ID: 1136103849

View in Genome Browser
Species Human (GRCh38)
Location 16:28014784-28014806
Sequence GACAAATGAGGCTGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 778
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 734}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136103849_1136103857 1 Left 1136103849 16:28014784-28014806 CCACCGTGCCAGCCTCATTTGTC 0: 1
1: 0
2: 5
3: 38
4: 734
Right 1136103857 16:28014808-28014830 CACTGGGCTGTTATATCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 132
1136103849_1136103858 19 Left 1136103849 16:28014784-28014806 CCACCGTGCCAGCCTCATTTGTC 0: 1
1: 0
2: 5
3: 38
4: 734
Right 1136103858 16:28014826-28014848 TTTGGCAATGAATACCTATTTGG 0: 1
1: 0
2: 0
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136103849 Original CRISPR GACAAATGAGGCTGGCACGG TGG (reversed) Intronic
900228570 1:1544328-1544350 GAAAAATGGGCCTGGCGCGGTGG + Intronic
900437502 1:2638521-2638543 GAGAAATCAGGCTGGGACGGAGG - Intronic
900988781 1:6088193-6088215 GACAAATTAGTCAGGCATGGTGG - Intronic
900999812 1:6143318-6143340 GACAAATGGGCCGGGCATGGTGG - Intronic
901099859 1:6711717-6711739 CAAAAATTAGGCTGGCATGGTGG - Intergenic
901268150 1:7928602-7928624 GACAAATGGGCCGGGCATGGTGG + Intronic
901400874 1:9014482-9014504 GAAAAATGAAGCTGGCATGTGGG + Intronic
902213208 1:14918386-14918408 GAGGAATGGGGCTGGCATGGTGG + Intronic
902341652 1:15787248-15787270 GAAAAATGAGCTGGGCACGGTGG + Intergenic
902588308 1:17455225-17455247 CAAAAATTAGCCTGGCACGGTGG + Intergenic
902819653 1:18936208-18936230 GGAAACTGAGGCTGGCAGGGAGG - Intronic
902905601 1:19554530-19554552 AAAAGATCAGGCTGGCACGGTGG + Intergenic
902950101 1:19875580-19875602 CAAAAATCAGCCTGGCACGGTGG + Intergenic
903483876 1:23675332-23675354 CAAAAATCAGCCTGGCACGGTGG - Intergenic
904520951 1:31095324-31095346 AAAAAATTAGCCTGGCACGGTGG - Intergenic
904662989 1:32098961-32098983 GCCAAATGGGCCAGGCACGGTGG + Intronic
904669105 1:32148978-32149000 GACCAATATGGCCGGCACGGTGG - Intronic
904791701 1:33027186-33027208 GAAAAACCAGGCTGGCACTGTGG + Intronic
905077939 1:35290580-35290602 GAAAAATGAGCCAGGCATGGTGG - Intronic
905233261 1:36528936-36528958 GACAAATGAGGCTGGGATGATGG - Intergenic
905306566 1:37023172-37023194 CACAAATGAGCCAGGCATGGTGG + Intronic
905522388 1:38610291-38610313 AACAAATGAGCCGGGCATGGTGG - Intergenic
906846057 1:49193678-49193700 AAAAAATTAGCCTGGCACGGTGG - Intronic
907587267 1:55631908-55631930 CAAAAATGAGTCTGGCATGGTGG + Intergenic
908244471 1:62216752-62216774 AAAAAATGAGCCGGGCACGGTGG - Intergenic
908978101 1:69922211-69922233 GAAAAATGTGCCGGGCACGGTGG - Intronic
909243750 1:73250338-73250360 AAAAAATTAGGCTGGCATGGTGG - Intergenic
910286795 1:85564715-85564737 AACAAATGAGCCAGGCATGGTGG + Intronic
911398027 1:97336595-97336617 AAAAAATTAGCCTGGCACGGTGG + Intronic
912830090 1:112945149-112945171 CAAAAATTAGGCAGGCACGGTGG - Intronic
912987289 1:114446765-114446787 GAGAAAGGAGCCTGGCATGGTGG + Intronic
913135852 1:115888275-115888297 AAAAAATGAGCCTGGCATGGTGG + Intergenic
913167858 1:116205493-116205515 GAAAAATTAGCCAGGCACGGTGG - Intergenic
913185782 1:116369642-116369664 CAAAAATTAGCCTGGCACGGTGG + Intergenic
914257263 1:145970721-145970743 AACAAATTAGCCGGGCACGGTGG + Intronic
914775775 1:150733674-150733696 GAAAAATGAGCCAGGCATGGTGG + Intronic
915126227 1:153666967-153666989 GAAAAATTAGCCTGGCATGGTGG + Intronic
915379027 1:155424010-155424032 GATAAATGGGCCGGGCACGGTGG - Intronic
915390959 1:155543642-155543664 CAAAAATAAGGCTGGCATGGTGG + Intronic
915438194 1:155925316-155925338 TAAAAATTAGGCGGGCACGGTGG - Intronic
916229900 1:162531379-162531401 GAAAAATTAGCCTGGCATGGTGG + Intergenic
916599737 1:166281129-166281151 AAAAAATTAGGCAGGCACGGTGG + Intergenic
916804013 1:168241342-168241364 AAAAAATGAGCCTGGCATGGTGG - Intronic
917387577 1:174493666-174493688 GAAAAATCAGCCTGGCATGGTGG + Intronic
917869673 1:179229842-179229864 GGCAAATGAGGTGGGCACTGGGG - Intergenic
918859927 1:189810723-189810745 CAAAAATTAGGCTGGCATGGTGG - Intergenic
919468145 1:197946966-197946988 GAAAAATTAGCCTGGCCCGGTGG - Intergenic
919917200 1:202145983-202146005 CAAAAATTAGGCTGGCATGGTGG - Intergenic
920283337 1:204860411-204860433 GACAAGTGAGGGTGGCACAGGGG - Intronic
920343089 1:205287970-205287992 CAGAAATCAGGCTGGCAGGGAGG - Intergenic
921893931 1:220379761-220379783 GAAAAATTAGTCGGGCACGGTGG - Intergenic
922608897 1:226909662-226909684 AAAAAATTAGCCTGGCACGGTGG - Intronic
923102582 1:230828011-230828033 GAGAAATGACGCTGGCCCAGGGG + Intergenic
923383468 1:233444174-233444196 AACAAATGAGCCAGGCATGGTGG - Intergenic
923845150 1:237721805-237721827 GACAAAGCAGCCGGGCACGGTGG - Intronic
924624946 1:245689708-245689730 GAAAAATTAGCCAGGCACGGTGG - Intronic
924762928 1:247006323-247006345 GACAAATAAGCCGGGCGCGGTGG + Intronic
1062967864 10:1624079-1624101 GAAAAATTAGCCTGGCATGGTGG + Intronic
1063675769 10:8139787-8139809 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1064145268 10:12821820-12821842 CAAAAATGAGCCTGGCATGGTGG + Intronic
1064211877 10:13366638-13366660 GAAAAATTAGTCAGGCACGGTGG - Intergenic
1064870384 10:19930672-19930694 TAAAAAAAAGGCTGGCACGGTGG + Intronic
1065526194 10:26623294-26623316 AAAAAATTAGGCAGGCACGGTGG + Intergenic
1066091692 10:32028114-32028136 CAAAAATGAGCCTGGCATGGTGG - Intronic
1067404473 10:46009266-46009288 GGCAAGTGAGGGTGGGACGGGGG - Intronic
1068037212 10:51775869-51775891 GAAAAATCAGGCTGGCGCAGTGG - Intronic
1069240372 10:66130701-66130723 AAAAAATGAGCCTGGCATGGTGG + Intronic
1069416525 10:68205532-68205554 GAAAAATTAGGCAGGCATGGTGG + Intronic
1069540138 10:69287993-69288015 TAAAAATTAGGCTGGCATGGTGG + Intronic
1070199091 10:74185998-74186020 CAAAAATTAGCCTGGCACGGTGG - Intronic
1071026113 10:81115295-81115317 TACAAATTAGGCAGGCATGGTGG - Intergenic
1071618510 10:87096459-87096481 AACTAACGAGGCTGGCACGGTGG + Intronic
1072060292 10:91803360-91803382 GAAAAATGAGCCGGGCATGGTGG + Intronic
1072969064 10:100000943-100000965 GAAAAAAGAGCCGGGCACGGTGG + Intronic
1072974832 10:100048540-100048562 GAAAAATTAGGCGGGCATGGTGG + Intronic
1073091356 10:100942669-100942691 GAAAAATTAGGCTGGCGTGGTGG - Intronic
1073138326 10:101231631-101231653 GGCAAGTGAGGCTAGCAGGGAGG + Intergenic
1074055324 10:109918472-109918494 CACAAATGGGCCGGGCACGGTGG + Intronic
1074092221 10:110271662-110271684 GGGAAATGAGGCTGGAAAGGTGG + Intronic
1074300472 10:112228590-112228612 GACAAATTAGCCAGGCATGGTGG + Intergenic
1075035502 10:119063795-119063817 CACAAATCTGGCCGGCACGGTGG + Intronic
1075760521 10:124852281-124852303 AAAAAATTAGGCAGGCACGGTGG + Intergenic
1076914237 10:133413533-133413555 GACAAATGGGCCGGGCACGGTGG - Intronic
1077158627 11:1102679-1102701 GCCACAGGAGGCTGGCATGGAGG + Intergenic
1077403514 11:2370459-2370481 AAAAAATCAGCCTGGCACGGTGG - Intergenic
1077548658 11:3189223-3189245 AACAAAGGAGGCTGGCACGGTGG - Intergenic
1077599412 11:3563552-3563574 GACAAATTAGTCAGGCATGGTGG + Intergenic
1077631619 11:3815088-3815110 AAAAAATGAGCCAGGCACGGTGG - Intronic
1077648125 11:3944663-3944685 GACAAATGAGGCCCACATGGCGG - Intronic
1077681923 11:4249948-4249970 AAAAAATGAGCTTGGCACGGTGG - Intergenic
1078035309 11:7798396-7798418 TAAAAATGAGCCAGGCACGGTGG + Intergenic
1078387251 11:10903496-10903518 GAGAAAGTAGGCTGGCATGGTGG + Intergenic
1078531780 11:12142132-12142154 GAGAAAAGAGGAAGGCACGGTGG - Intronic
1079011864 11:16835116-16835138 AAAAAATGAGCCAGGCACGGTGG + Intronic
1079426672 11:20349908-20349930 GTGAGATGAGGCTGGCATGGTGG + Intergenic
1080182367 11:29440786-29440808 TACAAATGATCCTGTCACGGAGG + Intergenic
1080400525 11:31931179-31931201 GAGAGATGAAGCTGGCAGGGAGG - Intronic
1081919061 11:46755774-46755796 GAAAAATTAGCCTGGCATGGTGG + Intronic
1082041952 11:47693312-47693334 AACAAATGAGCCGGGCAGGGTGG - Intronic
1083023857 11:59533365-59533387 GTCAAATGAGCCAGGCATGGTGG + Intergenic
1083814264 11:65123445-65123467 GAAAAATGGGCCAGGCACGGTGG + Intronic
1084141026 11:67229581-67229603 AAAAAATGGGCCTGGCACGGTGG + Intronic
1084255317 11:67938157-67938179 GACAAATTAGTCAGGCACGGTGG + Intergenic
1084817433 11:71657138-71657160 GACAAATTAGTCAGGCATGGTGG - Intergenic
1085098566 11:73780831-73780853 GAAAAATTAGGCAGGCATGGTGG + Intergenic
1085280204 11:75325108-75325130 GACAACTGAGGCTGGCAGTGGGG + Intronic
1085529423 11:77182724-77182746 GACAAAGGAGGGTGGCAGGCAGG - Intronic
1085575172 11:77596286-77596308 CAAAAATGAGCCTGGCATGGTGG + Intronic
1085697553 11:78717975-78717997 GACACAGCAGGCTGGCACTGAGG + Intronic
1086793412 11:91069595-91069617 TAGAAATGAGCCTGGCACAGAGG + Intergenic
1087521106 11:99237526-99237548 GAAAAATTAGCCTGGCATGGTGG + Intronic
1087626949 11:100605914-100605936 AAAAAATTAGGCGGGCACGGTGG + Intergenic
1087641882 11:100763775-100763797 GACAAAGGAGCCGGGCACGGTGG - Intronic
1087870712 11:103289606-103289628 AAAAAATGAGCCAGGCACGGTGG + Intronic
1088311815 11:108467976-108467998 GAAAAATGAGCCTGGCGTGGTGG - Intergenic
1088809445 11:113381062-113381084 GGCAAAGGAGGCCGGCATGGTGG - Intronic
1089521452 11:119067119-119067141 CAAAAATGAGCCTGGCATGGTGG - Intergenic
1089906762 11:122048077-122048099 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1090519786 11:127465886-127465908 GACAAATTAGCCGGGCATGGCGG + Intergenic
1090645144 11:128761129-128761151 GTCTTATGAGGCTGGCGCGGAGG - Intronic
1090990776 11:131815301-131815323 GAGAGCTGAGGCGGGCACGGTGG - Intronic
1091102731 11:132890557-132890579 GAAAAATGGGCCAGGCACGGTGG + Intronic
1091909677 12:4219461-4219483 CAAAAATTAGGCTGGCATGGTGG - Intergenic
1091970984 12:4786844-4786866 GACAAATGAGGAGGGCTCTGGGG - Intronic
1091973275 12:4805927-4805949 GAGAATGGAGCCTGGCACGGTGG - Intronic
1092219681 12:6704312-6704334 CACAAATTAGCCTGGCATGGTGG - Intergenic
1092260112 12:6948789-6948811 AAAAAATTAGGCTGGCACAGTGG + Intronic
1092425551 12:8372897-8372919 GACAAATTAGTCAGGCATGGTGG + Intergenic
1092720452 12:11435616-11435638 GAAAAATTAGGCAGGCATGGTGG - Intronic
1093486868 12:19661927-19661949 GACAGATGAGCCTGGAGCGGTGG + Intronic
1095491407 12:42737881-42737903 GGCAACTGAGGCTGGAAGGGTGG + Intergenic
1095753310 12:45734214-45734236 GAAAAATTAGCCTGGCATGGTGG + Intronic
1095901371 12:47332054-47332076 AACAAATTAGCCTGGCATGGTGG + Intergenic
1096125181 12:49113924-49113946 CAAATATGAGCCTGGCACGGTGG - Intergenic
1096266238 12:50124950-50124972 CAAAAATTAGCCTGGCACGGTGG - Intergenic
1096337477 12:50767228-50767250 AAAAAATCAGCCTGGCACGGTGG + Intronic
1096398975 12:51289460-51289482 CAAAAATGAGGCAGGCATGGTGG + Intronic
1097186204 12:57197859-57197881 GAGACATGAGGCTGGCAGCGAGG - Intronic
1097252304 12:57642533-57642555 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1097681015 12:62648692-62648714 GTCAAGTGAGGCTGGGAAGGGGG + Intronic
1097689209 12:62718546-62718568 GACAGATGGGGCTGGTACTGAGG - Intronic
1097801168 12:63916184-63916206 GAAAAATCAGGCAGGCATGGTGG - Intronic
1097865086 12:64553328-64553350 GACAAGTGAGGGTGGACCGGGGG + Intergenic
1097960825 12:65530511-65530533 AAAAAATTAGCCTGGCACGGTGG - Intergenic
1098876413 12:75870426-75870448 CAAAAATTAGGCTGGCATGGTGG - Intergenic
1098981036 12:76955953-76955975 CAAAAATTAGGCTGGCATGGTGG - Intergenic
1100305010 12:93342378-93342400 CACAAATTAGCCAGGCACGGTGG + Intergenic
1100528256 12:95440274-95440296 TACAAATGGGCCAGGCACGGTGG + Intergenic
1100825741 12:98472669-98472691 AAAAAATGAGCCTGGCATGGTGG + Intergenic
1100878445 12:98989650-98989672 GAAGAATGAGCCAGGCACGGTGG + Intronic
1101118277 12:101553221-101553243 GACAAATTAGCCAGGCATGGTGG + Intergenic
1101729696 12:107416779-107416801 TACAAATTAGGCAGGCAGGGTGG - Intronic
1102100977 12:110278890-110278912 CAAAAATGAGGCAGGCATGGTGG + Intergenic
1102287209 12:111667919-111667941 GAAAGCTGGGGCTGGCACGGTGG + Intronic
1102714013 12:114954093-114954115 GAAAAATTAGCCAGGCACGGTGG - Intergenic
1103499691 12:121391713-121391735 CAAAAATTAGGCTGGCATGGTGG - Intronic
1103980024 12:124731080-124731102 AAAAAATGAGGCAGGCATGGTGG + Intergenic
1104219583 12:126769028-126769050 TACAAATAAGCCTGGCATGGTGG - Intergenic
1104225928 12:126833039-126833061 CAAAAATGAGGCAGGCATGGTGG - Intergenic
1104325533 12:127792776-127792798 GAAAAATTAGCCTGGCAAGGTGG + Intergenic
1104347461 12:128014077-128014099 CAAAAATTAGGCTGGCATGGTGG + Intergenic
1104358926 12:128113950-128113972 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1104449832 12:128860171-128860193 CAGAAATTAGGCTGGCGCGGTGG + Intronic
1104453033 12:128886738-128886760 GACCCATGAGGCTGGGACAGGGG - Intronic
1104507214 12:129343782-129343804 AACAAATGAGCCGGGCATGGTGG + Intronic
1104527840 12:129540775-129540797 GTTGAATGAGGCTGGCATGGTGG - Intronic
1104834877 12:131782891-131782913 CAACATTGAGGCTGGCACGGTGG + Intronic
1104883907 12:132093031-132093053 GACAAATGGGCCAGGCGCGGTGG - Intronic
1104923050 12:132301056-132301078 GACAAAAGCAGCTGGCTCGGAGG - Intronic
1105402991 13:20111907-20111929 GAAAAATTAGCCGGGCACGGTGG + Intergenic
1106200626 13:27533656-27533678 GACAAAGGAGGCAGGCACCGGGG + Intergenic
1106260114 13:28058985-28059007 AAAAAATGTGGCTGGCACTGTGG + Intronic
1107954699 13:45499867-45499889 CAAAAATGAGGCAGGCATGGTGG + Intronic
1108806362 13:54161660-54161682 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1109007970 13:56902395-56902417 CACAAATTAGCCGGGCACGGTGG - Intergenic
1109626732 13:64983470-64983492 CACAAAAGTGGCTGGCAAGGTGG - Intergenic
1109807305 13:67460296-67460318 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1110382299 13:74867172-74867194 AAAAAATTAGCCTGGCACGGTGG - Intergenic
1111349918 13:87014454-87014476 CACAAATTAGCCTGGCATGGTGG + Intergenic
1112008014 13:95270806-95270828 GCCAAATGGGCCGGGCACGGTGG + Intronic
1112137315 13:96595196-96595218 GAAAAATTAGCCAGGCACGGTGG - Intronic
1112277022 13:98030638-98030660 GACAAATGAGTCAGGCTCGGTGG + Intergenic
1112511046 13:100009744-100009766 CACAAATTAGGCAGGCATGGTGG - Intergenic
1114135212 14:19840393-19840415 GACCAGTGAGGATGGCAAGGTGG + Intergenic
1114225266 14:20732281-20732303 AAAAAATTAGCCTGGCACGGTGG - Intronic
1114880001 14:26772868-26772890 CAAAAATTAGCCTGGCACGGTGG - Intergenic
1114896977 14:27002941-27002963 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1115568812 14:34648153-34648175 AAAAAATGAGCGTGGCACGGTGG + Intergenic
1116237552 14:42298115-42298137 AACAAATTAGGCAGGCATGGTGG - Intergenic
1116741559 14:48761354-48761376 GGCAAATGGGCCAGGCACGGTGG - Intergenic
1117498743 14:56331305-56331327 GGCAAATGGGCCGGGCACGGTGG - Intergenic
1117720341 14:58623164-58623186 GAAAAATTAGCCTGGCATGGTGG + Intergenic
1117919783 14:60717225-60717247 CAAAAATTAGGCTGGCATGGTGG - Intronic
1118262016 14:64256574-64256596 GAAAAATTAGCCTGGCATGGTGG + Intronic
1118308727 14:64677035-64677057 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1118872775 14:69757317-69757339 GAAAAATTAGGCTGGCATGGTGG - Intronic
1118876082 14:69785894-69785916 AACACATGAGGCTGGCGTGGTGG - Intronic
1119231131 14:72980718-72980740 AAAAAATTAGCCTGGCACGGTGG - Intronic
1119811582 14:77525302-77525324 GAAAAATGAGCCAGGCACGGTGG + Intronic
1120189578 14:81428433-81428455 GACAAATGGGCCAGGCATGGTGG + Intronic
1120252023 14:82069563-82069585 CACAAATGAGCCAGGCATGGTGG - Intergenic
1120882157 14:89422029-89422051 GAAAAATTAGCCTGGCATGGTGG - Intronic
1121054493 14:90841609-90841631 CAAAAATCAGCCTGGCACGGTGG - Intergenic
1121620729 14:95346387-95346409 GAAAAATTAGCCTGGCATGGTGG + Intergenic
1121954937 14:98205181-98205203 GAGAAAGGAGGCGGGCATGGGGG - Intergenic
1122393758 14:101408180-101408202 GGCAGATGAGGCTGGCGCAGGGG - Intergenic
1122586704 14:102812764-102812786 GAAAAATTAGCCGGGCACGGTGG + Intronic
1123095987 14:105767233-105767255 GACAGATGGGGATGGCATGGGGG + Intergenic
1123096037 14:105767401-105767423 GACAGATGGGGATGGCATGGGGG + Intergenic
1123721562 15:23065815-23065837 AACAAATGAGCCGGGCATGGTGG - Intergenic
1123857833 15:24432193-24432215 AAAAAATTAGCCTGGCACGGTGG + Intergenic
1125369594 15:38957886-38957908 AAAAAATTAGGCTGGCATGGTGG + Intergenic
1125657497 15:41370092-41370114 GACAAATCAGCCAGGCGCGGTGG + Intronic
1126597790 15:50399147-50399169 CAAAAATTAGCCTGGCACGGTGG + Intergenic
1126984314 15:54286028-54286050 AACAAATTAGCCTGGCATGGTGG - Intronic
1127050180 15:55074580-55074602 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1127492718 15:59480166-59480188 GATATATGAGGCTGGAACTGTGG + Intronic
1127916683 15:63460682-63460704 GAGAAATGAGGCAGGCAGGCAGG - Intergenic
1128026603 15:64442698-64442720 GAGAACTGAGCCAGGCACGGTGG + Intronic
1128417623 15:67461250-67461272 AACACATGGGCCTGGCACGGAGG + Intronic
1128998409 15:72313635-72313657 GTGAAATGCGGCTGGCACTGTGG - Intronic
1129195279 15:73961050-73961072 GAAAAATAGGCCTGGCACGGTGG - Intergenic
1129514061 15:76145959-76145981 GAAAAATGAGGCTGTCAGTGAGG + Intronic
1129753294 15:78080791-78080813 CAAAAATGAGCCAGGCACGGTGG + Intronic
1129860918 15:78860794-78860816 GAACAATGGGCCTGGCACGGTGG + Intronic
1130060575 15:80567036-80567058 CACACATGAGCCTGGCACAGAGG - Intronic
1130411795 15:83654079-83654101 GTTAAATGGGGCTGGGACGGGGG - Exonic
1130523733 15:84685408-84685430 AAAAAATGAGTCAGGCACGGTGG - Intronic
1131159098 15:90092864-90092886 TTAAAATTAGGCTGGCACGGTGG - Intronic
1131246376 15:90797261-90797283 GACAAATTAGTCGGGCATGGTGG + Intronic
1132255872 15:100374902-100374924 AAAAAATGAGGCAGGCATGGTGG - Intergenic
1132424947 15:101708091-101708113 GAAAAATTAGTCAGGCACGGTGG + Intronic
1132763244 16:1521351-1521373 GGAAAATCAGGCCGGCACGGTGG - Intronic
1132955449 16:2590272-2590294 CAAAAATGAGCCAGGCACGGTGG - Intronic
1132980091 16:2734021-2734043 AATAAATAGGGCTGGCACGGTGG - Intergenic
1133162454 16:3921002-3921024 CAAAAATGAGGTGGGCACGGTGG - Intergenic
1133213638 16:4277200-4277222 AAAAAATTAGACTGGCACGGTGG + Intergenic
1133372797 16:5258029-5258051 GACAAATTAGTCAGGCAAGGTGG - Intergenic
1133540426 16:6747254-6747276 TACAAATTAGCCTGGCATGGTGG + Intronic
1133649601 16:7799057-7799079 GAGAAATAAGCCAGGCACGGTGG - Intergenic
1134166510 16:11934264-11934286 ATGACATGAGGCTGGCACGGTGG + Intronic
1134188960 16:12106624-12106646 GAAAAATGAGCCAGGCATGGTGG - Intronic
1134485307 16:14653478-14653500 TACAAATTAGGCGGGCATGGTGG - Intronic
1134494200 16:14719445-14719467 ATGACATGAGGCTGGCACGGTGG - Intronic
1134499581 16:14758567-14758589 ATGACATGAGGCTGGCACGGTGG - Intronic
1134582732 16:15384790-15384812 CAAAAATGAGCCAGGCACGGTGG - Intergenic
1134642523 16:15840577-15840599 TAAAAATTAGCCTGGCACGGTGG + Intronic
1134680174 16:16119536-16119558 GAAAAATTAGCCAGGCACGGTGG + Intronic
1134871355 16:17654905-17654927 GAAAAATGAGGCGGGCATGGTGG + Intergenic
1135107690 16:19664745-19664767 CAAAAATTAGCCTGGCACGGTGG + Intronic
1135311902 16:21411669-21411691 ATGACATGAGGCTGGCACGGTGG + Intronic
1135314055 16:21428857-21428879 CAAAAATGAGCCGGGCACGGTGG - Intronic
1135364851 16:21844121-21844143 ATGACATGAGGCTGGCACGGTGG + Intronic
1135366979 16:21861135-21861157 CAAAAATGAGCCGGGCACGGTGG - Intronic
1135444836 16:22510025-22510047 CAAAAATGAGCCGGGCACGGTGG + Intronic
1135446989 16:22527216-22527238 ATGACATGAGGCTGGCACGGTGG - Intronic
1135541754 16:23335437-23335459 GAAAATACAGGCTGGCACGGTGG - Intronic
1135618477 16:23932672-23932694 GACAAGTGAAGCTGGCTCAGAGG + Intronic
1136023316 16:27453953-27453975 CAAAAATGAGTCTGGCATGGTGG + Intergenic
1136103849 16:28014784-28014806 GACAAATGAGGCTGGCACGGTGG - Intronic
1136151068 16:28349599-28349621 ATGACATGAGGCTGGCACGGTGG + Intronic
1136167302 16:28463437-28463459 ATGACATGAGGCTGGCACGGTGG + Intronic
1136195675 16:28651579-28651601 ATGACATGAGGCTGGCACGGTGG - Intronic
1136212013 16:28765696-28765718 ATGACATGAGGCTGGCACGGTGG - Intronic
1136256733 16:29045646-29045668 ATGACATGAGGCTGGCACGGTGG - Intronic
1136310725 16:29407565-29407587 CAAAAATGAGCCGGGCACGGTGG - Intergenic
1136322021 16:29492202-29492224 ATGACATGAGGCTGGCACGGTGG + Intronic
1136324166 16:29509343-29509365 CAAAAATGAGCCGGGCACGGTGG - Intergenic
1136436701 16:30232175-30232197 ATGACATGAGGCTGGCACGGTGG + Intronic
1136438851 16:30249325-30249347 CAAAAATGAGCCGGGCACGGTGG - Intronic
1136783053 16:32919057-32919079 GAAAGATGGGGCGGGCACGGTGG - Intergenic
1137740096 16:50761208-50761230 GACAAATGAGGGTGGAAGAGTGG - Intronic
1138656025 16:58491932-58491954 GAAAAATGAGACAGGCATGGTGG - Intronic
1138855228 16:60683178-60683200 AAAAAATGAGCCTGGCATGGTGG - Intergenic
1138903549 16:61302911-61302933 GACAAATTGGCCAGGCACGGTGG - Intergenic
1139328361 16:66168947-66168969 GGAAAAGGAGGCTGGCAGGGAGG + Intergenic
1139358975 16:66384811-66384833 GAAAAATTAGCCAGGCACGGTGG + Intronic
1139549458 16:67665512-67665534 CAAAAATCAGGCTGGCATGGTGG - Intronic
1139628220 16:68209212-68209234 GATAAATGAGTTGGGCACGGTGG + Intronic
1139771100 16:69278027-69278049 CAAAAATGAGCCAGGCACGGCGG + Intronic
1139856307 16:69983105-69983127 ATGACATGAGGCTGGCACGGTGG + Intergenic
1139858403 16:69999942-69999964 CAAAAATGAGCCGGGCACGGTGG - Intergenic
1140225431 16:73072715-73072737 AACAAATTAGCCTGGCATGGTGG - Intergenic
1140323252 16:73974484-73974506 GGCAAATGAGTCTGGCAAGCTGG + Intergenic
1140867471 16:79076506-79076528 GACAGCGGGGGCTGGCACGGAGG - Intronic
1141713698 16:85715002-85715024 AAAAAATTAGGCAGGCACGGTGG + Intronic
1142162927 16:88568577-88568599 AACAAAGGAGCCGGGCACGGTGG - Intergenic
1142337209 16:89497178-89497200 GAAAAATTAGCCAGGCACGGTGG + Intronic
1142857827 17:2742222-2742244 GAAAAATTAGCCGGGCACGGGGG - Intergenic
1142867060 17:2797527-2797549 GACTAATGGGGGTGGCACGAAGG + Intronic
1143419142 17:6775773-6775795 AAGAAATGAGGCTGGGACAGTGG + Intergenic
1143824302 17:9591724-9591746 GAAAAATGAGCCAGGCACGGTGG + Intronic
1144030985 17:11323365-11323387 AACACATGAGCCGGGCACGGTGG + Intronic
1144340545 17:14306235-14306257 GAAAAATGAAACTGACACGGTGG - Intronic
1146076668 17:29736632-29736654 GAAAAATTAGCCAGGCACGGTGG + Intronic
1146189161 17:30749688-30749710 TAAAAATGAGCCGGGCACGGTGG - Intergenic
1146384147 17:32354461-32354483 TACAACTCAGGCAGGCACGGTGG - Intronic
1146621856 17:34404890-34404912 TAGAAATGAGGCTGGCAGGGTGG - Intergenic
1146888661 17:36489905-36489927 GACAAATGGGCCGGGCATGGTGG - Intronic
1147056827 17:37841186-37841208 AAAAAATTAGGCTGGCGCGGCGG - Intergenic
1147320792 17:39644705-39644727 GAAAAATTAGCCTGGCATGGTGG + Intronic
1147405991 17:40212692-40212714 GACAAATAGGCCGGGCACGGTGG - Intergenic
1147680382 17:42239979-42240001 AAAAAATGAGCCGGGCACGGTGG + Intronic
1147874787 17:43613469-43613491 AAAAAATGAGCCGGGCACGGTGG - Intergenic
1148293943 17:46483171-46483193 GAAAAATGGGCCTGGCACGGTGG - Intergenic
1148316126 17:46700874-46700896 GAAAAATGGGCCTGGCACGGTGG - Intronic
1148520845 17:48273704-48273726 GATAAAAGAGCCGGGCACGGTGG - Intronic
1148574270 17:48698217-48698239 GAAAAGTGGGCCTGGCACGGTGG - Intergenic
1149091275 17:52784231-52784253 AAAAAATGAGCCTGGCACGGTGG - Intergenic
1149474420 17:56947621-56947643 TAAAAATGAGCCTGGCATGGTGG - Intronic
1150042217 17:61876015-61876037 AAAAAATTAGGCAGGCACGGGGG + Intronic
1150215424 17:63466071-63466093 GAAAAATTAGCCTGGCATGGTGG + Intergenic
1150274742 17:63889385-63889407 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1150360927 17:64533452-64533474 AAAAAATGAGCCTGGCATGGTGG + Intronic
1150535929 17:66040775-66040797 GGGAAAAGAGGCTGGCATGGTGG - Intronic
1151012646 17:70518421-70518443 AACAAATTAGCCTGGCATGGTGG - Intergenic
1151146911 17:72049577-72049599 GAAAAATTAGCCTGGCATGGTGG + Intergenic
1151481271 17:74371307-74371329 TACAAATTAGCCAGGCACGGTGG - Intronic
1152418143 17:80176286-80176308 AAAAAATGAGCCTGGCATGGGGG + Intronic
1152432169 17:80254514-80254536 AACAAATTAGCCTGGCGCGGTGG - Intergenic
1152481527 17:80556941-80556963 GAAAAATGAGCCGGGCATGGTGG + Intronic
1152581468 17:81167138-81167160 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1152883774 17:82835710-82835732 AATAAATGAGCCAGGCACGGTGG - Intronic
1153984864 18:10343043-10343065 GACGAATGGGCCAGGCACGGTGG + Intergenic
1154083838 18:11282701-11282723 TACAAATAGGCCTGGCACGGTGG - Intergenic
1154117775 18:11626339-11626361 ATGACATGAGGCTGGCACGGTGG + Intergenic
1154119852 18:11643231-11643253 CAAAAATGAGCCGGGCACGGTGG - Intergenic
1154242432 18:12664670-12664692 GACAAATTAGCCAGGCACAGTGG - Intronic
1154984436 18:21535533-21535555 AAAAAATGAGCCTGGCATGGTGG - Intronic
1157269334 18:46259394-46259416 CAAAAATGAGCCAGGCACGGTGG - Intronic
1157618291 18:49000953-49000975 GACTAATGAGCCTGGCACGGTGG - Intergenic
1158412278 18:57217974-57217996 GACAGATGGGCCTGGCACTGAGG - Intergenic
1158650884 18:59284352-59284374 AACAAATGAGCCGGGCGCGGTGG - Intronic
1158712275 18:59848219-59848241 GTGAAATGAGGCTTGCACAGAGG - Intergenic
1158892360 18:61884710-61884732 TACAAATTAGGCAGGCATGGTGG - Intronic
1160841286 19:1147984-1148006 GTAAAATGTGGCTGGCAGGGAGG + Intronic
1160842686 19:1153524-1153546 GAAAAATAGGCCTGGCACGGTGG - Intronic
1161166919 19:2792804-2792826 AACAAATTAGCCAGGCACGGTGG - Intronic
1161180005 19:2873967-2873989 GAAAAAAGAGCCAGGCACGGTGG + Intronic
1161223431 19:3130330-3130352 CAAAAATTAGGCGGGCACGGCGG + Intergenic
1161417619 19:4156472-4156494 AACAAAAGAGCCAGGCACGGTGG - Intronic
1161593762 19:5141010-5141032 GACAGATCAGTCTGGCAGGGTGG + Intronic
1161782623 19:6303401-6303423 AAAAAATGAGGCAGGCATGGTGG - Intergenic
1161839182 19:6668551-6668573 CACAAATTAGCCAGGCACGGTGG + Intronic
1161879294 19:6936773-6936795 GAAAAATTAGCCGGGCACGGTGG - Intronic
1162446050 19:10723418-10723440 GAAAAATTAGCCGGGCACGGTGG - Intronic
1162508004 19:11098849-11098871 GAAAAATTAGCCTGGCATGGTGG + Intronic
1162651128 19:12089825-12089847 GAGAAATTAGCCTGGCAAGGTGG - Intergenic
1163104886 19:15117522-15117544 AACAAATTAGCCTGGCATGGTGG + Intronic
1163245366 19:16090403-16090425 GAAAAATTAGCCAGGCACGGTGG - Intronic
1163297020 19:16418986-16419008 CCCAAATGAGGCTGCCACAGGGG + Intronic
1163432478 19:17276583-17276605 GAGAACTGGGGCTGGCAAGGTGG - Exonic
1163615867 19:18327856-18327878 CAAAAATTAGGCTGGCGCGGTGG + Intergenic
1163732435 19:18957028-18957050 CAGAAAAGAGGCCGGCACGGTGG - Intergenic
1163800326 19:19361047-19361069 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1163850490 19:19660327-19660349 CACAAATGAGCCGGACACGGTGG + Intronic
1163852927 19:19676268-19676290 GAAAAATTAGCCTGGCATGGTGG - Intronic
1164625773 19:29726889-29726911 GAAAAATTAGTCTGGCATGGTGG - Intergenic
1164657321 19:29932602-29932624 CTCAAATGGGCCTGGCACGGTGG - Intronic
1164995630 19:32719156-32719178 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1165033733 19:33017866-33017888 CAAAAATTAGCCTGGCACGGTGG + Intronic
1165037305 19:33042924-33042946 CAAAAATGAGCCGGGCACGGTGG + Intronic
1165690716 19:37861018-37861040 GACAAATCGGCCTGGCAAGGTGG - Intergenic
1165858479 19:38894247-38894269 AAAAAATGAGCCTGGCATGGTGG - Intronic
1166187270 19:41149109-41149131 GAAAAACCAGGCTGGCACAGTGG + Intergenic
1166658107 19:44627083-44627105 GAGAGATGAGGCTGGCCAGGTGG + Intronic
1166973800 19:46590878-46590900 CAAAAATTAGGCTGGCATGGTGG + Intronic
1167163010 19:47779861-47779883 GAAAACTGAGGCTGGGACTGGGG + Intronic
1167188644 19:47966717-47966739 AAAAAATTAGCCTGGCACGGTGG + Intergenic
1167387724 19:49173955-49173977 AATAAAGGAGGCTGGCATGGTGG - Intronic
1167802031 19:51749812-51749834 GAAAAATTAGCCAGGCACGGCGG - Intronic
1168285960 19:55333550-55333572 AAAAAATTAGGCAGGCACGGTGG - Intronic
925947649 2:8880517-8880539 GATAAATGAGGCTGGAGCCGAGG + Intronic
926089496 2:10041361-10041383 CAAAAATTAGCCTGGCACGGTGG - Intergenic
926135773 2:10334963-10334985 GACAATGGGGGCTGGCACAGTGG - Intronic
926155780 2:10453264-10453286 GGCAAAAGAGGCTGGGAGGGTGG - Intergenic
926401277 2:12499668-12499690 GACAAATAATGCTGGCACTTTGG - Intergenic
927269259 2:21188012-21188034 GAAAAATTAGCCGGGCACGGTGG - Intergenic
927984777 2:27401536-27401558 TACAAAACAGGCAGGCACGGTGG + Intronic
928560123 2:32473904-32473926 TACAAATTAGCCTGGCACTGTGG - Intronic
930739795 2:54819488-54819510 GACAAATAGGCCGGGCACGGTGG + Intronic
931282878 2:60809127-60809149 CACAAATTAGCCTGGCACGGTGG - Intergenic
931370405 2:61657446-61657468 GAAAAATTAGCCTGGCATGGTGG + Intergenic
931945380 2:67300414-67300436 GAAAGATGAGGCTGGAAAGGTGG + Intergenic
932157376 2:69430500-69430522 GAAAAAATAGGCTGGCATGGTGG - Intronic
932322377 2:70831663-70831685 GGAAAGTCAGGCTGGCACGGAGG + Intronic
932394139 2:71428037-71428059 AAAAAATGAGCCAGGCACGGTGG + Intronic
932555763 2:72824096-72824118 GACAAAGGGGCCAGGCACGGTGG + Intronic
932608040 2:73177321-73177343 GGGAAATGAAGCTGGAACGGGGG - Intergenic
932629544 2:73327478-73327500 TAAAAATTAGGCTGGCATGGTGG - Intergenic
932898537 2:75670010-75670032 GACAAATGGGCCAGGCACAGTGG - Intronic
934082422 2:88480616-88480638 CAAAAATCAGCCTGGCACGGCGG - Intergenic
934091369 2:88553474-88553496 GAAAAATGAGCCGGGCATGGTGG - Intergenic
934148522 2:89120366-89120388 GAAAAATTAGGCTGGCATGGTGG + Intergenic
934218771 2:90061644-90061666 GAAAAATTAGGCTGGCATGGTGG - Intergenic
934963231 2:98696032-98696054 GAAAAATTAGGCAGGCATGGTGG - Intronic
935602685 2:104939074-104939096 GAAAAATCAGCCAGGCACGGTGG - Intergenic
935982118 2:108638003-108638025 GAAAAATTAGCCGGGCACGGTGG - Intronic
936252655 2:110878770-110878792 ATCAAAACAGGCTGGCACGGTGG + Intronic
937904610 2:127046800-127046822 GGGAAATGAGGCTGTCAAGGAGG + Intergenic
937989906 2:127656564-127656586 AAAAAATGAGCCTGGCATGGTGG - Intronic
938462447 2:131506607-131506629 CAAAAATGAGCCGGGCACGGTGG + Intergenic
939461984 2:142508943-142508965 CAAAAATGAGCCTGGCATGGTGG - Intergenic
940254841 2:151718004-151718026 AACAAATTAGCCGGGCACGGTGG - Intronic
941043324 2:160647452-160647474 GAGAAAAGAGGGTGGCACTGGGG - Intergenic
942006888 2:171711288-171711310 GAAAAATGGGCCAGGCACGGTGG - Intronic
942145888 2:173025728-173025750 CACAAAAGTGGCTGGCACAGTGG - Intronic
942442110 2:176047420-176047442 GTCAATTGAGCCAGGCACGGTGG - Intergenic
942504800 2:176630282-176630304 GACAAATCAGCCAGGCATGGTGG + Intergenic
943048936 2:182893055-182893077 CAAAAATTAGGCTGGCACAGAGG + Intergenic
943140968 2:183980741-183980763 AAAAAATGGGCCTGGCACGGTGG - Intergenic
943363256 2:186946009-186946031 GACAATGGAGCCGGGCACGGTGG - Intergenic
943599235 2:189893666-189893688 CACAAAGGTGGCTGGCACGATGG - Intronic
944149440 2:196541974-196541996 GACAAAGGTGCCAGGCACGGTGG + Intronic
944411067 2:199442591-199442613 GACAAAAGAGCCGGGCACAGTGG + Intronic
944638343 2:201696428-201696450 GACAGATGAGGCTGACACTCAGG + Intronic
944765786 2:202863002-202863024 AAAAAAAAAGGCTGGCACGGTGG + Intronic
944771703 2:202921152-202921174 AAAAAATGAGCCGGGCACGGTGG - Intronic
945202900 2:207301855-207301877 CAAAAATTAGCCTGGCACGGTGG + Intergenic
945961647 2:216141724-216141746 TACAAATGAGCCAGGCATGGTGG - Intronic
946737556 2:222769646-222769668 GACAGCAGAGGCTGGCACGAAGG - Intergenic
947555202 2:231086194-231086216 AAAAAATTAGGCAGGCACGGTGG - Intronic
947972630 2:234336906-234336928 GAAAAATTAGCCAGGCACGGCGG - Intergenic
948454822 2:238100125-238100147 GAGAAAGGAGGCTGGCCCTGAGG - Intergenic
948568441 2:238901262-238901284 GGCAAAGGAGGCCGGCACGGTGG - Intronic
1169169098 20:3449585-3449607 GACAAATTAGCCAGGCATGGTGG - Intergenic
1170298410 20:14854727-14854749 GACAAATGGGCCGGGCACGATGG + Intronic
1170326028 20:15155334-15155356 GAGAAATGAGGCTGGAAGGGAGG - Intronic
1170372798 20:15667963-15667985 CATAAGTGAGGCAGGCACGGTGG + Intronic
1170616907 20:17960622-17960644 CACAAATTAGCCTGGCATGGTGG + Intronic
1170618605 20:17975402-17975424 GAAAAATTAGCCAGGCACGGTGG + Intronic
1171112169 20:22494293-22494315 GAGAAATGAAGCTAGCACTGGGG + Intergenic
1172154449 20:32813970-32813992 GAAAAATTAGTCAGGCACGGTGG - Intergenic
1172341526 20:34161771-34161793 GACAAATTAGCCGGGCGCGGTGG - Intergenic
1173488023 20:43455979-43456001 GACAAAGGAGGCTGGGATTGGGG - Intergenic
1173509592 20:43615953-43615975 GAAAAATTAGCCAGGCACGGTGG + Intronic
1173633612 20:44535351-44535373 GAAAAATTGGCCTGGCACGGTGG + Intronic
1173728490 20:45312853-45312875 GAAAAATTAGCCTGGCATGGTGG + Intronic
1174051242 20:47769031-47769053 AAAAAATGAGGCAGGCATGGTGG - Intronic
1174322727 20:49754776-49754798 GACACAAAAGTCTGGCACGGTGG + Intergenic
1174420871 20:50398572-50398594 GACAACAGAGGCTGGAGCGGAGG + Intergenic
1174501217 20:50986118-50986140 GAAAAAAGAGGCGGGCGCGGTGG - Intergenic
1174760826 20:53205931-53205953 GACATATGGGCCGGGCACGGTGG + Intronic
1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG + Intronic
1175593285 20:60210955-60210977 TAAAAATTAGCCTGGCACGGTGG - Intergenic
1176334195 21:5580449-5580471 GACAAGAGAGGCTGGCGTGGAGG - Intergenic
1176393562 21:6240503-6240525 GACAAGAGAGGCTGGCGTGGAGG + Intergenic
1176467857 21:7075671-7075693 GACAAGAGAGGCTGGCGTGGAGG - Intronic
1176491418 21:7457449-7457471 GACAAGAGAGGCTGGCGTGGAGG - Intergenic
1176509224 21:7680934-7680956 GACAAGAGAGGCTGGCGTGGAGG + Intergenic
1176546609 21:8205055-8205077 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1176554503 21:8249246-8249268 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1176565560 21:8388102-8388124 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1176573425 21:8432270-8432292 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1177938983 21:27385572-27385594 CACAATTAAGGCTGGCACAGTGG - Intergenic
1178625256 21:34211114-34211136 GAAAAATGAGTCAGGCATGGTGG - Intergenic
1179168397 21:38953366-38953388 GACCAGTGAGCCTGGCACGATGG + Intergenic
1180185664 21:46138043-46138065 TACATATGAGCCAGGCACGGTGG - Intronic
1180207644 21:46271706-46271728 AAAAAATGAGGCGGGCATGGTGG + Intronic
1181997506 22:26894269-26894291 AAAAAATTAGCCTGGCACGGTGG - Intergenic
1182489629 22:30662674-30662696 AAAAAATGAGGCGGGCATGGTGG + Exonic
1183511293 22:38236634-38236656 CACAAATTAGGCAGGCATGGTGG - Intronic
1183578191 22:38705899-38705921 GTCAAATGAGCCTGGGAGGGAGG + Exonic
1183955639 22:41379183-41379205 AAAAAATTAGGCGGGCACGGTGG + Intronic
1184228769 22:43146418-43146440 AAAAAATGAGCCGGGCACGGTGG + Intergenic
1184361542 22:44022134-44022156 GAATTATGAGGCAGGCACGGTGG - Intronic
1203251474 22_KI270733v1_random:121321-121343 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1203259524 22_KI270733v1_random:166403-166425 GACAGATCCGGCTGGCAGGGCGG - Intergenic
949234361 3:1790670-1790692 AAGAAATGAGGCAGCCACGGAGG + Intergenic
949545079 3:5065741-5065763 GAAAAATGGGGCTGGTATGGTGG + Intergenic
949752878 3:7375006-7375028 GAAAAATGAGGCAGTCACTGTGG - Intronic
950000703 3:9653914-9653936 GACAAGTCAGACTGGCAAGGTGG + Intronic
950021144 3:9788690-9788712 CAAAAATTAGCCTGGCACGGTGG - Intronic
950164285 3:10781888-10781910 AACCAATGAAGCTGGCACAGAGG + Intergenic
950747982 3:15105916-15105938 GACAAATTAGCCAGGCATGGTGG - Intergenic
950911950 3:16604754-16604776 CAGAAATGAGGCTGGCGGGGCGG + Exonic
952344767 3:32473078-32473100 GACAAATTTGGATGGCATGGAGG + Intronic
952409771 3:33037196-33037218 CAAAAATTAGGCTGGCATGGTGG - Intronic
953369272 3:42373359-42373381 TACAAATGTGGCTGGCACCCAGG - Intergenic
953415755 3:42715457-42715479 CAAAAATAAGCCTGGCACGGTGG + Intronic
953660383 3:44887564-44887586 GACAAATGAGCCTGGAAAGGAGG + Intronic
954015468 3:47685702-47685724 CAAAAATTAGCCTGGCACGGCGG + Intronic
955029927 3:55206060-55206082 GACATGTGAGGCTGCCATGGAGG - Intergenic
955124729 3:56099871-56099893 GGCAAATGTGTCTGGCAAGGGGG - Intronic
955257015 3:57342783-57342805 GGCAAATGAGGCTAGCATGATGG + Intronic
956093295 3:65690611-65690633 TACAAATGAGCCGGGCATGGTGG - Intronic
957070234 3:75562184-75562206 GACAAATTAGTCAGGCATGGTGG + Intergenic
957183188 3:76907990-76908012 GAAAAATTAGCCAGGCACGGTGG - Intronic
957286733 3:78225975-78225997 AATAAATGAGACTGGCAAGGTGG - Intergenic
957747372 3:84362951-84362973 GACAAATTGGCCGGGCACGGTGG - Intergenic
958143376 3:89591393-89591415 CAAAAATTAGCCTGGCACGGTGG + Intergenic
958953796 3:100445117-100445139 CAAAAATGAGGCAGGCATGGTGG + Intronic
959000244 3:100956033-100956055 CAAAAATTAGCCTGGCACGGTGG + Intronic
959927107 3:111935250-111935272 GAAAAATGAGCCAGGCATGGTGG - Intronic
960540115 3:118852329-118852351 CAAAAATGAGCCAGGCACGGTGG + Intergenic
961283856 3:125784333-125784355 GACAAATTAGTCAGGCATGGTGG - Intergenic
961400633 3:126639721-126639743 GAAAAATTAGGCAGGCATGGTGG - Intronic
961730051 3:128958611-128958633 GACAAAAAGGGCTGGCACTGTGG + Intronic
962016754 3:131448732-131448754 CACAAATGAGCCAGGCATGGTGG + Intergenic
963108627 3:141666535-141666557 GAAAAATTAGCCTGGCATGGTGG - Intergenic
963173195 3:142271800-142271822 AAAAAATTAGGCTGGCATGGTGG + Intergenic
963311628 3:143716225-143716247 AAAAAATGAGCCTGGCATGGTGG - Intronic
964015949 3:151947106-151947128 ACAAAATGAGCCTGGCACGGTGG - Intergenic
965166707 3:165203327-165203349 GGAAAATGTGGCTGGCACAGTGG - Intergenic
966300337 3:178471920-178471942 GATAAACTAGGCTGGCAGGGAGG + Intronic
966351716 3:179038423-179038445 GAAAAATGAGGCAGGCATGGTGG + Intronic
966425902 3:179779244-179779266 GACTAATGGGCCTGGCGCGGTGG + Intronic
966934514 3:184697091-184697113 GAGAAATGAAGCCGGCAAGGGGG - Intergenic
967027721 3:185579192-185579214 GAAAAATTAGCCTGGCATGGTGG - Intergenic
967680323 3:192354856-192354878 GAAAAATTAGCCAGGCACGGTGG - Intronic
967918274 3:194595776-194595798 AAAAAATGAGCCTGGCATGGTGG - Intronic
968124387 3:196147705-196147727 GAAAAATTAGCCAGGCACGGTGG + Intergenic
968346895 3:198016037-198016059 AAAAAATTAGGCTGGCATGGTGG + Intronic
968768452 4:2487708-2487730 CACAAATGGGGCAGGCACAGTGG - Intronic
969013848 4:4089869-4089891 GACAAATTAGTCAGGCATGGTGG + Intergenic
969740137 4:9018561-9018583 GACAAATTAGTCAGGCATGGTGG - Intergenic
969799301 4:9550076-9550098 GACAAATTAGTCAGGCATGGTGG - Intergenic
969869884 4:10098031-10098053 GACAAATGAGGGAAGCACTGGGG + Intronic
970029879 4:11662643-11662665 GAATAATGAGCCAGGCACGGTGG + Intergenic
970275476 4:14395142-14395164 GAAACATGAGGCTGGCAAGATGG + Intergenic
970920746 4:21391604-21391626 GTCAAGTGAGGCTGGGATGGTGG - Intronic
971321673 4:25610947-25610969 CAAAAATTAGGCTGGCATGGTGG - Intergenic
972138417 4:35923407-35923429 GACATTTGAGCCGGGCACGGTGG - Intergenic
972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG + Intergenic
972788722 4:42350412-42350434 AAAAAATTAGGCTGGCATGGTGG - Intergenic
973102470 4:46290062-46290084 AAAAAATGAGCCGGGCACGGTGG - Intronic
973823133 4:54680678-54680700 GACAAATAAGGCCGGCACGGTGG - Intronic
975294126 4:72712419-72712441 CACAAATGAGGATGCCACAGAGG + Intergenic
976773378 4:88679668-88679690 CAAAAATGAGCCTGGCATGGTGG - Intronic
976826086 4:89261967-89261989 CACAAATTAGCCTGGCATGGTGG + Intronic
976887198 4:90000469-90000491 CAAAAATTAGGCTGGCATGGTGG - Intergenic
977207251 4:94177288-94177310 CACAAATTAGGCAGGCAAGGTGG - Intergenic
977389085 4:96384621-96384643 GACAAATCAGCCAGGCGCGGTGG + Intergenic
978044674 4:104111980-104112002 GAAAAATTAGCCAGGCACGGTGG - Intergenic
978169127 4:105648173-105648195 GACAACTCAGCCGGGCACGGTGG - Intronic
978561565 4:110039317-110039339 TAAAAATGAGCCGGGCACGGTGG - Intergenic
978563037 4:110053650-110053672 CAAAAATTAGGCTGGCACGGTGG + Intronic
978802844 4:112771736-112771758 AAAAAATGAGCCGGGCACGGTGG - Intergenic
979337212 4:119476899-119476921 AAAAAATTAGGCTGGCATGGTGG - Intergenic
979526177 4:121719555-121719577 GAAAAATGAGCCAGGCATGGTGG - Intergenic
979958854 4:126991222-126991244 AACAAATTAGCCTGGCATGGTGG + Intergenic
981438623 4:144756603-144756625 AAAAAATGAGCCGGGCACGGTGG - Intergenic
981952141 4:150422676-150422698 AACAACTGAGACTGGCACTGTGG + Intronic
982046487 4:151452436-151452458 GATACATCAGGCTGGCATGGTGG + Intronic
982207344 4:153006474-153006496 GAAAAATGAGGCTGGAAGGTGGG + Intergenic
983078882 4:163360526-163360548 AAAAAATGAGCCTGGCATGGTGG - Intergenic
984992904 4:185398108-185398130 CACAAATTAGCCGGGCACGGTGG - Intronic
985470618 5:41837-41859 GACACAGGAGGCTGGTATGGTGG - Intergenic
985977623 5:3433504-3433526 AAAAAATTAGGCTGGCATGGTGG - Intergenic
986633867 5:9801037-9801059 CAAAAATTAGGCTGGCATGGTGG + Intergenic
988077407 5:26370152-26370174 CACAAATTAGGCAGGCATGGTGG + Intergenic
988457571 5:31400132-31400154 GAAAAATGGGCCAGGCACGGTGG - Intergenic
989040100 5:37218658-37218680 GACAAATGAGCTGGGCGCGGTGG + Intronic
989272178 5:39546327-39546349 CAAAAATGAGCCTGGCATGGTGG + Intergenic
990475169 5:56155691-56155713 GAAAAATTAGCCTGGCATGGTGG + Intronic
992219683 5:74559463-74559485 GACAAATGAGGGTGGGGCGAGGG + Intergenic
992698305 5:79313264-79313286 TACAAATTAGCCTGGCATGGTGG + Intronic
993548072 5:89238062-89238084 GAAAAATTAGCCTGGCATGGTGG - Intergenic
993946643 5:94123243-94123265 GATAAATGGGGCTGCCAGGGAGG + Intergenic
994492978 5:100471843-100471865 GAAAAATGAGGCTATCACGTAGG - Intergenic
995517560 5:112969215-112969237 GAAAAATTAGCCTGGCATGGTGG - Intergenic
995973000 5:117995907-117995929 GAAAAATAAGGCTGGAAAGGTGG + Intergenic
996710613 5:126539566-126539588 AACAACTGAGCCGGGCACGGTGG + Intergenic
997165518 5:131657154-131657176 CACAAATGAGCCAGGCATGGTGG - Intronic
998112549 5:139513467-139513489 GAAAAATTAGCCTGGCACGGTGG - Intergenic
999260925 5:150238599-150238621 AAGAAATGAGGTTGGCACGTGGG + Intronic
999748415 5:154609118-154609140 GAAAAATGAGAGTGGCACAGTGG - Intergenic
1000558144 5:162752756-162752778 GAGAAATGAGGCTAACAGGGAGG - Intergenic
1000765532 5:165284761-165284783 GAAAAATGAGGCTGGACAGGTGG + Intergenic
1001340359 5:170837867-170837889 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1001387108 5:171348916-171348938 CACAAATTAGCCGGGCACGGTGG - Intergenic
1001504668 5:172268593-172268615 GACAAATTAGCCAGGCATGGTGG + Intronic
1003150611 6:3545627-3545649 TAAAAATGAGGCTGGCATTGTGG + Intergenic
1003570981 6:7256398-7256420 CAAAAATTAGGCTGGCATGGTGG + Intergenic
1003578749 6:7320577-7320599 AAAAAATGAGGCAGGCATGGTGG - Intronic
1004116870 6:12777782-12777804 GAAAAATTAGCCGGGCACGGTGG - Intronic
1004132161 6:12930761-12930783 GACAAATGAGCCGGGCACAGTGG + Intronic
1004633346 6:17442868-17442890 GAAAAATTAGCCTGGCATGGTGG - Intronic
1006000374 6:30959962-30959984 AACATATGAGCCGGGCACGGTGG - Intergenic
1006525725 6:34603223-34603245 GGCAACTGAGCCGGGCACGGTGG + Intronic
1006542867 6:34754634-34754656 AAAAAATGAGCCGGGCACGGTGG + Intergenic
1007579260 6:42946448-42946470 GAAAAATTAGCCAGGCACGGTGG + Intergenic
1007689770 6:43692816-43692838 GAAAAATTAGCCAGGCACGGTGG + Intergenic
1007920866 6:45608436-45608458 CACCAGTGAGGCTGGCAGGGTGG + Intronic
1009560550 6:65236322-65236344 GTAAAATGGGTCTGGCACGGTGG + Intronic
1011078151 6:83460060-83460082 GCCATATGATGCTGGGACGGAGG - Intergenic
1012112611 6:95256482-95256504 CAAAAATTAGCCTGGCACGGTGG - Intergenic
1012254885 6:97020093-97020115 CAAAAATCAGCCTGGCACGGTGG - Intronic
1012753874 6:103198894-103198916 AACAAATGGGCCGGGCACGGTGG - Intergenic
1013471909 6:110473675-110473697 AAAAAATGAGCCTGGCATGGTGG - Intronic
1013502751 6:110769000-110769022 GAAAAATTAGCCTGGCATGGTGG + Intronic
1014029305 6:116682174-116682196 GAAAAATTAGCCTGGCATGGTGG + Intronic
1014697489 6:124641702-124641724 AATAAATAAGGCTGGCATGGTGG - Intronic
1015493930 6:133860201-133860223 GACATATGGGCCGGGCACGGTGG - Intergenic
1015558275 6:134485012-134485034 AAGAAATCAGGCTGGCATGGTGG - Intergenic
1016456517 6:144236416-144236438 AAAAAATTAGCCTGGCACGGTGG - Intergenic
1016831983 6:148443061-148443083 AACAAATACAGCTGGCACGGTGG - Intronic
1017222796 6:151985954-151985976 AACAATTGGGGCAGGCACGGTGG - Intronic
1017376296 6:153773099-153773121 CAAAAATTAGCCTGGCACGGTGG + Intergenic
1017422030 6:154282532-154282554 AAAAAATTAGGCGGGCACGGTGG + Intronic
1018139536 6:160816395-160816417 GAAAAATTAGCCTGGCATGGCGG + Intergenic
1018589172 6:165398326-165398348 GAAAAATTAGCCAGGCACGGTGG + Intronic
1019377933 7:705737-705759 CACAGATGAGGCGGGCACTGTGG + Intronic
1019494458 7:1331298-1331320 GGCAAAGGAGGCTGGCGGGGTGG - Intergenic
1019548545 7:1590807-1590829 GAGAAATGAGGCTGGGTCTGGGG + Intergenic
1019677856 7:2326082-2326104 GATAAATCAGCCAGGCACGGTGG + Intronic
1019759463 7:2799427-2799449 AACAAATTAGGCAGGCATGGTGG + Intronic
1019943253 7:4307819-4307841 AACAAATGAGGCAGGCCTGGAGG + Intergenic
1020035718 7:4961821-4961843 GATAGATGAGGCTGGGACGGAGG - Intergenic
1020121023 7:5503504-5503526 GAAAAATGAGCATGGCATGGTGG - Intronic
1020160301 7:5765653-5765675 GAAACATGGGGCTGGCATGGTGG + Intronic
1020691580 7:11361448-11361470 AAAAAATGAGCCAGGCACGGTGG - Intergenic
1021369062 7:19818463-19818485 CAAAAATGAGCCTGGCATGGTGG + Intergenic
1021630182 7:22637379-22637401 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1022065916 7:26857717-26857739 GACAAATGGGGCTGGATCTGTGG + Intronic
1022240899 7:28511635-28511657 GAAAAATGAGCCGGGCATGGTGG - Intronic
1025078451 7:55963200-55963222 CACAAATGAGCCAGGCACGGTGG - Intronic
1025222353 7:57124785-57124807 GACAAATGAGCCAGGTGCGGTGG + Intronic
1025605836 7:63039304-63039326 GACAAAGAAGGCTGGGAAGGGGG - Intergenic
1025633135 7:63296456-63296478 GACAAATGAGCCAGGTGCGGTGG + Intergenic
1025649561 7:63451727-63451749 GACAAATGAGCCAGGTGCGGTGG - Intergenic
1025909359 7:65815515-65815537 GACAAATAAGATGGGCACGGTGG - Intergenic
1025985408 7:66446365-66446387 GAGAAATACAGCTGGCACGGGGG - Intergenic
1026029619 7:66779214-66779236 GAGAAATACGGCTGGCACAGGGG + Intronic
1026645771 7:72166888-72166910 CACAAATTAGCCTGGCATGGTGG + Intronic
1026692111 7:72558799-72558821 GACTAATCAGCCAGGCACGGTGG - Intronic
1026781078 7:73267892-73267914 GACAAATGAGAGGGGCAGGGTGG - Intergenic
1026820461 7:73544471-73544493 CAAAAATGAGCCTGGCATGGTGG + Intronic
1026875909 7:73879086-73879108 GAAAAATTAGGCGGGCATGGTGG - Intergenic
1026950948 7:74346387-74346409 TAGAAATGAGGCTGCCACTGGGG + Intronic
1026989337 7:74574610-74574632 CAAAAATTAGCCTGGCACGGTGG - Intronic
1027021932 7:74821334-74821356 GACAAATGAGAGGGGCAGGGTGG - Intronic
1027066089 7:75124583-75124605 GACAAATGAGAGGGGCAGGGTGG + Intronic
1027142553 7:75669218-75669240 AAAAAATTAGGCTGGCATGGCGG + Intronic
1027162908 7:75815184-75815206 GAAAAATTAGCCAGGCACGGTGG + Intronic
1027784073 7:82557203-82557225 CATAAATGAGGCCAGCACGGTGG + Intergenic
1028852290 7:95551131-95551153 CAAAAATGAGCCTGGCATGGTGG - Intergenic
1028867984 7:95735918-95735940 GACAAATGGGCCAGGCACAGTGG - Intergenic
1029000483 7:97149222-97149244 CACAAATCAGCCAGGCACGGTGG - Intronic
1029253487 7:99253112-99253134 GAAAAATTAGCCTGGCATGGTGG + Intergenic
1029675430 7:102065231-102065253 TACAAATTAGACAGGCACGGTGG - Intronic
1029729139 7:102427923-102427945 CAAAAATTAGGCTGGCATGGTGG - Intergenic
1030544325 7:110873268-110873290 AAAAAATTAGGCTGGCATGGTGG + Intronic
1030976527 7:116130763-116130785 GAAAAATTAGTCTGGCATGGTGG - Intronic
1031789124 7:126077686-126077708 ATCAAATGAGGCGGTCACGGAGG - Intergenic
1032271350 7:130410176-130410198 GAAAAATTAGCCAGGCACGGTGG - Intronic
1033095723 7:138429173-138429195 CAAAAATGAGCCAGGCACGGTGG + Intergenic
1033117009 7:138634353-138634375 GAAAATTAAGGCAGGCACGGTGG + Intronic
1034319476 7:150166544-150166566 CAAAAATTAGCCTGGCACGGTGG + Intergenic
1034773283 7:153800667-153800689 CAAAAATTAGCCTGGCACGGTGG - Intergenic
1034818575 7:154196200-154196222 TACAAATGGGCCGGGCACGGTGG + Intronic
1034861647 7:154600278-154600300 GAAAAATTAGCCGGGCACGGTGG - Intronic
1035058174 7:156050670-156050692 GACAAAAGAAGGTGGCTCGGGGG + Intergenic
1035144578 7:156801682-156801704 CAAAAATCAGCCTGGCACGGTGG - Intronic
1035183363 7:157107031-157107053 GAAAAAATAGGCTGGCACAGTGG - Intergenic
1035186468 7:157129970-157129992 AAAAAATGAGTCTGGCATGGTGG - Intergenic
1035315764 7:157997037-157997059 GTGCAATGAGGCCGGCACGGGGG + Intronic
1035909672 8:3551938-3551960 GAAAGATGAGGCTGCCACTGTGG + Intronic
1036063908 8:5356909-5356931 CAAAAATTAGGCAGGCACGGTGG - Intergenic
1036207605 8:6816440-6816462 GACAAAGGAGCCTGGCCCCGTGG + Intronic
1036213940 8:6863659-6863681 GACAAGGGAGGCTGGCGGGGAGG + Intergenic
1036245163 8:7109814-7109836 GACAAATCAGTCAGGCATGGTGG - Intergenic
1036255586 8:7203993-7204015 GACAAATTAGTCAGGCATGGTGG + Intergenic
1036361899 8:8083508-8083530 GACAAATTAGTCAGGCATGGTGG - Intergenic
1036674743 8:10821186-10821208 GACAAGTGAGTCTGTGACGGTGG - Intronic
1036800320 8:11786220-11786242 GACAACTGGGGCTGGCACTGCGG - Exonic
1036889070 8:12583512-12583534 GACAAATTAGTCAGGCATGGTGG + Intergenic
1036896654 8:12641656-12641678 GACAAATTAGTCAGGCATGGTGG + Intergenic
1038141547 8:24850508-24850530 CAAAAATTAGGCTGGCATGGTGG + Intergenic
1038542305 8:28400244-28400266 GACTAATAAGTTTGGCACGGTGG - Intronic
1038558630 8:28548138-28548160 GACAAGTGAGCTGGGCACGGTGG - Intronic
1038730415 8:30121876-30121898 AAAAAATTAGGCTGGCACAGTGG + Intronic
1038788804 8:30648272-30648294 GCCAGATGAGGCAGGCACGCAGG + Intronic
1039161499 8:34626644-34626666 CAAAAATGAGCCAGGCACGGTGG + Intergenic
1039315070 8:36362482-36362504 CACAAATTAGCCTGGCATGGTGG - Intergenic
1039488825 8:37932315-37932337 AAAAAATTAGGCAGGCACGGTGG + Intergenic
1039511640 8:38096637-38096659 GAAAAATGAGCCAGGCATGGTGG + Intergenic
1039874956 8:41577841-41577863 GTGAAATCAGGCTGGCACCGCGG - Intronic
1039942545 8:42103589-42103611 AAAAAATTAGGCTGGCATGGTGG - Intergenic
1040048156 8:42984078-42984100 GACAAATGGGCTGGGCACGGTGG + Intronic
1040696200 8:50001968-50001990 GACGAATCAGGCTGGGAAGGAGG + Intronic
1040826918 8:51632448-51632470 GAAAAATGAGCCAGGCATGGTGG + Intronic
1040912991 8:52540576-52540598 GAAAAATGAGCCAGGCATGGCGG + Intronic
1041624592 8:60011012-60011034 GAAAAATTAGCCAGGCACGGTGG + Intergenic
1042307402 8:67345785-67345807 GAAAAATTAGCCAGGCACGGTGG + Intergenic
1042390075 8:68224169-68224191 GAAAAATTAGCCTGGCATGGTGG - Intronic
1042540366 8:69901887-69901909 GATATATAAGGCTGGCATGGTGG - Intergenic
1042557558 8:70046158-70046180 AAAAAATTAGCCTGGCACGGTGG + Intergenic
1043073690 8:75668986-75669008 GCAAAATGAGGCTGTCAGGGTGG + Intergenic
1043409166 8:79974251-79974273 AACAAACGAGGCCGGCGCGGTGG + Intronic
1044790104 8:95838461-95838483 GTCAAATGAGACTGGCATGGAGG - Intergenic
1045163880 8:99581028-99581050 CACAAATTAGGCAGGCATGGTGG + Intronic
1045235362 8:100347861-100347883 AAAAAATGAGCCGGGCACGGTGG - Intronic
1045493039 8:102684932-102684954 AACAACACAGGCTGGCACGGTGG - Intergenic
1046648662 8:116813026-116813048 AAAAAATGAGGCTGGCATGGTGG + Intronic
1046957284 8:120074621-120074643 ACCAAATGGGGCGGGCACGGTGG - Intronic
1047111593 8:121795400-121795422 CAAAAATGAGCCGGGCACGGTGG + Intergenic
1047384533 8:124396704-124396726 GAAAAATTAGACTGGCATGGTGG - Intergenic
1049290320 8:141798256-141798278 GACGAATCAGGCTGCCACTGTGG - Intergenic
1049290561 8:141799574-141799596 GACAATTGAGGGAGGCACGAGGG + Intergenic
1049507732 8:143012738-143012760 AACAAATCAGCCAGGCACGGTGG + Intergenic
1049618561 8:143587614-143587636 GAGAAATGGGCCGGGCACGGTGG - Intronic
1049772510 8:144390277-144390299 AAAAAATTAGGCAGGCACGGTGG - Intronic
1049908984 9:246901-246923 GACAAATTAGACAGGCACAGTGG - Intronic
1049978774 9:884815-884837 GAAAAATTAGCCAGGCACGGTGG + Intronic
1050705517 9:8392235-8392257 AAAAAATTAGGCTGGCATGGTGG + Intronic
1051256098 9:15215568-15215590 AATAAATGAGACAGGCACGGTGG + Intronic
1051635804 9:19179913-19179935 AAAAAGTGAGGCTGGCAAGGTGG + Intergenic
1052060017 9:23948472-23948494 CAAAAATTAGGCTGGCATGGTGG - Intergenic
1052096773 9:24392738-24392760 GACATTTGAGCCTGGCATGGTGG + Intergenic
1052182833 9:25551408-25551430 GACAAATGGGGCGGGGAGGGGGG + Intergenic
1052813243 9:33080106-33080128 GAAAAATTAGCCTGGCATGGTGG + Intergenic
1053454545 9:38223558-38223580 CAAATTTGAGGCTGGCACGGTGG + Intergenic
1053472624 9:38357822-38357844 GAGAAACAAGGCTGGCAAGGCGG - Intergenic
1055445601 9:76379075-76379097 GAAAAATGAGGCCAGCATGGTGG - Intergenic
1057575843 9:96241780-96241802 GAAAAATTAGTCAGGCACGGTGG + Intronic
1057859693 9:98630347-98630369 GAGAGATGAGGTTGGCAGGGAGG + Intronic
1058197933 9:102001564-102001586 TACAAATTAGGCAGGCATGGCGG - Intergenic
1058225906 9:102363037-102363059 GACAAAAGACGCTGCCACAGAGG + Intergenic
1058310306 9:103492255-103492277 CAAAAATGAGCCAGGCACGGTGG + Intergenic
1058729852 9:107839198-107839220 CACAAATTAGCCTGGCATGGTGG + Intergenic
1058803963 9:108572018-108572040 CAAAAATGAGCCTGGCATGGTGG + Intergenic
1058877574 9:109257840-109257862 GAAAAATGAGCCAGGCATGGTGG + Intronic
1058917763 9:109584240-109584262 GAAAAATGAGCCAGGCATGGTGG - Intergenic
1058996338 9:110302286-110302308 GACAAATTAGCCAGGCATGGTGG - Intergenic
1059100391 9:111465879-111465901 GAAAAATGAGCCAGGCATGGTGG + Intronic
1059935255 9:119304030-119304052 CAAAAATTAGGCAGGCACGGTGG - Intronic
1060229276 9:121814824-121814846 GACACAGGAGCCTGGGACGGAGG + Intergenic
1060660307 9:125401560-125401582 GAAAACTGAGGCTTGCAGGGGGG - Intergenic
1060958201 9:127659577-127659599 GACACCTAAGGCTGGCATGGTGG - Intronic
1061429294 9:130521032-130521054 GACAAGTGGGCCGGGCACGGTGG + Intergenic
1061969671 9:134037416-134037438 CAAAAATGAGCCAGGCACGGTGG + Intronic
1062387519 9:136318872-136318894 CCCAACTGAGGCTGGCACTGTGG + Intergenic
1062589631 9:137267644-137267666 CAAAAATTAGCCTGGCACGGTGG - Intronic
1203427443 Un_GL000195v1:54448-54470 GACAAGAGAGGCTGGCTTGGAGG + Intergenic
1203467876 Un_GL000220v1:104472-104494 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1203475697 Un_GL000220v1:148444-148466 GACAGATCCGGCTGGCAGGGCGG - Intergenic
1185476133 X:416666-416688 ACAAAATGAGGCTGGCACAGTGG - Intergenic
1185476163 X:416831-416853 ACGAAATGAGGCTGGCACAGTGG - Intergenic
1185476193 X:416996-417018 ACAAAATGAGGCTGGCACGGTGG - Intergenic
1185551851 X:988267-988289 CACAAATTAGCCAGGCACGGTGG + Intergenic
1185587387 X:1249886-1249908 ACAAACTGAGGCTGGCACGGTGG + Intergenic
1185597833 X:1318762-1318784 AAAAAATGAGCCTGGCATGGTGG + Intergenic
1185684666 X:1918418-1918440 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1185684753 X:1919137-1919159 GAAAAATTAGCCTGGCATGGTGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186596045 X:10982606-10982628 GTAAAATGAGGCTGGTAGGGAGG + Intergenic
1187013794 X:15306548-15306570 TAAAAATTAGCCTGGCACGGTGG + Intronic
1187151386 X:16684936-16684958 CAAAAATTAGGCTGGCATGGTGG + Intronic
1189621768 X:42848266-42848288 GAAAAATGGGCCTGGCACAGTGG + Intergenic
1189761877 X:44330102-44330124 AAAAAATGAGCCTGGTACGGTGG + Intronic
1189798860 X:44673510-44673532 TAAAAAGGAGGCTGGCATGGTGG - Intergenic
1189894624 X:45641437-45641459 GACAAAAGGGCCTGGCACGGTGG - Intergenic
1190043197 X:47088780-47088802 AACAAATGAGCCAGGCATGGTGG + Intronic
1190631230 X:52388663-52388685 TAAAAATGAGGCAGGCATGGTGG + Intergenic
1190725466 X:53187615-53187637 CACAAATCAGCCAGGCACGGTGG + Intergenic
1192253990 X:69439641-69439663 GAAAAATTAGCCAGGCACGGTGG - Intergenic
1192474072 X:71424399-71424421 AAAAAAAGAGCCTGGCACGGTGG - Intronic
1193365681 X:80629577-80629599 CAAAAATTAGGCTGGCATGGTGG + Intergenic
1193424752 X:81328265-81328287 AACAAATTAGCCTGGCATGGTGG + Intergenic
1193722456 X:85003365-85003387 GACAAATGAGGCCGGCGCGGTGG - Intergenic
1194697032 X:97065334-97065356 GACAAATGAGGTTGTCAAGGTGG - Intronic
1194827933 X:98585459-98585481 CAAAAATTAGCCTGGCACGGTGG + Intergenic
1195993923 X:110712452-110712474 GAGAAATGAGGCTGGAAAGTAGG + Intronic
1196096966 X:111810198-111810220 GGCAAAAGAGGCAGGCACGGTGG - Intronic
1196247183 X:113414143-113414165 AAAAAATTAGCCTGGCACGGTGG - Intergenic
1197166980 X:123388531-123388553 GAAAAATCGGCCTGGCACGGTGG - Intronic
1197626152 X:128804438-128804460 GACATTTGAAGCCGGCACGGTGG + Intergenic
1197770097 X:130084213-130084235 GGCAGCTGAGGCTGGCCCGGAGG - Intronic
1198193701 X:134337996-134338018 CACAAATTAGCCGGGCACGGTGG + Intergenic
1199340879 X:146675788-146675810 CACAAATGAGCCAGGCATGGTGG + Intergenic
1199353918 X:146837926-146837948 GAAAAATTAGCCTGGCACAGTGG - Intergenic
1199894329 X:152116926-152116948 CACAAATGAGGTTGGCACATAGG + Intergenic
1199926284 X:152468152-152468174 CAAAAATGAGCCGGGCACGGTGG + Intergenic
1200270032 X:154674116-154674138 AACAAATTAGCCTGGCATGGTGG - Intergenic
1200301961 X:154985281-154985303 CACAAATTAGGCGGGCATGGTGG + Intronic
1201010099 Y:9543391-9543413 AACAAATGAGGCTGGCATGGCGG + Intergenic
1201752860 Y:17452767-17452789 CACAAATTAGCCTGGCATGGTGG + Intergenic