ID: 1136104330

View in Genome Browser
Species Human (GRCh38)
Location 16:28018718-28018740
Sequence GATCTCAGGACATCAACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136104330_1136104333 8 Left 1136104330 16:28018718-28018740 CCCACTGTTGATGTCCTGAGATC 0: 1
1: 0
2: 2
3: 5
4: 139
Right 1136104333 16:28018749-28018771 AACCCAGACCCCACCTCACCTGG 0: 1
1: 0
2: 0
3: 27
4: 346
1136104330_1136104336 15 Left 1136104330 16:28018718-28018740 CCCACTGTTGATGTCCTGAGATC 0: 1
1: 0
2: 2
3: 5
4: 139
Right 1136104336 16:28018756-28018778 ACCCCACCTCACCTGGAAACCGG 0: 1
1: 0
2: 0
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136104330 Original CRISPR GATCTCAGGACATCAACAGT GGG (reversed) Intronic
900654020 1:3746248-3746270 CATCTCAGAGGATCAACAGTGGG + Intergenic
903201493 1:21743426-21743448 GATCTGGGGGCATCACCAGTGGG + Intronic
904966656 1:34379400-34379422 GATCTCAGGAGATGAACCCTGGG + Intergenic
910487913 1:87736220-87736242 GAGTTCAGGAAGTCAACAGTGGG + Intergenic
914314645 1:146498678-146498700 ACTCTCAGGACAGCAGCAGTGGG + Intergenic
914499705 1:148234710-148234732 ACTCTCAGGACAGCAGCAGTGGG - Intergenic
915615908 1:157038159-157038181 GATCACAGGTCATCACCAGGAGG + Intronic
915717768 1:157960673-157960695 GCTCTCAGGAAAGCAACACTAGG + Intergenic
918223090 1:182454232-182454254 GATCTGATGACATCAACAATGGG - Intronic
920359104 1:205400269-205400291 GAGCTCAGGAGTTCAATAGTGGG - Intronic
1063486156 10:6423069-6423091 CATCTCTGGACAGCAACAGCTGG + Intergenic
1065206275 10:23360618-23360640 GAACCCAGGAGTTCAACAGTGGG - Intergenic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1068787861 10:60996527-60996549 GACATCAGGTCATCTACAGTGGG - Intronic
1070401349 10:76056099-76056121 GCTCTCAGGACAACTAAAGTGGG + Intronic
1073579423 10:104650763-104650785 GATCCCAGGCCAGCAACAGCAGG - Intronic
1073583282 10:104686474-104686496 GAGCTCTGGACACCCACAGTTGG + Intronic
1073596501 10:104805660-104805682 GATCTAGGGACATCCAGAGTAGG + Intronic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1081804801 11:45884776-45884798 GATCCCAAGAAGTCAACAGTGGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083086971 11:60158889-60158911 GATCTGAGGATAGCAAAAGTGGG + Intergenic
1095192884 12:39278430-39278452 GATCTCAGGCTTCCAACAGTGGG + Intergenic
1095444045 12:42267360-42267382 GGTCTCAGGAGATCTAAAGTGGG + Intronic
1095782355 12:46073619-46073641 GATATCAAGGGATCAACAGTGGG + Intergenic
1098519609 12:71420782-71420804 GCTCTCAGGACACCCACAGTGGG + Intronic
1098811196 12:75095353-75095375 AATTTCAAGACAGCAACAGTGGG - Intronic
1099071599 12:78051126-78051148 GGACTGATGACATCAACAGTGGG + Exonic
1102082263 12:110108031-110108053 AATCTCAGGTCAGCAGCAGTGGG - Intergenic
1102474551 12:113180212-113180234 TGTCTCATGACATCAAGAGTGGG - Intronic
1106981681 13:35291559-35291581 GAACTCAGGACTTCAACAGTAGG - Intronic
1107544071 13:41420628-41420650 TAGCTCAGGGCATCACCAGTGGG + Intergenic
1112657282 13:101464395-101464417 TATCTGAGTACATCAACACTTGG - Intronic
1118840648 14:69507909-69507931 GATCTCAGGAGTTCAACATAAGG - Intronic
1120273611 14:82345383-82345405 GATCTCAGAATATCACCAGATGG + Intergenic
1123905403 15:24915624-24915646 GAAATCAGAACATCAACACTGGG - Intronic
1132945689 16:2530457-2530479 GCTCTGAGGACAGCCACAGTGGG + Exonic
1136104330 16:28018718-28018740 GATCTCAGGACATCAACAGTGGG - Intronic
1138688398 16:58746690-58746712 GAGCCCAGGACAACAACAGATGG - Intergenic
1138739084 16:59286786-59286808 GATCTCATCACCTCAACATTTGG - Intergenic
1139239704 16:65378342-65378364 GAGCTTAGGACATCAACATATGG + Intergenic
1143737201 17:8920218-8920240 GTTCTGAAGACATCAAGAGTTGG - Intronic
1155713307 18:28908547-28908569 GATGTCAAGTCATCAACACTGGG + Intergenic
1159722789 18:71913962-71913984 GTTCTGAGGACAGCAGCAGTAGG - Intergenic
1163181988 19:15610718-15610740 AAAATCAGAACATCAACAGTTGG + Intergenic
1163786650 19:19278173-19278195 GCTCTCAGGACATGAACACGGGG - Intronic
1164087450 19:21916439-21916461 AGACTCAGGACCTCAACAGTGGG - Intergenic
1164637875 19:29804807-29804829 TAACTCAGGACAGCAACAGGAGG - Intergenic
1164984471 19:32638359-32638381 GCTCTCAGGAGACCCACAGTGGG - Intronic
1167101403 19:47406388-47406410 GACCTCAGGACTCCAAGAGTGGG - Intronic
925849092 2:8063124-8063146 GATCTCAGGATAACAACACGAGG - Intergenic
928637921 2:33266735-33266757 GCTCTCAGGATACCCACAGTGGG - Intronic
929188495 2:39120050-39120072 GATTCCAGGACAACAACAGTTGG - Intronic
929816407 2:45236443-45236465 GAGCTGAGGACAGCAACAGGTGG + Intergenic
932896555 2:75646238-75646260 GATCTCCTGACATCAGGAGTTGG + Intergenic
936760176 2:115768681-115768703 TATCTCAGGTCCTCAAAAGTTGG - Intronic
937737884 2:125313597-125313619 GCTCTCAGGAGACCCACAGTGGG - Intergenic
938776210 2:134543842-134543864 TCTCTCAGGACATCCACTGTGGG + Intronic
940195903 2:151093840-151093862 CTTATCAGTACATCAACAGTTGG - Intergenic
943685639 2:190815034-190815056 GAGCTCAGGACCTGAACTGTAGG - Intergenic
943928460 2:193819388-193819410 GTTCTCAGGAGACCCACAGTAGG + Intergenic
945731729 2:213545843-213545865 GACCTATGGACATCAACATTTGG - Intronic
948466280 2:238153272-238153294 CATCCCAGGACAGCAGCAGTGGG + Intergenic
1169251436 20:4064180-4064202 GAGTTCAGGACAGCAGCAGTGGG + Intergenic
1169360705 20:4946383-4946405 GTTCTCAGGTCCTCACCAGTGGG + Intronic
1177037352 21:16060545-16060567 GCTCTCAGGAGATCCAAAGTGGG + Intergenic
1182684781 22:32113626-32113648 GCTCTCAGGACTTCAAAAGCTGG + Intergenic
1184227424 22:43137077-43137099 GATTTCAGGACACCAAGAGGTGG - Exonic
951061792 3:18217164-18217186 AATTTCAAGAAATCAACAGTAGG + Intronic
953482865 3:43266780-43266802 TATCTCAGGAAATTACCAGTAGG + Intergenic
957417936 3:79929869-79929891 GCTCTCAGGAGACCCACAGTGGG - Intergenic
963310034 3:143699985-143700007 GATATCAGCACAGCCACAGTAGG + Intronic
969219739 4:5751951-5751973 GATCTCAGGGCAGCAACAGGAGG + Intronic
970888133 4:21010100-21010122 GAGGTTAGGACTTCAACAGTAGG + Intronic
972231276 4:37075186-37075208 GATGTCAGTACAGCAACATTGGG + Intergenic
973839807 4:54849859-54849881 GATCTCAGGGCATTAAAAATGGG + Intergenic
975859122 4:78657435-78657457 AATCTCAGGACATCTAAAATTGG - Intergenic
979156005 4:117391919-117391941 GATATCAGGTCAGCCACAGTAGG + Intergenic
981247209 4:142554421-142554443 GATTTGAGGAGATCAAGAGTAGG - Intronic
984712548 4:182897849-182897871 GATTTCAGGACCACAACAGGCGG - Intronic
985917756 5:2937548-2937570 GAGCTCAGGAGATCAAGACTAGG + Intergenic
986492972 5:8311459-8311481 GATTTCAGGACAAAAACTGTAGG + Intergenic
988301042 5:29427397-29427419 GATCCCTGGACCCCAACAGTTGG + Intergenic
988666373 5:33332702-33332724 GTTCTCAGGATTTCAAGAGTAGG - Intergenic
991230502 5:64327872-64327894 GATCTCAATACAATAACAGTTGG - Intronic
991230913 5:64331578-64331600 GTTCTCAGGAGACCCACAGTGGG - Intronic
993877986 5:93330286-93330308 AATCTCAGGAAAGCAAGAGTGGG - Intergenic
994305052 5:98192924-98192946 GATCTCATGAGAACAGCAGTGGG + Intergenic
994715199 5:103313082-103313104 AAACTCAGTACATCAAAAGTAGG + Intergenic
996064642 5:119067469-119067491 GATTTCAAGAAATCAAGAGTGGG + Intronic
996241594 5:121209818-121209840 GATCTCAGGACTACAACCCTTGG + Intergenic
997964154 5:138344849-138344871 GAACTCAGCACAGGAACAGTGGG - Exonic
998119752 5:139566371-139566393 GATTTCAGGTCATGCACAGTGGG + Intronic
999944768 5:156582991-156583013 GCTCTCTAGACATCATCAGTGGG - Intronic
1000154637 5:158538640-158538662 GCTCCCAGGACTTCAACAGGAGG + Intergenic
1002498154 5:179629799-179629821 GATCACTTGACATCAAGAGTTGG + Intronic
1007251443 6:40497835-40497857 AAGATCAGGACATCAACAGCTGG + Intronic
1011176632 6:84568753-84568775 GACCCCAGGACATCAAAATTTGG + Intergenic
1012028574 6:94029422-94029444 GATATCAGCAAAACAACAGTAGG + Intergenic
1015866912 6:137736399-137736421 GATCTCAGGACCTGGAGAGTGGG + Intergenic
1017100564 6:150846386-150846408 GATCTCATCACATCAAAAGGCGG - Intergenic
1022859412 7:34351897-34351919 GATCACATGAGGTCAACAGTTGG + Intergenic
1024024672 7:45400310-45400332 GCTCTCAGGACACCCAAAGTAGG - Intergenic
1024234155 7:47385214-47385236 GAGCTCAGCACATCAGCAGAAGG + Intronic
1025706271 7:63867407-63867429 GAGCTCAGGACATAAAGAGAAGG - Intergenic
1025782037 7:64610426-64610448 AGACTCAGGACCTCAACAGTGGG - Intergenic
1031177109 7:118367657-118367679 GATGTCAGCACATCAAGGGTTGG + Intergenic
1032417492 7:131747748-131747770 GATCTTGTGACATCAACAGAAGG + Intergenic
1032456036 7:132074315-132074337 GAAATAAGGACATCAACTGTGGG - Intergenic
1033865297 7:145684301-145684323 CATTTAAGGACATCAACAATAGG - Intergenic
1035107860 7:156457223-156457245 GTTCACAGGACATGAAAAGTGGG + Intergenic
1036414223 8:8531758-8531780 GATCTCAGTAAACCATCAGTGGG + Intergenic
1038968845 8:32608415-32608437 GAACTCAGGAGTTCCACAGTGGG - Intronic
1039194390 8:35014747-35014769 GCTCTCAGGACATGAACAGTAGG + Intergenic
1039505615 8:38050258-38050280 GATCTAAGCAAATCAACAGGAGG - Intronic
1040378774 8:46852011-46852033 AGACTCAGGACCTCAACAGTGGG - Intergenic
1040382931 8:46890513-46890535 AGACTCAGGACTTCAACAGTGGG + Intergenic
1043027266 8:75085488-75085510 GTTCTCAGGGGATCAAGAGTTGG + Intergenic
1043695246 8:83208877-83208899 GCTCTCAGGAGATCCAAAGTGGG - Intergenic
1043702805 8:83312578-83312600 GTTCTCAGGAGACCCACAGTGGG + Intergenic
1046458056 8:114494540-114494562 TCTCTCTTGACATCAACAGTTGG - Intergenic
1047848629 8:128831512-128831534 TTTCTCAGGATATGAACAGTTGG - Intergenic
1048259125 8:132930776-132930798 CATCTCTGGACATGAACAGATGG - Intronic
1051992041 9:23163146-23163168 GATATCAGGCCAGCCACAGTAGG + Intergenic
1052437172 9:28444060-28444082 GCTCTCAGGACACCCAAAGTTGG - Intronic
1062231327 9:135483434-135483456 GCCCTCAGGACCTCAGCAGTGGG - Intronic
1062548347 9:137074008-137074030 GGTGTCAGGACATGAACTGTTGG - Intergenic
1187510587 X:19914153-19914175 CATCTCAGGACCTCAGCAGAAGG - Exonic
1188856611 X:35204101-35204123 AATCTCAGGGAATCAAGAGTAGG + Intergenic
1191016406 X:55814065-55814087 GATCTCAGGAGAACCACAGTGGG - Intergenic
1191943512 X:66504535-66504557 GATATCAGCTCATCCACAGTAGG + Intergenic
1192380750 X:70613840-70613862 GATATCAGATCATCCACAGTAGG + Intronic
1194891456 X:99384481-99384503 GCTCTCAGGAGACCCACAGTGGG + Intergenic
1197615020 X:128681279-128681301 GATCTCAGCCCATCCTCAGTGGG + Intergenic
1199580086 X:149351964-149351986 GCCGTCAGGCCATCAACAGTGGG - Intergenic
1200849859 Y:7871965-7871987 AGACTCAGGACCTCAACAGTGGG + Intergenic
1200856094 Y:7940074-7940096 AGACTCAGGACCTCAACAGTGGG + Intergenic
1200858747 Y:7967396-7967418 AAACTCAGTACACCAACAGTGGG + Intergenic
1200890935 Y:8323376-8323398 AGACTCAGGACATCAACAATGGG - Intergenic
1201308836 Y:12576185-12576207 AATGTGAGGACATCAGCAGTGGG - Intergenic
1202133496 Y:21635817-21635839 GATCTCAGGATACAAAAAGTGGG - Intergenic
1202252646 Y:22889113-22889135 AAACTCAGAACCTCAACAGTGGG + Intergenic
1202265030 Y:23009153-23009175 AGACTCAGGACTTCAACAGTGGG - Intergenic
1202405635 Y:24522862-24522884 AAACTCAGAACCTCAACAGTGGG + Intergenic
1202418021 Y:24642895-24642917 AGACTCAGGACTTCAACAGTGGG - Intergenic
1202452765 Y:25027191-25027213 AGACTCAGGACTTCAACAGTGGG + Intergenic
1202465145 Y:25147220-25147242 AAACTCAGAACCTCAACAGTGGG - Intergenic