ID: 1136103508

View in Genome Browser
Species Human (GRCh38)
Location 16:28012237-28012259
Sequence GTGTTTAAGGGGTGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 424}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136103508_1136103520 14 Left 1136103508 16:28012237-28012259 CCCTCCCACCACCCCTTAAACAC 0: 1
1: 0
2: 1
3: 24
4: 424
Right 1136103520 16:28012274-28012296 CTGTTATGGCACACATCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 89
1136103508_1136103516 0 Left 1136103508 16:28012237-28012259 CCCTCCCACCACCCCTTAAACAC 0: 1
1: 0
2: 1
3: 24
4: 424
Right 1136103516 16:28012260-28012282 AGCCTATTAATACCCTGTTATGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136103508 Original CRISPR GTGTTTAAGGGGTGGTGGGA GGG (reversed) Intronic
900351524 1:2237217-2237239 GTGGGTGAGGGGTGGTGGGAGGG + Intronic
902042768 1:13504716-13504738 GTGTTGAAGGGGGGAGGGGAGGG + Intronic
902111805 1:14085425-14085447 GTGGTCAGGGGGTGGTGAGAAGG - Intergenic
902547007 1:17196426-17196448 GTGTTGAGGGCGTGGAGGGAAGG - Intergenic
903380812 1:22895868-22895890 GAGTTTAGTGGGTGGTGGAAGGG + Intronic
905199942 1:36308395-36308417 GAGGATAAGGGCTGGTGGGAAGG + Exonic
905668686 1:39777732-39777754 GGGTCTGAGGGGAGGTGGGATGG - Intronic
906420897 1:45666039-45666061 GTTTTTGAGGGGTGGGGGAAAGG - Intronic
906422989 1:45686608-45686630 GTGTGTAAGGCGGGGTCGGACGG - Exonic
906700992 1:47857887-47857909 GTGGATAAGGGGTGGGGGGTGGG - Intronic
907580566 1:55568550-55568572 GTGATTAAGGGGTCTTGAGAGGG + Intergenic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
908914197 1:69107213-69107235 ATGTTTTAATGGTGGTGGGATGG + Intergenic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
910475234 1:87598778-87598800 GTGATTAAGAGGTGGTGAAAGGG + Intergenic
910749397 1:90612405-90612427 GTTTTAGAGGGGTGGAGGGATGG - Intergenic
910875309 1:91872958-91872980 TTTTTGACGGGGTGGTGGGAGGG + Intronic
911710571 1:101066952-101066974 CTGTTCAGGGGGTGGAGGGAGGG - Intergenic
912063711 1:105707639-105707661 GTGTAAATGGGATGGTGGGATGG + Intergenic
912440220 1:109691958-109691980 TTATGTAAGAGGTGGTGGGAAGG + Intronic
912443542 1:109716343-109716365 TTATGTAAGAGGTGGTGGGAGGG + Intronic
913248589 1:116892329-116892351 GTGTTGAAGGGGTGGTGAGAAGG - Intergenic
913252413 1:116922829-116922851 GTTTCTAAGGACTGGTGGGAGGG - Intronic
913466340 1:119147092-119147114 GTGTTGGAGAGGTGGTGGGTGGG + Intergenic
914957681 1:152178993-152179015 CTGTTTTTGGGGGGGTGGGAGGG - Intergenic
915054969 1:153119861-153119883 GTGTTGAAAGAGTGCTGGGAGGG + Intergenic
915911456 1:159918197-159918219 GTGGCTAAGGGGTGGGGTGAGGG - Exonic
916065333 1:161132033-161132055 GTGTTAAATTGGAGGTGGGAGGG - Intronic
916726420 1:167527596-167527618 GTGTGCAGGTGGTGGTGGGAGGG - Intergenic
917105275 1:171485634-171485656 GGGTTAAAGGGGTGGCCGGAAGG - Exonic
917921405 1:179753655-179753677 GTGTGTATATGGTGGTGGGAAGG + Intronic
918625665 1:186653575-186653597 ATGTTTAAGTGCTGATGGGAAGG + Intergenic
919407233 1:197200908-197200930 GTGGTTTAGGGGTGCTGGGATGG + Intergenic
919883262 1:201914841-201914863 AGGTTTAAAGGGTGGTGGGAAGG - Intronic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920077615 1:203348640-203348662 GTGTTTGTGGTGTGGTGGTAAGG + Intronic
920440651 1:205978539-205978561 GTGTTTGAGGGGTGGATGGGTGG + Exonic
920700386 1:208213808-208213830 GTGCTGAAGGGGTGGAGGCAAGG + Intronic
920956275 1:210622765-210622787 AGGTTTAGGGGGTGGTTGGATGG + Intronic
922694523 1:227722051-227722073 GAGTTTGGGGGGTGGTGGGTAGG + Intergenic
923041791 1:230324927-230324949 GTGTGTTAGGGGTGTGGGGAAGG + Intronic
1063106094 10:2993710-2993732 GTGGTTAGGGGGTGCTGGGATGG - Intergenic
1063309405 10:4938216-4938238 AAGTTTAAGAGATGGTGGGAAGG + Intronic
1063618136 10:7620167-7620189 GGGGGTAGGGGGTGGTGGGATGG - Intronic
1064329356 10:14379312-14379334 GGGTTCAAGGGCTTGTGGGAAGG - Intronic
1068962832 10:62882727-62882749 GTAGTGGAGGGGTGGTGGGATGG - Intronic
1069624814 10:69861104-69861126 GTGCCTGAGGGCTGGTGGGACGG - Intronic
1069787144 10:70996171-70996193 GTTGTTAAGGGGTGCTGGGTGGG + Intergenic
1070826224 10:79391918-79391940 GTGGCTGAGGGGTGGTAGGAGGG - Intronic
1071132448 10:82410530-82410552 GTGGCTAAGGGGTGGAGGGAAGG + Intronic
1071446083 10:85748828-85748850 GTGTTTGAGGAGTTTTGGGATGG - Intronic
1071450244 10:85786863-85786885 GTGGAGGAGGGGTGGTGGGAGGG + Intronic
1072019832 10:91387336-91387358 GTGATTAAGGGGACTTGGGAAGG + Intergenic
1072175807 10:92920527-92920549 ATGTTTTGGGGGTGGTTGGAGGG - Intronic
1073069524 10:100784340-100784362 GGGACTAAGGGGTGTTGGGATGG + Intronic
1074134784 10:110616941-110616963 GTGTGTGTGGGATGGTGGGAAGG + Intergenic
1074206278 10:111285768-111285790 GTGTGTAAAGAGGGGTGGGAGGG + Intergenic
1074860200 10:117504157-117504179 CTTTCTAGGGGGTGGTGGGATGG - Intergenic
1075944445 10:126420034-126420056 GTGTTGAGGGGGTGGGAGGAGGG + Intergenic
1076096322 10:127737150-127737172 GTGTTTAAAGGGCGGAGGGCTGG + Intergenic
1077104823 11:837647-837669 GTGTCTACGAGGTGGTGGGGGGG + Intronic
1077321603 11:1945377-1945399 GTGTTCAATGGCAGGTGGGAAGG + Intergenic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1080170129 11:29291213-29291235 GTGTGTGAGGGGCGGTGGGGGGG + Intergenic
1080294950 11:30715833-30715855 AAGTTTAAGGGGTGGAGTGAAGG + Intergenic
1080523360 11:33088162-33088184 GTGTTTAACGGTGGGTGGTATGG - Intronic
1080691532 11:34562792-34562814 GTGTCCTTGGGGTGGTGGGAAGG + Intergenic
1081192650 11:40122755-40122777 GTGTTTGTTGGGTGGGGGGAGGG - Intronic
1081660561 11:44885573-44885595 GTGCTTCAGGGGTTGGGGGAGGG - Intronic
1083204919 11:61142796-61142818 GACTCTAAGGGGTGGGGGGAGGG + Intronic
1084426103 11:69085316-69085338 GTGTCTCAGGGGTGCTGGGGTGG + Intronic
1084617140 11:70244089-70244111 GGGTTTCAGGGGTGGAGGGCAGG + Intergenic
1085058549 11:73423671-73423693 GTGGTTAAGGGGTGGGGAGAAGG - Intronic
1087077402 11:94137668-94137690 GGGTGAAAGGGGTGGTGGGGAGG + Intronic
1087492613 11:98847285-98847307 GTGGGTGAGGTGTGGTGGGAGGG - Intergenic
1088554654 11:111049381-111049403 TTGTTTATTTGGTGGTGGGATGG - Intergenic
1088986108 11:114909972-114909994 GTGTTGGTGGGGTGGTGGCAGGG - Intergenic
1089090762 11:115872954-115872976 AGGTGTAAGGGGTGGTAGGAGGG + Intergenic
1089298698 11:117484937-117484959 GTGTGTAAGTGGGGCTGGGAGGG + Intronic
1089636423 11:119816425-119816447 GTTTTCAAGAGGTGGTGGTAGGG - Intergenic
1090344581 11:126059461-126059483 GGGTTGAGGGGGTGGAGGGAAGG - Intronic
1090407953 11:126488695-126488717 GTGGCTCATGGGTGGTGGGAGGG - Intronic
1090793560 11:130113929-130113951 GTGTGTGAGGGGTACTGGGAAGG - Intronic
1090814343 11:130278570-130278592 GTGTTTAATGGTATGTGGGATGG + Intronic
1091297656 11:134485368-134485390 GTGTGTAGGTGGTGGTGGGGAGG + Intergenic
1202804621 11_KI270721v1_random:690-712 GTGTTCAATGGCAGGTGGGAAGG + Intergenic
1092997230 12:13961886-13961908 GTGTGAGAGAGGTGGTGGGAGGG + Intronic
1093842325 12:23919122-23919144 GTGTGTTTGGGGTGGTGGGGAGG + Intronic
1095189791 12:39244325-39244347 GTGTGTGTGGGGTGGTGGGGGGG + Intergenic
1095308793 12:40669935-40669957 GTGGGGAAGGGGTGGTGGGGAGG + Intergenic
1095721068 12:45401539-45401561 GGGTGCAGGGGGTGGTGGGAAGG - Intronic
1095988140 12:48014230-48014252 ATGTGCAGGGGGTGGTGGGAAGG + Intergenic
1096122839 12:49099500-49099522 GTATTTAGGGGGAGGTAGGAGGG + Intronic
1096693146 12:53333324-53333346 TTGTTTTAAGGGTGGTGGGGTGG - Intronic
1097028007 12:56072558-56072580 GTGTTTTTGGGGTGGTGGGGCGG + Intergenic
1099469382 12:83028406-83028428 GTGTATCTGGGGTTGTGGGAAGG - Intronic
1100207167 12:92363421-92363443 ATGTTCAAGGGGAGGTGGAAGGG + Intergenic
1100396137 12:94187942-94187964 GTGTTTAGGGGTTGGGGAGAAGG + Intronic
1101334165 12:103781571-103781593 ATGTTTAATGGCTGATGGGAAGG - Intronic
1101399456 12:104375089-104375111 GGGTGTGAGGGGTGGTGGGCTGG + Intergenic
1102010913 12:109617841-109617863 GTTTTAATGGGGTGTTGGGAGGG + Intergenic
1102220792 12:111193123-111193145 GTCTTTAAGGGTTGGTGGTCAGG + Intronic
1104024806 12:125017988-125018010 GTGTGTGTAGGGTGGTGGGATGG + Intronic
1104081421 12:125433668-125433690 GTGAATAATGGGTGGGGGGAGGG - Intronic
1104911278 12:132241812-132241834 GTGTTTAATGGGTATAGGGAGGG - Intronic
1105576405 13:21657145-21657167 GTGTGTGGGGGGTGTTGGGAGGG + Intergenic
1105971463 13:25432555-25432577 GTGCTTGTGGGCTGGTGGGAGGG + Intronic
1106205723 13:27592335-27592357 GTGTTCATGGGCTGATGGGAGGG + Intronic
1106223696 13:27769324-27769346 GTGTGTAAGTGGTGGTGAGGTGG + Intergenic
1106302051 13:28476194-28476216 TTGTTTGAGTGGTGGTGGGGAGG + Intronic
1107440845 13:40425961-40425983 CTGTTTCAGGGCTGGTGGGGTGG + Intergenic
1107522742 13:41199621-41199643 TTGTGTAAGGGGTAGTGGGGAGG + Intergenic
1108110783 13:47069612-47069634 GTGTTGAAAGGGAGGTGGAAAGG + Intergenic
1108492384 13:50994258-50994280 TGTTTTAAAGGGTGGTGGGAAGG - Intergenic
1108986809 13:56600591-56600613 GTGATTCAGTGGTGGTGGGCTGG - Intergenic
1111968235 13:94882794-94882816 GTGTTTGGGGGGTGGGGGGCGGG - Intergenic
1112200715 13:97271571-97271593 GGGTTTACGGGGTGAGGGGAGGG - Intronic
1113861217 13:113488845-113488867 GTGTACATGGGGTGGGGGGAAGG + Intronic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1115471116 14:33769718-33769740 GTCTTTCAGGGCTGGTTGGAGGG - Intronic
1118081028 14:62361203-62361225 CTGTTTAAGAGGCTGTGGGAGGG + Intergenic
1119279709 14:73395324-73395346 ATTTTAAAGGGGTGGTGGGCTGG + Intronic
1119637856 14:76291368-76291390 TTTTGCAAGGGGTGGTGGGAGGG - Intergenic
1120317744 14:82917562-82917584 GAGTATATGTGGTGGTGGGATGG + Intergenic
1121586352 14:95065554-95065576 GAGTGTGAGGGGTGGTGGGAGGG - Intergenic
1123112482 14:105879867-105879889 GTGTGTAAGTGGTTGGGGGAGGG + Intergenic
1123114822 14:105889933-105889955 GTGTGTAAGTGGTGGCAGGAAGG + Intergenic
1123432112 15:20226786-20226808 GTGTGTGAGGGGTGGAGGGGGGG - Intergenic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1127797496 15:62451264-62451286 GTGTCTAGGGCGTGGTGTGAGGG + Intronic
1128319985 15:66686441-66686463 GTGGTTGAGGGGGGCTGGGAAGG + Intergenic
1130686478 15:86042023-86042045 TTGTTTTAGGGGGGGTGGGGTGG + Intergenic
1131157892 15:90086038-90086060 GTGTCTAAGGAATGGTGTGAAGG - Intronic
1132042994 15:98540914-98540936 GTGGTTATGGGGATGTGGGATGG + Intergenic
1132992530 16:2804290-2804312 GTGTTATAGGGGTGGGGAGAAGG - Intergenic
1134914544 16:18058960-18058982 GTGTTTGAGGGTATGTGGGAGGG + Intergenic
1136103508 16:28012237-28012259 GTGTTTAAGGGGTGGTGGGAGGG - Intronic
1136852526 16:33624353-33624375 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1137723559 16:50641903-50641925 CTGTTTAAGGAGTGCTGGGCGGG - Intergenic
1138741239 16:59313099-59313121 GTGTGTATGGGGTGGGGGTAGGG - Intergenic
1138790632 16:59899744-59899766 GTCTTTATGGGGAGGGGGGAGGG + Intergenic
1138970440 16:62136299-62136321 GTGTTTATGGGGGGGGGTGAGGG + Intergenic
1139220881 16:65180359-65180381 TTGTTTAAAGGGAGGTTGGAAGG - Intergenic
1140663875 16:77211947-77211969 GCGTTTAGGGGGAGGTGGGTGGG + Intronic
1140872672 16:79121494-79121516 CTGTTTACGGGGCTGTGGGATGG + Intronic
1141118847 16:81335139-81335161 GTGACTATGGGGTGGGGGGAGGG + Intronic
1141877149 16:86833666-86833688 GCGTTTCAGAGGTGGAGGGAGGG + Intergenic
1141971636 16:87487954-87487976 GTGGTCAAGGGTTGGGGGGAGGG + Intronic
1203114126 16_KI270728v1_random:1472821-1472843 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1142802401 17:2354828-2354850 GTGTGTAAGGGTTGGGGGCAGGG + Intronic
1142863097 17:2775471-2775493 GTGTTAAGTGGGTGGTGGGGAGG + Intergenic
1143266799 17:5644095-5644117 TTTTTCAAGGGGTGGTAGGATGG + Intergenic
1143317084 17:6040986-6041008 GTGCTAAAGGGGTGTGGGGAAGG - Intronic
1143395079 17:6587947-6587969 GTCTGTAAGTGGGGGTGGGAGGG + Intronic
1143490606 17:7283411-7283433 GTGTCTCGGGGGTGGTGGAAAGG + Intronic
1143514329 17:7411772-7411794 GTGTTAGAGGTGGGGTGGGAGGG - Intronic
1143873232 17:9972768-9972790 GTGTTTAGGAGTTGGGGGGATGG - Intronic
1144328550 17:14204684-14204706 GTGTGTAGGGGGTGAGGGGAGGG - Intronic
1144887459 17:18473071-18473093 GTGGTTAGGGGCTGGTAGGAGGG - Intergenic
1145144758 17:20471223-20471245 GTGGTTAGGGGCTGGTAGGAGGG + Intergenic
1145176208 17:20702620-20702642 GTGGTTAGGGGCTGGTAGGAGGG + Intergenic
1145897134 17:28465698-28465720 GTGTGTATGGGGTGGGGGAAGGG + Intronic
1146032200 17:29375949-29375971 GTGTATGTGGGGTGGTAGGAAGG + Intergenic
1146279300 17:31534799-31534821 GTGTTTTGGGGGTGGGGCGAGGG + Exonic
1147426926 17:40350344-40350366 GTGTGTATGGGGGGGTGGAAGGG + Intronic
1147652136 17:42068809-42068831 GGCTTTAAGGAGAGGTGGGATGG - Intergenic
1147733807 17:42621097-42621119 GTGTTTTAGGGCTGGTGCGGTGG + Intergenic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1147897208 17:43758527-43758549 GTCTCAAAGGGGTGGTGGGGAGG + Exonic
1147917301 17:43896459-43896481 GTATTTGAGGGGTGATGGTAGGG - Intronic
1148593316 17:48832680-48832702 GTGTTTGAAGTGTGGTGGAAAGG - Intronic
1149615207 17:57991640-57991662 GTATTTAAGGGGGGATGGGGGGG - Intronic
1149639822 17:58195342-58195364 GTGTTTGAGAGGTGGGGGTAGGG + Intronic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1149899776 17:60464422-60464444 GAGTTTAAGGGGTTGGAGGAAGG - Intronic
1150368423 17:64612673-64612695 TTTTTTGAGGGGTGGAGGGAGGG - Intronic
1151407588 17:73899447-73899469 GTGTTTATGGGTTGGTGAAATGG - Intergenic
1151570087 17:74921674-74921696 GTGTTTGATGGGTTGTGGGTTGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153563316 18:6394070-6394092 GTGTTGAAAGGGTAGTGAGAAGG - Intronic
1155379871 18:25208539-25208561 GGGTTTAAGGGAGGGAGGGAAGG - Intronic
1155569483 18:27176041-27176063 GTTTTTAGGGGATGGGGGGATGG + Intronic
1157099817 18:44719344-44719366 GTGTGCAAGGGGTGGAGGGCAGG + Intronic
1157498510 18:48172896-48172918 CTGTCTAGGGGGTGGTGGGAGGG + Intronic
1157700660 18:49759930-49759952 GTGTGTAGGGGGTGGGGGGCTGG + Intergenic
1158311965 18:56168712-56168734 ATGTGAAAGGGGTGGTGGGGTGG + Intergenic
1158782601 18:60668896-60668918 CTGTTTGTGGGGTGGTGGGTGGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159403172 18:67963661-67963683 GTGTGCAAGAGATGGTGGGAAGG - Intergenic
1159448975 18:68575984-68576006 GTGTGTAGGGGGGTGTGGGAGGG - Intergenic
1161258920 19:3324848-3324870 TTGTCTAAGGGGAGGTGGAAGGG - Intergenic
1161291429 19:3495620-3495642 GGGTTTAAGGCGGGGTGCGATGG + Intronic
1161396058 19:4045477-4045499 AGGCTTAAGGGGGGGTGGGAAGG + Exonic
1162099515 19:8331452-8331474 GTGTTTAGGGGGTTGGGGGCAGG + Intronic
1162134733 19:8548371-8548393 GTGTCTAAGGAGTGGTGGGCAGG - Intronic
1162831328 19:13286516-13286538 GTGGTTGAGGGGGGGTGGGCAGG + Exonic
1163931564 19:20398363-20398385 GTGAAGAAGGGGTTGTGGGATGG + Intergenic
1164091602 19:21957983-21958005 GCTGTTATGGGGTGGTGGGAAGG - Intronic
1164400316 19:27897562-27897584 TTATTTAAGTGGTGGTGGGGAGG - Intergenic
1165357425 19:35312527-35312549 GTGGCTAGGGGGTGGAGGGAGGG + Intronic
1165755913 19:38292896-38292918 ATCTTGAAGGGGTGGTGGGAGGG + Intronic
1165907466 19:39202849-39202871 GTATTGCAGGGGAGGTGGGAGGG + Exonic
1166883409 19:45942872-45942894 GGGTTTAAGGGGACATGGGAAGG - Intronic
1167201813 19:48070737-48070759 CTGTTGAGGGGGCGGTGGGAGGG + Intronic
1167245613 19:48371340-48371362 GTGTAGATGGGGTGGTGGGGAGG - Intronic
1167795103 19:51703853-51703875 GGGTTTAAGGAGTGAGGGGAAGG + Intergenic
1168058192 19:53875228-53875250 GTGTTTGGGGGGTGGGGGGTGGG + Exonic
1168295507 19:55375689-55375711 GAGGTTAGGGAGTGGTGGGAGGG - Intergenic
925640613 2:5982909-5982931 TTGTTCAAGGGATGGGGGGAAGG - Intergenic
925943308 2:8839587-8839609 GGGGTTGGGGGGTGGTGGGAAGG - Intergenic
926108648 2:10168258-10168280 GGGTGTCAGGGGTGGGGGGAAGG - Intronic
926317023 2:11717486-11717508 GTGTTTGGAGGGTGGGGGGATGG - Intronic
926697473 2:15780764-15780786 GTTTCTAAGGGCTGGAGGGAGGG + Intergenic
926781237 2:16473995-16474017 GTTTGTAAGGGGTGGAAGGAGGG + Intergenic
927430526 2:23023073-23023095 GTGACTAAGGGGTGGAGAGAGGG - Intergenic
927500074 2:23576841-23576863 GGGTGTGAGTGGTGGTGGGAAGG - Intronic
928161323 2:28928357-28928379 GCGTTTATTGGGTGGTGGGGTGG + Intronic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929078774 2:38101090-38101112 GTGTGTATGTGGGGGTGGGAGGG + Intronic
929554356 2:42916084-42916106 GTCTTTTAGGTCTGGTGGGAGGG + Intergenic
929759896 2:44798222-44798244 GTGTTTACGGGGTGGAGGAGGGG - Intergenic
930236553 2:48894440-48894462 GTGGTTAAGGGATGGATGGATGG - Intergenic
931032339 2:58192345-58192367 GTGTTTTATGGGCAGTGGGATGG - Intronic
931354649 2:61525199-61525221 TTGTTTCATGGGCGGTGGGAGGG - Intronic
931471482 2:62542346-62542368 GTGTTTATTGTGTGGTAGGATGG + Intergenic
931632895 2:64317211-64317233 GTGTATGGGGGGTGGTGGCACGG - Intergenic
931634355 2:64328299-64328321 ATGTTTAGGGGGTGCTGAGAAGG - Intergenic
932077728 2:68680828-68680850 GTGTTTAAGGAATAGTGAGAAGG + Intronic
932308142 2:70718523-70718545 GTGTTTAATGCTTGTTGGGAAGG + Intronic
932867815 2:75364883-75364905 ATGTTGAAGGAGTGGTGAGAGGG + Intergenic
933227270 2:79765520-79765542 GTGTTTAATGGGAGGTGGGCAGG + Intronic
933348786 2:81126561-81126583 GTGCTGAAGGGGTGGGGGGGGGG - Intergenic
933562477 2:83905727-83905749 GGGTTTAAGGGGAGGAGGGAAGG + Intergenic
935132192 2:100268985-100269007 GTGTTTGGGGAGTGGAGGGAGGG - Intergenic
935454475 2:103251261-103251283 GGGTTAAAGGGATGGGGGGATGG - Intergenic
935782286 2:106518887-106518909 GAGTTTAGGGGATGGTTGGAGGG - Intergenic
936713005 2:115154725-115154747 GTGCTCAGGGGGTGGTGGGTAGG - Intronic
937135100 2:119544959-119544981 GCGTTGAAGGGCTGGAGGGAAGG + Intronic
938289516 2:130141943-130141965 GGGATTAAGGGGGGGTGGGCAGG - Intronic
938467014 2:131530995-131531017 GGGATTAAGGGGGGGTGGGCAGG + Intronic
938657914 2:133453907-133453929 GTGATTCAGCGGTGGTGGGGGGG - Intronic
939139749 2:138340126-138340148 TTTTTTAAGGGGTGGGGGGCAGG - Intergenic
939836335 2:147134004-147134026 CTGTTTTGGGGGTGCTGGGAAGG - Intergenic
940002043 2:148975969-148975991 GTGTGGAAGGGGTGGTGCCAAGG + Intronic
942017901 2:171835785-171835807 GTGTGTGAGGGGTGGTGGGGTGG - Intronic
943059044 2:183018537-183018559 GTGTTTTAGGGGTGGGGTGGTGG - Intronic
944312821 2:198253577-198253599 GTGTGTTGGGGGTGGTGGGCAGG + Intronic
944386544 2:199171093-199171115 GTTTTTAAGTGGTGGTAGGATGG - Intergenic
945048329 2:205801037-205801059 GTGTTGATGGGGGTGTGGGAGGG + Intergenic
946450191 2:219773067-219773089 GTGCATAAGGGGAGGTGGGAGGG + Intergenic
948096926 2:235342986-235343008 GAGATTAAGTGGTGGGGGGATGG - Intergenic
948537918 2:238659850-238659872 GTGTTCTAAGGCTGGTGGGATGG + Intergenic
948618894 2:239221007-239221029 GAGTCCAAGGGCTGGTGGGAGGG - Intronic
948704324 2:239779675-239779697 GTGTCTGAGGGGTTGTGTGAGGG - Intronic
948945114 2:241215436-241215458 GTGTTCAGGGGGCGCTGGGAGGG - Intronic
1168849216 20:965240-965262 GTCTTGAAGTGGGGGTGGGATGG + Intronic
1169181350 20:3570785-3570807 GTTTTTAAGGGGTGACAGGAGGG + Intronic
1169263339 20:4153196-4153218 GTGATTTTGGGGTGCTGGGAAGG + Intronic
1169307725 20:4507539-4507561 GTTTTGAGGGGGTGGAGGGAGGG + Intergenic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1172012727 20:31855686-31855708 GTGTTGAATGGGTGGTTGCATGG - Intronic
1173760218 20:45553317-45553339 CTCTTTGAAGGGTGGTGGGATGG - Intronic
1174897825 20:54469477-54469499 GAGTTCAAGGGGCTGTGGGAAGG - Intergenic
1175565809 20:59975852-59975874 GTGTTCAGGGGGTGGTGTGGGGG + Intronic
1175664459 20:60846221-60846243 CTTTTTCAGGAGTGGTGGGAAGG + Intergenic
1175669069 20:60885827-60885849 GTGTGTGGGGGGTGGTGGGGAGG + Intergenic
1176087912 20:63306493-63306515 GGGTCTAGGGGGTGGTGAGAGGG + Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176912250 21:14580120-14580142 GAGTCTAAGGGATGATGGGATGG + Intronic
1177381039 21:20344756-20344778 CTGTTTCAGGGTTGGAGGGATGG - Intergenic
1181482189 22:23207225-23207247 CTGATAAAGGGGTGCTGGGATGG + Intronic
1181661613 22:24354555-24354577 GTACTTCAGGGGTGGAGGGAAGG - Intronic
1181687512 22:24539740-24539762 GTGTTTGAGGGAGGATGGGAAGG + Intergenic
1182025863 22:27118694-27118716 ATGTGTTGGGGGTGGTGGGATGG + Intergenic
1182549653 22:31093881-31093903 GTGCTTCTGGGTTGGTGGGAGGG + Intronic
1183246725 22:36699637-36699659 GTGGTTAAGGGGTGGGGGGTGGG + Intronic
1185116442 22:48940897-48940919 GTGTTTGACGGGTGGGGGAAGGG + Intergenic
1185297973 22:50063665-50063687 GGGTTTCAGGGGTGCTGGGGAGG - Intronic
949465321 3:4337599-4337621 GTGGTCAAGGGATGGAGGGAGGG - Intronic
950333543 3:12176110-12176132 GTGTAGGAGGGGTGGTGGGAAGG - Intronic
950419105 3:12886454-12886476 CTGTGTATGGGGTGGTGGGGGGG - Intergenic
950490068 3:13299227-13299249 TTTTTTGAGGGGTGGGGGGATGG - Intergenic
950962300 3:17119248-17119270 GTGGGGATGGGGTGGTGGGAGGG - Intergenic
952271725 3:31839459-31839481 CTTTTTAGGGGGTGGTGGGTGGG - Intronic
952573485 3:34745635-34745657 GTGTAGAAGGGCTGGTGGCAGGG + Intergenic
952598559 3:35049593-35049615 GTGTTTTATGTGTGGTGGGGGGG - Intergenic
952654427 3:35767868-35767890 ATGTTTAAGGACTGGTGGGCTGG - Intronic
953982053 3:47417971-47417993 GGGGGTACGGGGTGGTGGGAGGG + Intronic
954089420 3:48272540-48272562 GTGTTTAGGGGTTGCTGGGCAGG + Intronic
954255646 3:49403955-49403977 TTTTTTCGGGGGTGGTGGGAGGG - Intronic
954445076 3:50542089-50542111 GTGTGTGTGGGGTGGTGGGGGGG + Intergenic
954614699 3:51963734-51963756 GTGTTTAGGGGCTGGGGGTAGGG + Intronic
954848276 3:53578496-53578518 GTCTTTAAGGGGTCGAGTGAGGG + Intronic
955381215 3:58439854-58439876 GTGTTAAGGGGGTGGTGGGGGGG + Intergenic
956245316 3:67176098-67176120 GTGTGTGAGAGGTGGGGGGAGGG + Intergenic
956322378 3:68011123-68011145 GTGTGTGGGGGGTGGTGGGGGGG + Intronic
956755239 3:72379352-72379374 CTTTTTAGGGGGTGGTGGGGTGG + Exonic
957609998 3:82453694-82453716 GTGTTGAAGGGGTGGTCTGGTGG + Intergenic
957942591 3:87023558-87023580 GAGTCCAAGGGGTGGTTGGAAGG - Intergenic
959088170 3:101873414-101873436 GTGTTTTGGGGGTGGTGAGAAGG - Intergenic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
963252349 3:143114966-143114988 GGGGGTAAGGGGTAGTGGGAGGG + Intergenic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
965604339 3:170484310-170484332 GTGTTGAAGGAGGGGTGGTAGGG - Intronic
965836803 3:172862138-172862160 GGCTTTGTGGGGTGGTGGGAAGG - Intergenic
966228134 3:177620164-177620186 GTGTTTAGGGGGTGGAAGTAAGG - Intergenic
966924577 3:184636000-184636022 GTGAGTCAGGGGTGGTGGGCAGG + Intronic
968126630 3:196164869-196164891 GTGTATATGGGGTGGTGTGTGGG + Intergenic
968377599 4:56315-56337 GTGGGCAAGGGGAGGTGGGAGGG - Intronic
969294937 4:6264178-6264200 GTGGTCAAGGCCTGGTGGGATGG + Intergenic
969392681 4:6901742-6901764 TTGTTTTAATGGTGGTGGGAGGG - Intergenic
970027295 4:11636992-11637014 ATGTTTAAGAAGGGGTGGGAGGG - Intergenic
970127795 4:12833711-12833733 GTGTTTAAGGGATTGTAGAAAGG - Intergenic
972138135 4:35918805-35918827 TTATATAAGGGGTGATGGGAGGG + Intergenic
972978344 4:44664254-44664276 GTGTTTGCGGGGTGGGGGGTGGG - Intronic
973885710 4:55318896-55318918 GTGTTAAACTGGTAGTGGGAGGG - Intergenic
973958903 4:56090249-56090271 GTATTTAAGGGGAGCTGGAAAGG + Intergenic
974331627 4:60487012-60487034 GTGGTCAAGTGTTGGTGGGAGGG + Intergenic
974337895 4:60575101-60575123 GAGTTTTGGGGGTGGGGGGATGG + Intergenic
975127660 4:70800240-70800262 GTTATTCTGGGGTGGTGGGAAGG + Intronic
975134168 4:70857955-70857977 TTGTTGAAGTGGTGTTGGGAAGG + Intergenic
975733333 4:77358552-77358574 GTGTTCTAGAGGTGGTGGCAGGG + Intronic
976588810 4:86828595-86828617 TGGTTGAAGGGGCGGTGGGAGGG - Intronic
976854208 4:89583422-89583444 GAGTTTCAGGGCTGTTGGGATGG + Intergenic
978085418 4:104646166-104646188 GTGTGTAAGAGGTGGGGAGAAGG + Intergenic
978435731 4:108682260-108682282 GTGAGGCAGGGGTGGTGGGAGGG + Intergenic
979508922 4:121529398-121529420 GTGTGTCAGGGGTAGTGGGTAGG - Intergenic
981784523 4:148462367-148462389 ATTTTTCCGGGGTGGTGGGATGG - Intergenic
982285694 4:153731794-153731816 GTGTGTGGAGGGTGGTGGGATGG + Intronic
985393481 4:189515835-189515857 GTGTAGCAGGTGTGGTGGGATGG + Intergenic
985929819 5:3048200-3048222 CTGTTGAAAGGATGGTGGGATGG + Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
987205166 5:15618008-15618030 GTGTTGCAGGGGTTGGGGGAGGG + Intronic
988820455 5:34879482-34879504 CTGTTTGGGGGGTGCTGGGAGGG - Intronic
989194934 5:38707442-38707464 GGGTGAAAGGGGAGGTGGGAGGG - Intergenic
989300246 5:39882866-39882888 GTGTGTGTGTGGTGGTGGGAAGG + Intergenic
990759946 5:59117819-59117841 TTTTGTGAGGGGTGGTGGGATGG + Intronic
991114141 5:62934634-62934656 CTGTTGAAGGTGGGGTGGGATGG - Intergenic
991395651 5:66202505-66202527 GTGTGTGGGGGGTGGTGGGCGGG - Intergenic
991405282 5:66295205-66295227 CTGATGAAGGGGTGGAGGGAGGG + Intergenic
993204216 5:84859994-84860016 GTGTTTTGGGGGTGGAGGCAAGG + Intergenic
995662353 5:114499538-114499560 TTGTTTAGGGAGTGCTGGGAAGG + Intergenic
996443157 5:123513086-123513108 GTGTTTAAGGGGTTGGGTGGGGG + Intronic
997651784 5:135527233-135527255 GTGTTTGGTGGGTGGTGAGAGGG + Intergenic
998083644 5:139297843-139297865 GTTTTTAAGGTTTGGTGGGTGGG - Intronic
1000145448 5:158449120-158449142 GTGGTTAAAGGGTAGTGAGAAGG - Intergenic
1000262193 5:159598685-159598707 GAGTTTAAGAGATGGGGGGAGGG - Intergenic
1000532384 5:162439427-162439449 GTTTTTTTGGGGGGGTGGGAGGG + Intergenic
1002437461 5:179240402-179240424 CTGGGTAAGGGGTGGAGGGAAGG + Intronic
1002795314 6:466826-466848 GTGGTCAGGGGATGGTGGGAAGG + Intergenic
1002857155 6:1048129-1048151 GTGTTTGAAGGACGGTGGGAGGG - Intergenic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1004878191 6:19977547-19977569 GTGGTGATGGGGTGGGGGGAGGG - Intergenic
1004954880 6:20718388-20718410 GAGTTTAAGGGGTGGTCCTAGGG - Intronic
1005172983 6:23009512-23009534 TTGTGTAATGGGTGGTGTGATGG + Intergenic
1005230412 6:23695128-23695150 GTGTATATGTGGTGATGGGAGGG - Intergenic
1005261462 6:24065415-24065437 GGGTTTGAGGGGTGGTAGGAAGG + Intergenic
1007399966 6:41597976-41597998 GTGGTTGAGGGGTGCTGGGGTGG - Intronic
1009979132 6:70705672-70705694 GTGTTTAAGGAGTGGCAGGATGG + Intronic
1010026268 6:71221367-71221389 CTGTCTCAGGGGTGGTGGGGGGG - Intergenic
1010486674 6:76422755-76422777 GTTTTTAAGGGCTGGAGTGAGGG + Intergenic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1011002479 6:82606620-82606642 TTGTTTGAGGGGAAGTGGGATGG + Intergenic
1011444348 6:87422021-87422043 GTGTTTAAAAGGTAGGGGGAAGG + Intronic
1013426341 6:110016279-110016301 GTGGTTCAGGGGAGTTGGGAAGG - Intergenic
1014087379 6:117363112-117363134 GTGCTTAAGTGGTAGTAGGAAGG - Intronic
1014087674 6:117366318-117366340 GTGTTTCTGGAGTGGTGGAAGGG + Intronic
1014899596 6:126946701-126946723 GAGTGTATGGGGAGGTGGGATGG - Intergenic
1015245609 6:131071276-131071298 TTTTTTGAGGGGTGGAGGGAGGG - Intergenic
1015284487 6:131469747-131469769 TTGTTTCAGTGGTGCTGGGAGGG - Intergenic
1015935812 6:138404803-138404825 GTCTTTGCGGGGTGGTGGGGCGG + Intronic
1016435097 6:144028445-144028467 GTGATGAAGATGTGGTGGGAGGG + Intronic
1017031774 6:150230225-150230247 GTGTGAAGCGGGTGGTGGGAAGG - Intronic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019378298 7:707959-707981 GAGATCAAGGTGTGGTGGGATGG - Intronic
1019892010 7:3954525-3954547 GTTGTAAAGGGGAGGTGGGAGGG - Intronic
1020240140 7:6388057-6388079 GTGTTGAAGGGGGAATGGGAGGG + Intronic
1022095822 7:27140606-27140628 GTGGGGAAGGGGTGCTGGGATGG + Intronic
1024529061 7:50375715-50375737 GTGTTTGTTGGGTGGTGGGTGGG - Intronic
1024628749 7:51230514-51230536 GTGGAGCAGGGGTGGTGGGAAGG - Intronic
1025193916 7:56917921-56917943 GTGTTTATTGGGTGGGTGGATGG + Intergenic
1025678030 7:63659025-63659047 GTGTTTATTGGGTGGGTGGATGG - Intergenic
1025855331 7:65271489-65271511 CTGTTAGAGGGGTGGAGGGAGGG - Intergenic
1026847366 7:73705579-73705601 GAGTTGAAGGGGTGGGGGGGCGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027359857 7:77396506-77396528 GTTTTTAAAAGGTGGTGGGGAGG + Intronic
1027442273 7:78231993-78232015 GTGTTTGGGGGAGGGTGGGATGG + Intronic
1027592563 7:80134771-80134793 GTGGTCGCGGGGTGGTGGGAGGG + Exonic
1027696767 7:81421670-81421692 CTGTTTTTGGGGTGGGGGGAGGG - Intergenic
1028642127 7:93054247-93054269 TTATTTATGGGGTGGGGGGAGGG - Intergenic
1028704095 7:93817509-93817531 GTGATTAAGGAGTGATCGGAGGG + Intronic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029429400 7:100520377-100520399 GTGTTCAGAGGATGGTGGGATGG - Intergenic
1031666003 7:124482673-124482695 GAGTTTAGTGAGTGGTGGGAAGG + Intergenic
1032359182 7:131239109-131239131 ATTTTTAAGGGGTGCTGGGGAGG + Intronic
1033370898 7:140706682-140706704 GTGGTGGAGAGGTGGTGGGAGGG + Intronic
1034376460 7:150649127-150649149 GTGTCTTAGGGGTGGGGGCAGGG + Intergenic
1035131623 7:156660033-156660055 GTATTTGTGGGGAGGTGGGATGG - Intronic
1036060214 8:5308829-5308851 GTGGCTAGGGGCTGGTGGGAAGG - Intergenic
1037018618 8:13940451-13940473 GTGTTAAAGGCATGGAGGGAAGG + Intergenic
1037640251 8:20735870-20735892 GTGCCTGAGTGGTGGTGGGAGGG - Intergenic
1037836180 8:22216048-22216070 ATGTTCAAGGGGTGGGGGAAGGG - Intergenic
1038450420 8:27635785-27635807 GTGTTTGTGTGTTGGTGGGAGGG - Intronic
1038642312 8:29338232-29338254 GGGTTTGAGGGCGGGTGGGAAGG - Intronic
1038697636 8:29819971-29819993 GTGTGTAAGTGGTGGTGAGGTGG - Intergenic
1039162825 8:34641455-34641477 GTATTTTAGAGGTGGTGGAAGGG + Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1040589242 8:48774185-48774207 GAGTTCAAGGGGTGGAGGGCGGG + Intergenic
1041024116 8:53666484-53666506 GTGTGGAAGGGGTGGTGGTGAGG - Intergenic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1042131808 8:65594693-65594715 GTATTTAAATGCTGGTGGGATGG - Intergenic
1044621301 8:94193020-94193042 GGATTTCAGGGGTGTTGGGAGGG - Intronic
1045323240 8:101097703-101097725 GTGTGTAGGGGGCGGTGGGGGGG + Intergenic
1045850832 8:106696821-106696843 GTGGCTAAGGGGTGGGGTGAGGG - Intronic
1046082941 8:109394507-109394529 CTGTTGCGGGGGTGGTGGGAAGG + Intronic
1047676627 8:127209546-127209568 GTGGTTGAGGGGCTGTGGGAGGG + Intergenic
1047947567 8:129897227-129897249 GTATTTAAGCAGTGGTGAGATGG - Intronic
1048152867 8:131910793-131910815 GTGTTTCTGTTGTGGTGGGATGG + Intronic
1048155680 8:131947565-131947587 GTGTTTGGGGGGTGGTGGACAGG + Intronic
1048564198 8:135577410-135577432 CAGTTTAAGGGGTGGAGAGAAGG - Intronic
1049477293 8:142802659-142802681 GTGCTTAAGGGCTGTTGAGAGGG + Intergenic
1050573333 9:6965638-6965660 GTGTTTCAGGTGTGGTCTGAAGG + Intronic
1050654789 9:7815896-7815918 GTGTTTGCGGGGAGGGGGGAGGG - Intronic
1051660743 9:19424002-19424024 GACTTAATGGGGTGGTGGGATGG + Intronic
1055312015 9:74992532-74992554 GTGTTTAAGGAGTGCTGGTCAGG + Intronic
1056474835 9:86944012-86944034 GGGGGTAAGGGGTGATGGGAAGG + Intergenic
1056767032 9:89450796-89450818 GAGTCTAGGGTGTGGTGGGAAGG - Intronic
1057944318 9:99311711-99311733 GTCTTTGAGGTGTGGAGGGAAGG + Intergenic
1058507230 9:105678491-105678513 CTATTTCAGGGGTGGTGGAAAGG - Intergenic
1059563314 9:115356556-115356578 GTTTGTAAGGTGTGTTGGGAAGG + Intronic
1059667835 9:116465786-116465808 GTGTTTTAGGCGAGATGGGAGGG + Intronic
1059702630 9:116790443-116790465 GTCATGAAGGGGTGGAGGGATGG - Intronic
1060301580 9:122377407-122377429 GTGTTCATGGGGTGGTGGTCTGG + Intronic
1060368374 9:123043627-123043649 GTGTTTGGGGGGTGAGGGGAAGG + Intronic
1203571638 Un_KI270744v1:137932-137954 GTGGGCAAGGGGAGGTGGGAGGG + Intergenic
1188945928 X:36301692-36301714 GAGTTCAGGGGCTGGTGGGAAGG + Intronic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189755449 X:44266749-44266771 GTGGTGGAGGGGTGGTGGGAAGG - Intronic
1189911490 X:45814682-45814704 TTGGTGAAGGGATGGTGGGAAGG - Intergenic
1193732281 X:85115886-85115908 GGCTTTCAGGGGTGGTGGGAAGG - Intergenic
1194265521 X:91749053-91749075 CTGCTTATGGGGTGGGGGGAGGG - Intergenic
1194374122 X:93111334-93111356 GTGTGTAGGGGGGGGTGGGTGGG + Intergenic
1194787927 X:98109575-98109597 GTGCATAAGGGGTGGTGGCGGGG - Intergenic
1196042281 X:111217798-111217820 GTGTATGTGGAGTGGTGGGAGGG - Intronic
1196741094 X:119026704-119026726 CTGTCAGAGGGGTGGTGGGAGGG + Intergenic
1197942333 X:131803115-131803137 GTGTTTAGTGGGGGGTGGGGGGG - Intergenic
1198804487 X:140480779-140480801 GTGTTTGGGTGGTGGTGGGGAGG - Intergenic
1199032844 X:143021289-143021311 GTATTTAAGGGTTGGAAGGATGG + Intergenic
1202036418 Y:20641393-20641415 CTGTTGGCGGGGTGGTGGGAGGG - Intergenic
1202057392 Y:20849199-20849221 GCCTTTGAGGGGTGGAGGGAGGG - Intergenic