCGGG - Intronic
967124099 3:186409182-186409204 CACAGCAGGGCAGTGTGGGCAGG - Intergenic
967877220 3:194275690-194275712 CACAGCAGAGTGGCAGGGGTGGG + Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968447137 4:657717-657739 CACAGCTGTGCGGCGGGGGCAGG + Intronic
968447233 4:658038-658060 CACGGCTGTGTGGTGGGGGCAGG + Intronic
968447282 4:658198-658220 CACGGCTGTGTGGCGGGGGCAGG + Intronic
968647800 4:1748999-1749021 GAGAGCAGTGGGGAGGGGGCAGG - Intergenic
968745856 4:2359767-2359789 CACTGCAGCATGGAGGGGTCTGG - Intronic
968814894 4:2817242-2817264 CTGTGCTGGGTGGAGGGGGCTGG + Intronic
968915370 4:3494922-3494944 CACAACAGGGTGGCGGGTGAGGG - Intronic
968978628 4:3834904-3834926 CACAGCAGAGAGGAGAGGGAGGG + Intergenic
969530301 4:7726748-7726770 CACAGCAGGGCTTAGGGGCCTGG - Intronic
969614963 4:8247010-8247032 CACAGCTGGGTGGAGGGTGGAGG - Intergenic
969871570 4:10107961-10107983 CACAGGTGGGAGGTGGGGGCTGG - Intronic
970488119 4:16544624-16544646 CCCAACAGGGTAGATGGGGCTGG + Intronic
970721876 4:18997490-18997512 CACAGCAGGGTCGGGGGTGGGGG + Intergenic
972641843 4:40932637-40932659 CACAGGAGGGTGAAGGGGAGGGG + Intronic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
973977876 4:56281144-56281166 CACAGCAGGGGGTAAGTGGCAGG + Intronic
976720939 4:88168060-88168082 GACAGCATCGGGGAGGGGGCAGG + Intronic
977558319 4:98506874-98506896 AAAAGCTGGGAGGAGGGGGCGGG + Intronic
977642803 4:99376261-99376283 TAAAGCAGGGTGGGAGGGGCAGG - Intergenic
977847377 4:101781618-101781640 CAAAGAAGGGTGGTGGGGGTGGG + Intronic
980705587 4:136488811-136488833 CAAAGCAGGGTGGAGGAGAATGG + Intergenic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981655242 4:147105262-147105284 CATGGGATGGTGGAGGGGGCAGG - Intergenic
981871785 4:149495697-149495719 CAGAGCAGGGTGGAGCTGCCAGG + Intergenic
982045910 4:151445449-151445471 CCCAGCAAGGTGGAGTGGGGGGG + Intronic
982407484 4:155036422-155036444 CACTACAGGGTGGAGGTGGGTGG + Intergenic
983054312 4:163083771-163083793 CAGAGCTGGGAGGAGGGTGCAGG + Intergenic
983929042 4:173433497-173433519 CACAGCAGAGTGTACAGGGCGGG - Intergenic
984004741 4:174294726-174294748 CCCAGCAGGGAGGTGGGGGGTGG - Intronic
984610841 4:181835001-181835023 CACAGAAGTGTGGAGGGGAAGGG + Intergenic
985000046 4:185473423-185473445 CACACCAGGGCGCAGGGGGTTGG + Intergenic
985158932 4:187024105-187024127 CACAGCAGAGTGGAGAAGGGTGG - Intergenic
985451505 4:190066014-190066036 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985452495 4:190069307-190069329 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985453480 4:190072604-190072626 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985454470 4:190075897-190075919 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985455458 4:190079190-190079212 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985456443 4:190082484-190082506 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985457430 4:190085784-190085806 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985458417 4:190089077-190089099 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985459406 4:190092377-190092399 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985463658 4:190175146-190175168 GTCAGCCCGGTGGAGGGGGCGGG - Exonic
985511254 5:315487-315509 CACAACTGGGTGGAAGGAGCAGG - Intronic
985626886 5:993644-993666 AACAGCAGGGAGGAGAAGGCTGG + Intergenic
985674473 5:1223893-1223915 GTCAGCAGGGTGAAAGGGGCTGG - Exonic
985722012 5:1494401-1494423 CCCAGCAGCGTGGTGGGGGGGGG + Intronic
985787833 5:1909035-1909057 CACAGCAGGGTTGATGGGGGCGG + Intergenic
985809939 5:2075504-2075526 TGGAGCAGGGTGGAGGGGACGGG + Intergenic
985923051 5:2994477-2994499 CAGAGCAGGGCGGAGGGTGGAGG - Intergenic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986661784 5:10065775-10065797 CACGGCAGGGCGTGGGGGGCGGG - Intergenic
987054974 5:14182864-14182886 CACGGCAAAGTGGAGGGGGGGGG - Intronic
988059457 5:26148679-26148701 CCCAGCAGTGGGGAGGGGGTGGG + Intergenic
989105272 5:37857251-37857273 CAGTGCAGGGTGGGGGGGTCGGG - Intergenic
989170304 5:38466651-38466673 CACAGCAGGGTGCAGTAGGGAGG + Intergenic
990493176 5:56321615-56321637 CACAGCAGGGGGTAAGTGGCAGG - Intergenic
991344421 5:65648132-65648154 GACTGCAGGGTGGAGAGGGAGGG - Intronic
993004164 5:82412815-82412837 CACAGCAGGGTGGGGGCTGATGG - Intergenic
994141013 5:96341340-96341362 CCAAGCAGGGTGGAGGGGTGGGG - Intergenic
995420600 5:111962698-111962720 CACAGAATGGGGGATGGGGCAGG - Intronic
996087354 5:119318679-119318701 GACAGGAGAGGGGAGGGGGCAGG - Intronic
996798707 5:127378747-127378769 TAAAGCAGGGTGTAGGGGGCGGG - Intronic
997239339 5:132295108-132295130 AACAGCAGGTTTGAGGGGGAGGG - Intronic
997942225 5:138168516-138168538 GACAGCAGAGGGGAGGGGGGTGG + Intronic
998038757 5:138937659-138937681 CACAGTGGGGTGGAGGGATCTGG - Intergenic
998134997 5:139669895-139669917 CCCAGTAGGGTGGATGGGGATGG - Intronic
999208783 5:149869730-149869752 AAGAGCAGGATGGAGGGGGATGG + Intronic
999270686 5:150294824-150294846 CACAGGAGATGGGAGGGGGCTGG + Intergenic
999325605 5:150641540-150641562 CACAGGAGGGAGGTGGGGCCGGG - Intronic
999403225 5:151283569-151283591 CACAGCAAGGTGGGTGGGGATGG + Intronic
999636575 5:153629219-153629241 CAAAGCAGGGAGGAAGGGGGAGG - Intronic
999812163 5:155138010-155138032 CACAGCAAGGGAGAGGAGGCTGG + Intergenic
1000247248 5:159459005-159459027 CAAAGCAGGAGGGAAGGGGCAGG - Intergenic
1001081596 5:168671518-168671540 GACAGCAGGGTGGCAGGGGAGGG - Intronic
1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG + Intronic
1001142600 5:169157336-169157358 CACCTCAGGGTAGAAGGGGCAGG - Intronic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1001816916 5:174677148-174677170 CAGAGCAGGGTGGGGTGGGTAGG - Intergenic
1002591726 5:180295314-180295336 CACAGCGGGGTGGAGGAGCTAGG + Intergenic
1002902027 6:1417370-1417392 CACAGCAGGCGGGAGGTAGCCGG - Intergenic
1003175456 6:3750453-3750475 AATTGCGGGGTGGAGGGGGCAGG - Intronic
1004263883 6:14132347-14132369 CAGAGGAGAGTGGAGAGGGCAGG + Intronic
1004562568 6:16763345-16763367 CCAAGCAGGGTGTTGGGGGCGGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005485950 6:26299599-26299621 CACGGGGGGTTGGAGGGGGCGGG + Intergenic
1005959837 6:30686969-30686991 TACAGCGGGGTGGAGACGGCCGG - Exonic
1005968705 6:30744442-30744464 CCCGGGATGGTGGAGGGGGCCGG + Exonic
1006136081 6:31897256-31897278 TGCAGCCGGGAGGAGGGGGCGGG - Intronic
1006175252 6:32117469-32117491 CACAGGAGTGAGGAGAGGGCAGG + Intronic
1006303741 6:33207310-33207332 GAGAGCAGGAGGGAGGGGGCTGG + Intergenic
1006854453 6:37123470-37123492 CCCAGCAGGGTGCAGGCGGATGG + Intergenic
1006906939 6:37539055-37539077 CACACCAGGATGGATGGGGATGG - Intergenic
1006983580 6:38163626-38163648 CACAGCCGGGAGGAGTGCGCAGG + Intergenic
1006984547 6:38168109-38168131 CACAGGAGGTGGGAGGGAGCTGG + Intergenic
1007110913 6:39313227-39313249 CCTAGCAGGGCGGAGGAGGCCGG - Intronic
1007147560 6:39651395-39651417 CACTGCAGGATGGCGGGGGAGGG + Intronic
1007209982 6:40185668-40185690 CACAGCAGGGCAGAGGGTGAGGG + Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007363284 6:41373395-41373417 GACCGCTGGGGGGAGGGGGCAGG - Intergenic
1007785662 6:44277865-44277887 CACATCAGGGTGGAGGTGGTGGG - Exonic
1010756533 6:79671777-79671799 CACCCTAGGGTGGCGGGGGCAGG - Intronic
1011198067 6:84802963-84802985 CAGAGCAGGGTGGAGAAGACTGG - Intergenic
1011228733 6:85136372-85136394 CCCAGCAGGAGGGAGGGGACAGG + Intergenic
1011431718 6:87294353-87294375 CACACAAGGGTGGAGGCTGCAGG + Intronic
1011981301 6:93382436-93382458 CACAGCAGGATGTGCGGGGCAGG - Intronic
1012363282 6:98409213-98409235 CAAAGCGGGGTGGAAGGGACAGG + Intergenic
1012374701 6:98547401-98547423 CAGAGCAGGGTGGAAGGAGAAGG - Intergenic
1012963197 6:105644469-105644491 CACAGCAGAGTGTAGGAGGATGG + Intergenic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1014247304 6:119082011-119082033 CACAGGATGGTGGGGGTGGCAGG + Intronic
1014277099 6:119399561-119399583 AAAAGCAGGCTGGAGGGAGCTGG + Intergenic
1015786424 6:136923809-136923831 GACAGCAGGTTGGCGTGGGCGGG - Intronic
1015831025 6:137369154-137369176 CACAGCAGAGGGCAGAGGGCTGG + Intergenic
1016755149 6:147676856-147676878 AAGATCAGGGTAGAGGGGGCTGG + Intronic
1016796580 6:148124531-148124553 CCCAGCAGGATGGAGTGGGATGG - Intergenic
1016851599 6:148624816-148624838 CACAGAAGGGTGCCAGGGGCAGG + Intergenic
1016879799 6:148899894-148899916 CACAGAAGGGTGATGGGGGGTGG - Intronic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1018692960 6:166363795-166363817 CACAGCACTGTGGAGCAGGCTGG - Intergenic
1018713334 6:166513339-166513361 AACACCAAGGTGGAGGGTGCGGG + Intronic
1018930943 6:168239907-168239929 CAATGCAAGGTGGAGGGTGCGGG - Intergenic
1019024820 6:168950683-168950705 CACAGAAGGGTGCAGGGGTCTGG - Intergenic
1019049006 6:169169069-169169091 CAGAGCACGGTGGAGGGTGGGGG + Intergenic
1019219684 6:170463796-170463818 GACAACTGGGAGGAGGGGGCTGG + Intergenic
1019267331 7:125209-125231 CAGCACAGGGTGGAGGGGCCAGG - Intergenic
1019269956 7:141434-141456 CACAGCTGAGTGGAAGGAGCTGG + Intergenic
1019384799 7:748600-748622 CAGAGCAGGGGGGATGGGGGCGG - Intronic
1019497581 7:1347650-1347672 CACAGCAGGGTGCAGGGCACAGG - Intergenic
1019587774 7:1814314-1814336 GAAAGCAGGGTGGTGGGGGCTGG + Intergenic
1019731972 7:2633513-2633535 CACAGCAGGGAGGAGGGAGGCGG + Intronic
1020201274 7:6081760-6081782 AACAGCAGGGAGGAGCGGCCCGG - Intergenic
1021644668 7:22777222-22777244 AACAGTGGGGTGGAGGGGGTGGG + Intergenic
1021820785 7:24495353-24495375 CACAGGAGGATGGAGGATGCTGG - Intergenic
1022096025 7:27142342-27142364 CGGGGCAGGGCGGAGGGGGCAGG - Intronic
1022381733 7:29866760-29866782 CAGAGCAGGAAGGAGTGGGCAGG - Intronic
1022648853 7:32256628-32256650 CACAGCAGGGTGGGGGAACCTGG - Intronic
1022950612 7:35334505-35334527 CACAGCATGATGGATGGGGTGGG + Intergenic
1023473656 7:40552765-40552787 CAAAGCTGGGTGGTGGGGGTGGG - Intronic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1023850889 7:44149719-44149741 CTCAGCAGTCTGGAAGGGGCAGG + Intronic
1024226525 7:47329877-47329899 GGCAGCAGGGAGGAGGAGGCAGG + Intronic
1024260201 7:47568621-47568643 CACCGCAGAGTGGAGGCCGCAGG - Intronic
1024261281 7:47576021-47576043 CAGAGCCGGGTGGACAGGGCTGG - Intronic
1024527866 7:50363836-50363858 GACAGCAAGGTGGAGGTGGATGG - Intronic
1024809590 7:53192231-53192253 TACAGCGGGGTGGCGGAGGCGGG + Intergenic
1025019926 7:55472899-55472921 TGCAGTAGGCTGGAGGGGGCGGG + Exonic
1026844416 7:73689955-73689977 TACAGCAGGGCGGAGGGGAAGGG + Intronic
1026867657 7:73833358-73833380 AACAGCGGGGTGGGGGTGGCAGG - Intergenic
1027269061 7:76510465-76510487 CACAGCAGGGAGGAGCTGGGGGG - Intronic
1028467448 7:91168916-91168938 CCCAGCACAGTGGAGGGGGAGGG - Intronic
1029279900 7:99428880-99428902 CAAAGCAGGGTGGGAGGGGCGGG + Intronic
1030014602 7:105206150-105206172 CACAGCTGGGTGGTGGGGTGGGG - Intronic
1030116043 7:106063063-106063085 GACAGGAGGGTGGAGGAGGGTGG - Intergenic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1033439633 7:141367078-141367100 GACAGCAGGGGGGAGGGGTGGGG + Intronic
1033718074 7:144023960-144023982 ATCTGCAGGGTGGAGGGGACAGG - Intergenic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034255646 7:149723281-149723303 GACAGCATGGTGGAGGGGCCGGG + Intronic
1034418779 7:150978360-150978382 CGCGGCAGGCGGGAGGGGGCCGG - Intergenic
1034518344 7:151599747-151599769 CACAGCAGGAGGCAAGGGGCGGG - Intronic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1034716313 7:153245805-153245827 CAGAGCAGGGTGGAGAGTGGTGG - Intergenic
1034959479 7:155356021-155356043 CAAAGCAGTGTGGCAGGGGCTGG - Intergenic
1035019894 7:155794574-155794596 CTCAGGAGGGGGGTGGGGGCAGG + Intergenic
1035690576 8:1557027-1557049 CTCAGCACGGGGGTGGGGGCTGG + Intronic
1035748191 8:1976562-1976584 CACAGCAGGGTGGGGGGTGGGGG - Intronic
1036552439 8:9827092-9827114 GCCCGCAGGGTGGAGGGAGCAGG + Intergenic
1036566917 8:9945648-9945670 CACAGCAGTGAGGTGGGGGAAGG - Intergenic
1036597274 8:10225288-10225310 CAAAGAAGGGTTGAGGGGGAAGG - Intronic
1037636764 8:20707145-20707167 ATAAGCAGTGTGGAGGGGGCAGG + Intergenic
1037987653 8:23299750-23299772 CACAGCAGGGGGGCGGGTACAGG + Intronic
1038207338 8:25479240-25479262 CACAGCAGGGAGGAGGGAGAGGG - Intronic
1038951352 8:32417717-32417739 CACACGGGGGTGGAGGGGGAGGG + Intronic
1039048503 8:33472276-33472298 TGCAGCAGGGAGCAGGGGGCAGG + Intronic
1039546335 8:38413835-38413857 CTGAGCAGGGAGGAGGGGCCCGG - Intronic
1039553541 8:38460508-38460530 CACACCTGGGAGGAGGCGGCAGG - Intronic
1040060252 8:43097637-43097659 CGCAGCGGGGTGGAGGGGAAGGG + Intronic
1040299382 8:46180092-46180114 GGCCGCAGGGTGGAGTGGGCGGG - Intergenic
1040299830 8:46182170-46182192 GACAGCAGGGTGGGCTGGGCAGG - Intergenic
1040305544 8:46209950-46209972 GGCAGCAGGGTGGCGTGGGCAGG + Intergenic
1040305593 8:46210163-46210185 CTCCGCAGGGTGGCGTGGGCTGG + Intergenic
1040318058 8:46275418-46275440 GGCAGCAGGGTGGGGTGGGCAGG + Intergenic
1040325855 8:46341144-46341166 CACAGCAGGGTGGCATGGGCGGG + Intergenic
1040332131 8:46391089-46391111 AACTGCAGGGTGGTGGGGGTGGG + Intergenic
1040334890 8:46411038-46411060 GGCAGCAGGGTGGCGTGGGCGGG + Intergenic
1040335756 8:46415115-46415137 GACTGCAGGGTGGCGTGGGCGGG + Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1040595629 8:48835040-48835062 CGCAGCAGGGTGGAGCGCGAGGG - Intergenic
1040900718 8:52414561-52414583 CAAAGCTGGGGGGAGGGGGGCGG + Intronic
1040973622 8:53165022-53165044 CACAGCATGGTGAAGGGGAAGGG - Intergenic
1041738218 8:61133285-61133307 CACAGGAGGGTAGAGGAGGCAGG + Intronic
1042663627 8:71182120-71182142 TATAGCTGGATGGAGGGGGCAGG + Intergenic
1042742235 8:72062865-72062887 CACAGCCAGGTGGAGAGGGGTGG + Exonic
1042757926 8:72238122-72238144 CACAGCCAGATGGAGAGGGCTGG + Intergenic
1042759137 8:72251998-72252020 CACACACGGTTGGAGGGGGCAGG - Intergenic
1043147083 8:76672857-76672879 CACTGCAGGCAGGAGTGGGCTGG - Intergenic
1043306581 8:78803963-78803985 GACAGCTGGGGGGAGGGTGCGGG - Intronic
1044313897 8:90727193-90727215 CACTGAAGGGTAGAGGGGGTGGG - Intronic
1044632531 8:94293182-94293204 GACAGCAGGGAGCAGGGAGCAGG + Intergenic
1045251521 8:100487039-100487061 AACAGGAGTGTGGAAGGGGCAGG - Intergenic
1047301617 8:123618326-123618348 CACAGCAGGAGGTGGGGGGCAGG + Intergenic
1047347186 8:124039741-124039763 CAGAGGAGGGTGGATGTGGCTGG + Intronic
1047412534 8:124636012-124636034 CACTGGAGGGTGGAGGGTGCAGG + Intronic
1047696966 8:127413433-127413455 TACAGCTAGGTGAAGGGGGCAGG - Intergenic
1048066131 8:130970586-130970608 CACACCAGGGTGGAGGGGGATGG - Intronic
1048395610 8:134011303-134011325 CACAGTCAGGTGCAGGGGGCGGG + Intergenic
1048615139 8:136065995-136066017 CACAGCAACGTGGATGGGGCTGG + Intergenic
1048641726 8:136370402-136370424 CACAGGATGGGGGATGGGGCAGG + Intergenic
1048842398 8:138577350-138577372 CACTGCTGGATGGAGGGGACGGG + Intergenic
1048987016 8:139740194-139740216 GACAGGAGGGAAGAGGGGGCCGG - Intronic
1049218101 8:141416974-141416996 CAGAGCAGGGTGGAGCGGCAAGG - Intronic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049280663 8:141742518-141742540 CAGAGCTGGGTGCAGTGGGCTGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049361139 8:142213049-142213071 GACAGGAAGGTGGAGGGGGAAGG - Intronic
1049383585 8:142329968-142329990 CCCACAAGGGTGGAGGGTGCTGG - Intronic
1049545063 8:143226743-143226765 CAGAGAAGGATGGAGAGGGCAGG - Intergenic
1049560187 8:143306469-143306491 CACAGCAGGGTGGGGGTCGAGGG - Intronic
1049564666 8:143331882-143331904 CAGGGCGGGGTGGAGGAGGCGGG + Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049743122 8:144250432-144250454 CAGAGCCGGGTGGAGGGCTCGGG - Intronic
1049792105 8:144476857-144476879 CACAGCAGAGAGGTGGTGGCAGG - Intergenic
1049998157 9:1050599-1050621 CACTGGATGGTGGAGGGGGAGGG - Exonic
1051346379 9:16154708-16154730 GACAGAAGGGTGGAGGGAGCGGG - Intergenic
1051449380 9:17178501-17178523 CACAGCAGGGCGGGGGCGGGGGG + Intronic
1051484614 9:17594473-17594495 CACACCAGGGTCTATGGGGCGGG + Intronic
1052353901 9:27484750-27484772 CAGGGCAGGGTAGAGGAGGCCGG - Intronic
1052855270 9:33402913-33402935 AACAGCCAGGTGGAGGGGACGGG + Intergenic
1053184103 9:36000613-36000635 AAAAGCAGGGTGGTGGCGGCAGG + Intergenic
1053554537 9:39121942-39121964 AAAAGAAGGGTAGAGGGGGCTGG - Intronic
1053707112 9:40767610-40767632 CCCTGCAGGGTGGAGGGCCCAGG - Intergenic
1053818629 9:41942063-41942085 AAAAGAAGGGTAGAGGGGGCTGG - Intronic
1054108893 9:61085721-61085743 AAAAGAAGGGTAGAGGGGGCTGG - Intergenic
1054417025 9:64888378-64888400 CCCTGCAGGGTGGAGGGCCCAGG - Intergenic
1054611964 9:67245404-67245426 AAAAGAAGGGTAGAGGGGGCTGG + Intergenic
1054870981 9:70046826-70046848 CACTCCAGGGTGGAGCAGGCAGG + Intronic
1056246446 9:84700092-84700114 CACAGCTGGTAGGAGGGGACAGG + Intronic
1057315603 9:93966500-93966522 CACAGCAAGGTGGCGGCTGCAGG - Intergenic
1057825819 9:98371316-98371338 CCCAGTAGGGTGAAGGTGGCAGG + Intronic
1057832241 9:98416412-98416434 CAGAGCAGGATAGAGAGGGCAGG - Intronic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1058234199 9:102468683-102468705 TACAGCAGGGTGGAGGGTTGAGG + Intergenic
1058890036 9:109353816-109353838 CTCAGCAAGGTGGCGGGGGCTGG - Intergenic
1059083155 9:111271673-111271695 TTCAAAAGGGTGGAGGGGGCAGG - Intergenic
1060003507 9:119979774-119979796 CACAGCAGGGCAGAGGGGACTGG - Intergenic
1060202068 9:121657112-121657134 GACAGCAGGATCCAGGGGGCAGG - Intronic
1060412188 9:123407148-123407170 CAGAGCAGGGGGGGAGGGGCGGG + Intronic
1060973629 9:127752955-127752977 AGCACCAGGGTGGAGAGGGCAGG + Intronic
1060977955 9:127776517-127776539 CACAGCTGGGGGCAGGGGGAGGG - Intronic
1061376294 9:130226633-130226655 CATAGCTGGGAGGAGGAGGCTGG + Intronic
1061396337 9:130345864-130345886 CAGGGTAGGGCGGAGGGGGCAGG + Intronic
1061618350 9:131794564-131794586 CTCTGCAGGGAGGAGGGGACGGG + Intergenic
1061658840 9:132114307-132114329 CGCAGGCGGGTGGAGGAGGCTGG + Intergenic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061919649 9:133775914-133775936 CCCAGCAGGGTGGAGGCCCCAGG - Intronic
1061958239 9:133974723-133974745 CACTGCTGGGTGCAGGGCGCAGG - Intronic
1062071116 9:134555504-134555526 CAGAGCTGGGCAGAGGGGGCAGG + Intergenic
1062312817 9:135948520-135948542 CAGGGCAGGGTGGCGGGGGATGG - Intronic
1062386005 9:136311818-136311840 CACAGCAGGGCTGGGGGGCCGGG - Intergenic
1062430185 9:136523447-136523469 CACGGCAGGAGGAAGGGGGCAGG + Intronic
1062562488 9:137147832-137147854 CACGGCAGGGTGGGGGCGGCAGG + Intronic
1062590345 9:137271830-137271852 GACAGGAGGGTGGAGGGAGGGGG - Intronic
1062696237 9:137877693-137877715 CGCGGCAGGGTGGGCGGGGCCGG + Intergenic
1062736740 9:138141547-138141569 CACGGCAGGGCGTCGGGGGCAGG + Intergenic
1203740264 Un_GL000216v2:171824-171846 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1185769190 X:2752195-2752217 AACAGGAGGGTGGAGAGGCCGGG + Exonic
1185891755 X:3828271-3828293 CACAGCAGGGACAAGGGGCCGGG - Intronic
1185896863 X:3866687-3866709 CACAGCAGGGACAAGGGGCCGGG - Intergenic
1185901981 X:3905113-3905135 CACAGCAGGGACAAGGGGCCGGG - Intergenic
1185925955 X:4146715-4146737 CTCAGAAGGGTGGGCGGGGCTGG - Intergenic
1186578347 X:10790387-10790409 CACAGCAGGGGAGAGAGGGGTGG - Intronic
1187839374 X:23471091-23471113 CACAGCAGGGTAGAAAAGGCTGG - Intergenic
1188181435 X:27060808-27060830 CTCAGAAGGGTGGAGGGGAAGGG - Intergenic
1189353640 X:40295681-40295703 CACAGCAGCGTGGGGAGAGCCGG + Intergenic
1190028778 X:46951761-46951783 AACAGCAGAATGGAGGAGGCAGG - Intronic
1190128690 X:47726811-47726833 CAGAGCAGGGTGGTGGGGGGAGG - Intergenic
1190275083 X:48894051-48894073 CAGAACAGGGTGGAAGGGGCTGG + Intronic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1191057210 X:56254392-56254414 CACAGCAGAGTCCGGGGGGCGGG + Intronic
1191902835 X:66056629-66056651 CACAGCAGGCGGGCGGGGGTGGG + Intergenic
1192420272 X:71023095-71023117 AACAGAGGGGTGGAGGGGGATGG + Intergenic
1192497183 X:71623591-71623613 GGCAGGAGGGTAGAGGGGGCTGG + Intergenic
1192549324 X:72041572-72041594 CTCAGGAGAGTGGAGGGGGCTGG + Intergenic
1193777800 X:85665041-85665063 CACACCAGGGTGGGGGGAGGGGG + Intergenic
1194057022 X:89148115-89148137 TACAGCAGCGTGGATGGAGCTGG + Intergenic
1194945219 X:100058748-100058770 CAAAGGAGGGTGGAGAAGGCTGG + Intergenic
1195321634 X:103726008-103726030 GACAGCAGGCAGGAGGGAGCAGG - Intronic
1196156012 X:112431165-112431187 CATGGTAGGTTGGAGGGGGCTGG + Intergenic
1196616169 X:117769304-117769326 CACAGCGGGGGGCAGGGGGGGGG - Intergenic
1197776013 X:130119219-130119241 CACAGCTGGCTGGAGGGGGTGGG - Intergenic
1198169722 X:134093812-134093834 CAAAGAAGGGTGGTGGGGGTGGG - Intergenic
1198454157 X:136798918-136798940 CAAAGCAGGTAGGAGGGGCCAGG + Intergenic
1198803396 X:140470213-140470235 GGCAGCAGAGTGGAGGTGGCTGG - Intergenic
1199768159 X:150955429-150955451 AACAGAAGGGTGGATGGGTCAGG - Intergenic
1199975412 X:152892341-152892363 CTCAGCATGGGGGAAGGGGCTGG - Intergenic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1200134942 X:153870297-153870319 CACCGCGGGGTATAGGGGGCTGG - Intronic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic
1200766366 Y:7083900-7083922 CCAGGGAGGGTGGAGGGGGCTGG - Intronic
1201073665 Y:10171143-10171165 CACGGGAGGGTGGAGCGGGGAGG + Intergenic
1201145554 Y:11063406-11063428 CACAGCAGGAATGAGAGGGCAGG + Intergenic
1201179913 Y:11333693-11333715 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1202046179 Y:20738962-20738984 CCATGGAGGGTGGAGGGGGCTGG - Intergenic