ID: 1136104354

View in Genome Browser
Species Human (GRCh38)
Location 16:28018860-28018882
Sequence CAGCTGGGCTTGGGGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136104354_1136104361 19 Left 1136104354 16:28018860-28018882 CCTTTGATCCCCAAGCCCAGCTG 0: 1
1: 0
2: 2
3: 30
4: 223
Right 1136104361 16:28018902-28018924 CACTTCATGATGCCAATCAGTGG 0: 1
1: 0
2: 1
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136104354 Original CRISPR CAGCTGGGCTTGGGGATCAA AGG (reversed) Intronic
900831644 1:4969774-4969796 AAGCTGGGGTTGGGGGTCCAGGG + Intergenic
901615296 1:10534714-10534736 GAGCTGGGCTTGGCTGTCAAGGG + Intronic
901727918 1:11256887-11256909 CAGCCAGGCTTGGGGAACGATGG - Intronic
902116424 1:14125301-14125323 CAATGGGGCTTGGGGGTCAATGG + Intergenic
902556011 1:17247234-17247256 CTGCTGGGCTTCTGGGTCAAGGG - Intergenic
903142080 1:21345021-21345043 CAGCTTGGCTTGGAGACCCAGGG - Intronic
903814654 1:26056070-26056092 CAGCTGAGGTTGGGGGACAAGGG - Intronic
904012636 1:27398582-27398604 AAGCTGGGCTGGGGAAGCAAAGG - Intergenic
904300773 1:29551996-29552018 GAGCTGGGCTTGGGGACACAGGG + Intergenic
904457430 1:30656047-30656069 GAGCTGGGCTTGGGGACACAGGG - Intergenic
904536340 1:31201993-31202015 CCGCTGGGCCTGGGGAGCCAGGG + Intronic
904948146 1:34214365-34214387 CTGCTAGGCCTGGGGATCCAGGG + Intronic
905975059 1:42168558-42168580 CAGAGGGGCTTGGGGAACAAGGG - Intergenic
906675317 1:47688910-47688932 CAGATGGGCTTTGGGAGCCAGGG - Intergenic
909784341 1:79592285-79592307 TATCTGGCCTTGGGGATGAAGGG + Intergenic
910975593 1:92902341-92902363 CAGCTTGGCTTGGGGATGTGTGG + Intronic
914329080 1:146649227-146649249 AAGCTGGGTTTGGGTATCACTGG + Intergenic
916171506 1:162004594-162004616 CAGCTGGGTTTGGGGATCTTGGG - Intronic
916723547 1:167503325-167503347 AAGCTGGGCTAGAGGATTAAAGG - Intronic
917515213 1:175701465-175701487 CAGCTGGGGTTGAGGAGCCAAGG - Intronic
917979324 1:180259566-180259588 CAGCTGAGCCTGGGGCTCAGTGG + Intronic
919671664 1:200344003-200344025 CAGCTGAGGTTGAGAATCAATGG - Intergenic
919794207 1:201311421-201311443 CAGCTGGGCGTGTGGGTGAAGGG + Intronic
920802228 1:209200057-209200079 TGGCTGGGCTTGGGAATCACTGG + Intergenic
923265006 1:232306005-232306027 GTGCTGGGCTTGGGAGTCAAAGG - Intergenic
923542333 1:234897502-234897524 CAGCTGGGGTTGGGGAGCATTGG - Intergenic
923944525 1:238868799-238868821 CTCCTGGGCTTGGGTCTCAAAGG - Intergenic
1065307418 10:24382200-24382222 CAGATGGGCTTGGGGATAAGAGG + Intronic
1065857086 10:29839454-29839476 CAGCAGGGCTGGGGGCTCATGGG + Intergenic
1067015798 10:42755556-42755578 CAGCTGAGCTTGGGGAGAATGGG - Intergenic
1067242676 10:44509351-44509373 CAGCTGCCCTTAGGGATCATGGG + Intergenic
1067737979 10:48873557-48873579 GAGCTGGGCTTGTGGAGCCAGGG + Exonic
1068739552 10:60452936-60452958 CAGCAGTGCTTGGGCATCACAGG - Intronic
1069774721 10:70919658-70919680 CAGCTGGGCTTGGGTCTGCAAGG + Intergenic
1070771555 10:79085327-79085349 AAGCTGGGGGTGGGGGTCAAGGG + Intronic
1071524647 10:86351396-86351418 GAGGTGGGCTGAGGGATCAATGG + Intronic
1073438304 10:103535787-103535809 CAGCTTGGCTTGGGGATGTTGGG + Intronic
1073576769 10:104632462-104632484 TAACTGGGCTTGAGGATTAAAGG - Intergenic
1074892352 10:117746246-117746268 CAGCGGGGCATGGGGAGGAAGGG - Intergenic
1076662679 10:132065761-132065783 GAGCTGGGCTGGGGGCTCAGAGG + Intergenic
1079601791 11:22318263-22318285 CAGCTGGGCTTAGGGATTCTTGG + Intergenic
1080599548 11:33808859-33808881 CGGCTGGGCCTGGGCATCAGAGG + Intergenic
1080784618 11:35463430-35463452 CAACTGGGCCGGGGGAACAAAGG + Intronic
1081976609 11:47239415-47239437 CAGCTGGGCTGGGGTCTCCAGGG - Exonic
1083281688 11:61630571-61630593 CAGCCAGGCTTGGGGACCACTGG - Intergenic
1083646420 11:64173878-64173900 CAACTGGGGTTGGGGGTCCAAGG + Intergenic
1083873435 11:65506729-65506751 GAGCTGGGCTGGGGGAGAAATGG + Intergenic
1084651973 11:70494831-70494853 CAGCTGGACTTGGTCATGAAGGG - Intronic
1085871078 11:80349865-80349887 GAGCTGGGCTTGGGGTTGATGGG + Intergenic
1089503232 11:118945299-118945321 CAGCTGAGCTTGGGGACTACTGG - Intronic
1089582254 11:119488822-119488844 CAGCTGGGCTAGGGCAGCACCGG - Intergenic
1089603572 11:119629002-119629024 CTGCTGGGCTTGGCAATGAAAGG - Intronic
1089902677 11:122004308-122004330 CAGCTGTGGTTGGAGATCATAGG + Intergenic
1090268183 11:125367937-125367959 CAGCTGGGCCTGGGGGTCGATGG - Exonic
1090355637 11:126138753-126138775 AGGCTGGGCTTGGAGCTCAAAGG + Intergenic
1091132683 11:133159746-133159768 CAGCTGGGCTTTGGGAGACAGGG - Intronic
1092948322 12:13476732-13476754 CAGTTGGGGCTGGGGATTAAGGG + Intergenic
1093652977 12:21665036-21665058 CAGATGGGGTTTGGAATCAAAGG - Intronic
1094125532 12:27018950-27018972 GAGCTGGGAGTGGGGATCCAGGG + Intergenic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1098334752 12:69391707-69391729 CAGGTAGGCATGGGGATAAAAGG - Intergenic
1102584604 12:113914417-113914439 CAGCCGGGGTTGGGGACCAGTGG - Intronic
1103730967 12:123027544-123027566 CATCTGGGGATGGGGATGAATGG + Intronic
1105514561 13:21077812-21077834 GAGCTGGGCCTGGGAACCAAAGG - Intergenic
1106087883 13:26558664-26558686 GTGATGGGCTTAGGGATCAATGG + Intronic
1106919643 13:34549692-34549714 CATCAGTGCTTGAGGATCAAAGG - Intergenic
1108346570 13:49552233-49552255 CAGCTGGGCCTGGGAAACAATGG - Exonic
1112753338 13:102604061-102604083 CAGCTGGGCGTGGGGATTCCTGG + Intronic
1113584814 13:111457994-111458016 CAGCAGAGCTTGGGGAGCAGCGG - Intergenic
1114580682 14:23756661-23756683 GTGCTGGGCTGGGGGATCTAGGG - Intergenic
1114954143 14:27796523-27796545 TAACTGGGCTTGGAAATCAAGGG - Intergenic
1115805594 14:37047509-37047531 CATCTGGGTTTGGGGAGCAGGGG - Intronic
1116235571 14:42275005-42275027 CAGCTGCTCTTAGAGATCAATGG + Intergenic
1116769877 14:49114842-49114864 CAGCTGGACTTTGAGAGCAATGG - Intergenic
1118739723 14:68730938-68730960 AAGATGGGCTTGGGGAGGAAGGG - Intergenic
1122081175 14:99268961-99268983 CAGCTGGGCATGGGGGTGAGGGG - Intronic
1124689057 15:31806598-31806620 CTGCTGGTCCTGGGGGTCAAAGG + Intronic
1125512183 15:40298072-40298094 CAGCAGGGATTGGGGGCCAATGG - Intronic
1125594020 15:40873133-40873155 CAGCCGGGCTTTGTGCTCAATGG + Exonic
1126235742 15:46382186-46382208 CAGCTGGGCATGGAAAACAATGG - Intergenic
1128510043 15:68307727-68307749 CTGCTGGGCTAGGGGAGCAGGGG + Intronic
1133447938 16:5878168-5878190 CAGCTGGACATGTGGATGAAGGG + Intergenic
1133804306 16:9112421-9112443 CACCTGCGCTGGTGGATCAACGG + Intronic
1135175521 16:20224746-20224768 GAACTGGGCTTAGGGATGAAGGG + Intergenic
1136075169 16:27812200-27812222 GTGCTGGGCTTGGGGACCACAGG + Intronic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1136686038 16:31995539-31995561 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1136786650 16:32939068-32939090 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1136883119 16:33914722-33914744 CTGCTGGGCCTGGGGATGAAAGG - Intergenic
1137436234 16:48456022-48456044 CAGCAGGGCTCAGGGATCAGCGG + Intergenic
1137563893 16:49521539-49521561 CAGCTCAGTTTGTGGATCAATGG + Intronic
1138081427 16:54094604-54094626 CAGGTGGACTTGGGAATCCAGGG + Intronic
1139990040 16:70933163-70933185 CAGCTGGGGATGGGGAAGAAAGG + Intronic
1140004485 16:71061712-71061734 AAGCTGGGTTTGGGTATCACTGG - Intronic
1141150781 16:81563270-81563292 CATCTTGGCTTGGGGATCATGGG + Intronic
1141205951 16:81933299-81933321 GAGCTGGTGTTGGGGAGCAAAGG + Intronic
1141564052 16:84889383-84889405 CAGCCGGGATTGGGTGTCAAGGG - Intronic
1203088887 16_KI270728v1_random:1200738-1200760 CTGCTGGGCCTGGGGATGAAAGG + Intergenic
1143186824 17:5014970-5014992 CAGAGGGGCTTGGGGCTCATGGG + Intronic
1143565891 17:7720324-7720346 CAGCCGGGCTTTGGATTCAAAGG - Intronic
1143610844 17:8016562-8016584 CAGCTGGGGTTGGGGCTGAGGGG - Intronic
1143680832 17:8474965-8474987 CAGCTCGGCTTAGGGGTCCACGG + Exonic
1147147001 17:38491207-38491229 CTGCTGGGCCTGGGGATGAAAGG + Intronic
1147256166 17:39183767-39183789 CAGCTGGGCTGGGTGATTGATGG + Exonic
1147901898 17:43792282-43792304 CAGCTTGTCTTGGGGATTAGGGG + Intergenic
1148789678 17:50166255-50166277 GAGCTGGGCTCTGGGATGAAGGG + Intronic
1148862226 17:50610428-50610450 CAGCAGGAATTGGGAATCAAAGG + Intronic
1150624310 17:66831899-66831921 CAGCTGTGCTTGGGGATTTGGGG - Intergenic
1151130976 17:71895606-71895628 CAGCTGGGGTTAGAGATCACTGG + Intergenic
1151772035 17:76170017-76170039 CAGCAGGACTTGGGGATCCTGGG + Intronic
1152097903 17:78282707-78282729 CAGATGGGCTTGGAGGTCCATGG + Intergenic
1152208852 17:78992204-78992226 CAGCTGTGCTTGAGTTTCAAAGG + Exonic
1153147264 18:2047705-2047727 CTGCTGGGCAGGGAGATCAAGGG - Intergenic
1153488056 18:5621277-5621299 CAACTGGGTTTAGGGATCACTGG - Intronic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1158561067 18:58514047-58514069 GAGCGGGGCTTGGGGAAAAAAGG + Intronic
1161184504 19:2907428-2907450 TAGCTGGCCTTGGGGATGAGAGG - Intronic
1161489722 19:4555300-4555322 CAGCTGGGATTGAGGCTCAGCGG - Intronic
1161716330 19:5877988-5878010 CAGCTGGGCCTGGGTACCAGGGG - Intronic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1162259213 19:9518790-9518812 TGGCTGGCCTTGGGGTTCAAGGG - Intergenic
1163813911 19:19452279-19452301 CACCTGGGCTGTGGGATCCAGGG - Intronic
1165472565 19:36011643-36011665 CAGGTGGGCTTTGGGGCCAAAGG - Intronic
1166977380 19:46612617-46612639 CAGCTGGGCTTTAGGGTAAATGG + Intergenic
1167115705 19:47488023-47488045 CAGCTGGTTTTGGGGGTGAAGGG + Exonic
1167557846 19:50206615-50206637 CTGCTGGGCTTGGGGATGGGAGG + Intronic
1167565038 19:50250714-50250736 CATGTGGGAGTGGGGATCAAGGG + Intronic
1167576667 19:50320965-50320987 CAGCTGGGAGAGGGTATCAAGGG + Intronic
925182410 2:1825932-1825954 CAGCTGGGCTGGGGTCTCATAGG - Intronic
926209961 2:10862450-10862472 CTGCTGGGCTTGGGGCTCTGCGG - Intergenic
926442575 2:12905811-12905833 CAGCTGGGCTTGGTTGTTAAGGG - Intergenic
926553299 2:14326758-14326780 CTGCTGGGGTTGGGGGGCAAGGG - Intergenic
931125678 2:59273920-59273942 CAGCTGAGCTTGGAGTTTAAGGG - Intergenic
934851059 2:97701509-97701531 CAGCCGGGTTTGGGGATCCCTGG + Intergenic
934924457 2:98372219-98372241 AAGCTGGGCTTGGAGGTCACTGG - Intronic
935756774 2:106282570-106282592 CAGCTGGGCTTTGCGATCCCTGG + Intergenic
936112794 2:109678455-109678477 CAGCTGGGCTTTGCGATCCCTGG - Intergenic
936917610 2:117655737-117655759 CAGCGGGGGTTGGGGGTGAAAGG + Intergenic
942669955 2:178364529-178364551 CAGCATGGCTTGGAGATCAGCGG + Intronic
946722866 2:222629516-222629538 AAGCTGTGTTTGGGGATCATTGG - Intronic
1171986257 20:31663509-31663531 CGGCTGGGCATGGGGATCACTGG + Intergenic
1172762529 20:37332454-37332476 GACCTGGGCTTGGGGGTCAGGGG + Intergenic
1173154400 20:40595655-40595677 CTGCTGGGCTTGGGGGTTCAAGG - Intergenic
1173944110 20:46936562-46936584 CATTTGGGTTTGGGGATAAAAGG + Intronic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1174830634 20:53809005-53809027 CGGCAAGCCTTGGGGATCAAAGG - Intergenic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1176141219 20:63545919-63545941 CATCAGGGCTTGGGGGTCAGAGG + Intronic
1176299134 21:5090357-5090379 CAGGTGGGCTTGGGGGTCACAGG + Intergenic
1177320010 21:19508918-19508940 CAGCTGGGCTTTGGGATGTTGGG + Intergenic
1179710794 21:43211889-43211911 CAGCTGGCCTTGGGGAGCTGGGG + Intergenic
1179857892 21:44171591-44171613 CAGGTGGGCTTGGGGGTCACAGG - Intergenic
1181282191 22:21727995-21728017 CTGCTGGGCGTGGCGATGAAGGG + Intronic
1181639095 22:24187509-24187531 GGGCAGGGCTTGGGGACCAAAGG + Intronic
1183304958 22:37077927-37077949 CTGCTGGGCTGGGGGAACCATGG - Intronic
1185338806 22:50282664-50282686 CAGCTGGGTGTGGGGAGCAGAGG + Intronic
949600177 3:5589706-5589728 CACCTAGGTTTGGGGCTCAAAGG + Intergenic
950267224 3:11583155-11583177 CAGCTGGGCTTGGGTATATCAGG - Intronic
953742307 3:45548185-45548207 CAGCTGGGGTTGGGGAGGACAGG - Exonic
954914726 3:54139045-54139067 CTGCTGAGCTTGGGGATCTGGGG + Intronic
955733602 3:62013578-62013600 CAGCAGGGCTTGGGTAGCTATGG + Intronic
959527194 3:107390303-107390325 CATCTGGGCTGGGGGGTAAAAGG - Intergenic
960942985 3:122946642-122946664 CAGCTGGGCTGAGGGACCAAAGG + Intronic
961472309 3:127123516-127123538 CAGCTGAGATTACGGATCAAGGG + Intergenic
962248675 3:133821037-133821059 CACCTGGCCTTGAGGATCAGGGG + Exonic
962345671 3:134617710-134617732 CAACTGGGCTGGGGGTACAAAGG + Intronic
964443031 3:156731593-156731615 CAGCTGAGCTTGGAAATCACTGG - Intergenic
967335262 3:188337135-188337157 CAGCTCGGCTTGGGGATGTCGGG + Intronic
968829967 4:2928301-2928323 CAGTGGGGCTTGGGGGTCTATGG - Exonic
969106508 4:4810771-4810793 CAGCTGGGATTGGGGATGCAAGG + Intergenic
969186688 4:5479639-5479661 CAGCAGGGCTTGGGTAACACTGG + Intronic
969494141 4:7516281-7516303 CAGCTGGGCGTGGGGAGGGACGG + Intronic
971681902 4:29710775-29710797 GAGCTGGGCTGGAGGATCCAAGG + Intergenic
972740126 4:41880581-41880603 CTGCTCCGCTTGGAGATCAAAGG - Intergenic
972948392 4:44286571-44286593 TAGCTGGGCATGTGGATGAAGGG + Intronic
974003364 4:56532206-56532228 CAGCTGGGTGGGGGGGTCAAAGG - Intronic
974054569 4:56972482-56972504 CAGATGGCTTTGGGGAACAATGG + Intronic
981430454 4:144652404-144652426 GAGCTGGGCTGGGAGAACAAAGG - Intronic
984719774 4:182958900-182958922 GAGCTGGGCTTGGGGACCTGAGG + Intergenic
985699888 5:1364440-1364462 TGGCTGGGCTTGGGGAATAATGG + Intergenic
986054603 5:4123830-4123852 CACCTGGGCTTGAGGATCACGGG - Intergenic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
986789770 5:11148477-11148499 CATCTGGGCTTGGTGGTCTATGG + Intronic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
990347686 5:54885554-54885576 CAGCTGGCCTTGTGGATGAATGG - Intergenic
991180036 5:63739649-63739671 AAGCAGGACTTGGGGATAAATGG - Intergenic
992572828 5:78077359-78077381 CAGTTGGCCTTGGGGATTCATGG - Intronic
992749414 5:79848749-79848771 TTCCTGGGCTTGGGTATCAACGG - Intergenic
995995368 5:118291818-118291840 CAGCTGGGGTTGGGTACCAATGG + Intergenic
996152566 5:120057928-120057950 CAGCTGGGCATGGTGATAAGAGG + Intergenic
997303102 5:132820632-132820654 CGGCTGGGCGTGGGGAGCACAGG - Intergenic
998342236 5:141428270-141428292 CAGCTTTGCTTGGGAATCAGAGG - Intronic
998389754 5:141779889-141779911 CAGCTGGGCCTGGGGATGTGAGG - Intergenic
998953064 5:147411388-147411410 CAGCTGGGCTTGGGAGGCAAGGG + Intronic
1004860856 6:19803573-19803595 CAGCTGGGCCAGGGGATTAAAGG + Intergenic
1006596792 6:35199500-35199522 CAGCTCGGCTTGGGAATCACTGG + Intergenic
1006879663 6:37327873-37327895 TTCTTGGGCTTGGGGATCAAAGG + Intronic
1011355482 6:86469011-86469033 CAGCTGGGCTTGGGTCCAAAGGG + Intergenic
1014152053 6:118068469-118068491 CAGCTGGGATTAGGTAGCAAGGG - Intronic
1014651935 6:124050512-124050534 CAGCCTGGCTTGGGGCTCAGTGG + Intronic
1015790376 6:136959161-136959183 CAGCTGGGCGTTGGGGTCTAGGG + Intergenic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018062883 6:160104339-160104361 CAGCTGCGCTGGGGGATCACTGG + Intronic
1018420132 6:163633922-163633944 CACCAGGGTTTGGGGATCATTGG + Intergenic
1022841303 7:34166512-34166534 CAGCTGTACTTGGGCATCAGGGG + Intergenic
1023278429 7:38545308-38545330 AATCTGGGCTTGGGGAATAAGGG + Intronic
1023780666 7:43652112-43652134 CAGCCGGGCTTGGGAACCAGTGG + Intronic
1026673792 7:72412586-72412608 CAGCTGGGCTTCTGGGTCAGTGG - Intronic
1027895575 7:84039443-84039465 TATCTGGTCTTGGGGTTCAAAGG + Intronic
1028854699 7:95577442-95577464 GAGCTGGGATTGGGGAACTAAGG - Intergenic
1029105041 7:98167992-98168014 CAGCTGTGCTTGGGGAGAAGTGG + Intronic
1030987126 7:116254694-116254716 CACCTGGGCTTGGGGTGCAGTGG - Intronic
1031811835 7:126379456-126379478 CAGATGGGCATGGGTATGAATGG + Intergenic
1034636936 7:152575103-152575125 CAGCTGTGCTTGGGGCTGATCGG + Intergenic
1035040152 7:155921199-155921221 CAGCTGGGTTTGGAAACCAACGG - Intergenic
1035519922 8:267154-267176 CAGGTGGGCTTTGGGGACAAGGG + Intergenic
1035758602 8:2052616-2052638 CAGCTGGGCTTAGAGCTCCAGGG + Intronic
1037138654 8:15493965-15493987 CAGCTGGCCTTGTAAATCAAAGG - Intronic
1037817130 8:22118241-22118263 CAGCTGGACTTGGGAACCACGGG + Intronic
1038179662 8:25214612-25214634 CAGTGGGGCTTGGGGGTCAGGGG - Intronic
1039215120 8:35261157-35261179 CAGATGGACTTGCGCATCAAAGG + Intronic
1041079476 8:54202669-54202691 CAGCTGAGCTTGGGGATGTTGGG + Intergenic
1041189591 8:55340565-55340587 GAGCTGGCCTTTGGGATCACTGG - Intronic
1041439398 8:57877726-57877748 CAGCTGGTCCTGGGGCCCAAAGG - Intergenic
1043393003 8:79809356-79809378 CAGCTGGTCATGGGAATCAGCGG + Intergenic
1045315387 8:101039561-101039583 GAGCTGGGCCTGGGAAGCAAGGG + Intergenic
1046507863 8:115159359-115159381 CAGCTGGGCTTCTGGGTCCATGG - Intergenic
1046617520 8:116493903-116493925 TAGCTGGGTGTTGGGATCAAGGG - Intergenic
1048574350 8:135679281-135679303 CAGCTGGGCTTGGGGATGGGTGG + Intergenic
1048577157 8:135701865-135701887 CAGCTTGGCTTGGGGATGGGTGG + Intergenic
1048612605 8:136040139-136040161 CAGGTGGGCATGGGGATATATGG - Intergenic
1050151474 9:2622450-2622472 GAGCCGGGCTTGGGGAACAGCGG + Intronic
1050561060 9:6834779-6834801 CGGCTGGCCTTGGGGTTCAGGGG - Intronic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1051165213 9:14254625-14254647 CAGATGGGCTTTTGGATCAGTGG - Intronic
1052823481 9:33158380-33158402 TAGCTGGACTGAGGGATCAAAGG - Intronic
1053121040 9:35547739-35547761 CAGCAGGGCTTGGGGATGATTGG - Exonic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1057187132 9:93063177-93063199 CTGCAGACCTTGGGGATCAAGGG + Intronic
1057871969 9:98725254-98725276 CAGCTGGGTTTGGAGATCTCTGG - Intergenic
1059354459 9:113688015-113688037 CAGCTGGGGGTGGGGGTCAGGGG + Intergenic
1060301923 9:122378934-122378956 GAGCTGGGCCTGGGGATTACAGG + Intronic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061746530 9:132744220-132744242 CAGCTGTGATTGGGGACGAAGGG - Intronic
1186789732 X:12985305-12985327 CAGCTGGACATGGGGAGGAAAGG - Intergenic
1191054569 X:56228943-56228965 AAGCTGGGCTGGGGAATGAAAGG - Intergenic
1192151069 X:68712706-68712728 CAGTAGGGCTTGGGGAGCAGAGG + Intronic
1192537292 X:71939066-71939088 AAGCTGGACTTGGGGAGCCAAGG + Intergenic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1192865673 X:75129441-75129463 CATTTGGGGTTGGGGAGCAAGGG + Intronic
1194725217 X:97387994-97388016 CATATCGGCTTGGGGATCATTGG + Intronic
1195606943 X:106816466-106816488 CTGATGGGTTTGGGGATAAAAGG - Intronic
1196641593 X:118068828-118068850 CAGCTGGACTTGAGGATATAGGG - Intronic
1199587505 X:149431747-149431769 CAGCTGAGCTTGGTGATGATGGG + Intergenic