ID: 1136104503

View in Genome Browser
Species Human (GRCh38)
Location 16:28020010-28020032
Sequence TTGGACTAAAGCACTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136104499_1136104503 13 Left 1136104499 16:28019974-28019996 CCTGTCTCGCCTTGTAGGCACTA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1136104503 16:28020010-28020032 TTGGACTAAAGCACTGAAGATGG 0: 1
1: 0
2: 0
3: 15
4: 178
1136104496_1136104503 28 Left 1136104496 16:28019959-28019981 CCCAAACTTGGGTCACCTGTCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1136104503 16:28020010-28020032 TTGGACTAAAGCACTGAAGATGG 0: 1
1: 0
2: 0
3: 15
4: 178
1136104500_1136104503 4 Left 1136104500 16:28019983-28020005 CCTTGTAGGCACTAGAGTTTCAG 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1136104503 16:28020010-28020032 TTGGACTAAAGCACTGAAGATGG 0: 1
1: 0
2: 0
3: 15
4: 178
1136104497_1136104503 27 Left 1136104497 16:28019960-28019982 CCAAACTTGGGTCACCTGTCTCG 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1136104503 16:28020010-28020032 TTGGACTAAAGCACTGAAGATGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136104503 Original CRISPR TTGGACTAAAGCACTGAAGA TGG Intronic
903801787 1:25974278-25974300 ATGGAATAAATCACTGTAGATGG + Intronic
904390822 1:30184640-30184662 ATGGACTAAAGGAAAGAAGATGG - Intergenic
905007393 1:34720935-34720957 TTGGAAAAAAGCCCTGCAGAGGG - Intronic
908304881 1:62802249-62802271 TTGGACTGGAGCAGTGAAGATGG - Intronic
908658828 1:66416894-66416916 TTGGACTAATACCCAGAAGAGGG + Intergenic
909340649 1:74527770-74527792 TTGGACTAAATCATTCATGAAGG - Intronic
911161836 1:94689112-94689134 TTGCCCTCAAGCCCTGAAGAGGG + Intergenic
911337556 1:96599013-96599035 TGTGACTAAAGCATTGGAGAGGG - Intergenic
912151538 1:106864672-106864694 TTAGACTAGAAAACTGAAGATGG + Intergenic
912860579 1:113210576-113210598 TTGGGCTAAAGCAAAGAAAAAGG - Intergenic
914953224 1:152137520-152137542 TTGGAGCAAAGATCTGAAGAAGG - Intergenic
915738773 1:158101996-158102018 TTGGACAAAAGCACAGAGGGAGG - Intergenic
916844011 1:168630015-168630037 CTGAACAGAAGCACTGAAGAGGG + Intergenic
918633817 1:186750869-186750891 TTGGAGTAATACAATGAAGAAGG + Intergenic
918823489 1:189290862-189290884 TTGGACTCAAACACTGATTATGG - Intergenic
918933613 1:190891079-190891101 TTTTACTAAATCACAGAAGAAGG - Intergenic
919727755 1:200895066-200895088 CTGGACTAAAGCCCAGAAGCAGG + Exonic
920410627 1:205757510-205757532 TTTGACAAATGCAATGAAGAAGG - Intergenic
923807818 1:237278715-237278737 ATAGACTTAAGCACTGAACATGG + Intronic
924797016 1:247300034-247300056 TTGGACTAGAGGAAAGAAGAAGG - Exonic
1064703549 10:18047040-18047062 TTGGATTAAATCTCTGAAGCTGG - Intergenic
1071280060 10:84093397-84093419 TTGTAATAAAAAACTGAAGAGGG + Intergenic
1073340034 10:102737368-102737390 TTGAACTAGAGTACTGAGGAAGG - Intronic
1076074751 10:127524304-127524326 TTGGACCAGGCCACTGAAGAGGG - Intergenic
1077977982 11:7269541-7269563 TTGAAGTAATGCACTAAAGAAGG - Intronic
1081528248 11:43941841-43941863 TTGGAGTAAAGCTCTCCAGATGG + Intronic
1086225145 11:84498918-84498940 TTGGACAAAAGCACTGTACCTGG - Intronic
1086262225 11:84953849-84953871 CTGGAACAAAGCATTGAAGAAGG - Intronic
1086856365 11:91870957-91870979 TAGGGTTATAGCACTGAAGATGG + Intergenic
1088842186 11:113636345-113636367 ATGGACTGAAGGACTGATGATGG + Intergenic
1093922943 12:24880150-24880172 TTGGGCTAAATCCCTGAAGCTGG + Intronic
1095353236 12:41240023-41240045 ATGGAGTAAATCACTGAAGCAGG + Intronic
1098008201 12:66021333-66021355 TTTGAGCAAAGCCCTGAAGAGGG - Intergenic
1098228960 12:68353415-68353437 TTGGCTTAAAGCAGGGAAGAGGG - Intergenic
1099541693 12:83917791-83917813 TTAGTCTAAAGCACTAAAAAGGG - Intergenic
1099887213 12:88546281-88546303 TTGGATTAAAGCACTGCTCAGGG - Intronic
1099994815 12:89767086-89767108 ATGGACTAATGCACTCATGAGGG - Intergenic
1100926095 12:99550022-99550044 TTGGACAAAAGACCTGCAGAAGG - Intronic
1107413325 13:40177667-40177689 TCGGATTAAAGCACTGACCAGGG - Intergenic
1110124362 13:71924175-71924197 TTTAAACAAAGCACTGAAGAAGG + Intergenic
1110697661 13:78510601-78510623 GTAGAGTAAAGCAATGAAGAGGG + Intergenic
1112691813 13:101905004-101905026 TTGGAGTAAGCCACTAAAGAGGG - Intronic
1113181926 13:107638817-107638839 TTCGACTGAAGCACTCCAGAAGG + Intronic
1113387933 13:109868321-109868343 TATGACTAAAACACTGAAAATGG + Intergenic
1115232963 14:31181384-31181406 CTGGACTCAAGCACTCAAGATGG - Intronic
1118046793 14:61978768-61978790 GTGGACTAAAGCAGTGAGGGAGG - Intergenic
1118100217 14:62591109-62591131 TTAAAATAAAGCATTGAAGATGG - Intergenic
1118677157 14:68199663-68199685 TCGGACCAAAGAACTGAAGGGGG - Intronic
1120604070 14:86550065-86550087 TTGAATTAAAACACTGATGAAGG + Intergenic
1120950426 14:90035869-90035891 TAGGACTAAAGAAATGAAGGGGG - Intronic
1121821734 14:96974153-96974175 CTGCACAAATGCACTGAAGAAGG + Intergenic
1125187204 15:36944728-36944750 TTGGAAATAATCACTGAAGATGG + Intronic
1127064625 15:55223679-55223701 TGGGACCAAAGCACTGAAGGAGG + Intronic
1130041243 15:80406584-80406606 ATGGACTAAAGATCTAAAGATGG + Intronic
1131679060 15:94702442-94702464 TCGGAGCACAGCACTGAAGATGG - Intergenic
1135910330 16:26554833-26554855 CTGGACTAAAGCTTTGGAGAAGG - Intergenic
1136104503 16:28020010-28020032 TTGGACTAAAGCACTGAAGATGG + Intronic
1139425147 16:66874547-66874569 TTTGAATAAAGGGCTGAAGAAGG + Intergenic
1139827027 16:69765491-69765513 TTGTAATAAAGCAGGGAAGAGGG + Intronic
1144441169 17:15283436-15283458 TAGGACTAAAGTACCAAAGAGGG - Intergenic
1146397100 17:32477080-32477102 TTGGAACAAGGCACTGAACAAGG - Intronic
1159122729 18:64189749-64189771 TTGTACTAAAGCATTAAATAAGG + Intergenic
1160937434 19:1603648-1603670 TTGGATGAAAGCACGGATGACGG + Intronic
1164444876 19:28308304-28308326 TTGGACCAAGGCCCTGAAGCTGG - Intergenic
1164560263 19:29287011-29287033 GTGGAATAAAGCACTGAAAAAGG - Intergenic
1164830875 19:31319664-31319686 TTCTACTAGAACACTGAAGAGGG + Intronic
1165537581 19:36462381-36462403 TAGGACTAGAGAACTGAATAGGG - Intronic
1166722820 19:45007076-45007098 TTTGACCAAGGAACTGAAGATGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168379955 19:55911768-55911790 TTTGCCTAAAGCACTGTAAAAGG - Exonic
1168502545 19:56905607-56905629 TGGGAATAAAACATTGAAGAGGG - Intergenic
925275676 2:2646421-2646443 TTTAATTAATGCACTGAAGAAGG + Intergenic
925741177 2:7007127-7007149 CTGGAAGAAAGCACTGAGGAGGG - Intronic
928018948 2:27685698-27685720 TTGGACTAAAGTTCTCAAGAAGG + Intronic
933920396 2:87039881-87039903 TTGGACTCTAGCACAGCAGAGGG + Intergenic
933931228 2:87153905-87153927 TTGGACTCTAGCACAGCAGAGGG - Intergenic
934002601 2:87730017-87730039 TTGGACTCTAGCACAGCAGAGGG - Intergenic
934953889 2:98600470-98600492 TTGTTCTAAAGCACAGAAAATGG - Exonic
936361894 2:111811527-111811549 TTGGACTCTAGCACAGCAGAGGG + Intronic
936505701 2:113104114-113104136 TTCTACTGAAGCACTGAGGAAGG + Intergenic
936821807 2:116530593-116530615 TTCTACTAAAGCAGTGCAGAGGG + Intergenic
938426786 2:131199039-131199061 TTTCACTTAAACACTGAAGACGG - Intronic
939520691 2:143226113-143226135 TTGGATGAAAAAACTGAAGAGGG - Intronic
940182123 2:150946295-150946317 TTGGAGGAAAACACTGAAGGGGG + Intergenic
940434810 2:153638901-153638923 ATGGACTAAAACAATGAGGAAGG + Intergenic
941480586 2:166004812-166004834 TTGAACTAAAGCCTTTAAGAGGG - Intronic
943314323 2:186367495-186367517 TCGGACTAAAACACTCAAGTTGG + Intergenic
1172116396 20:32575876-32575898 TTTGACCAAAGACCTGAAGAGGG + Intronic
1172868103 20:38115226-38115248 TTGTGCAAAAGCCCTGAAGAGGG + Intronic
1173226916 20:41167527-41167549 CTGAACTAAAGCACTGAATATGG + Intronic
1173924426 20:46770268-46770290 TGGGAGTACAGCACTGAACATGG + Intergenic
1175581681 20:60104655-60104677 TTGGAGTATGGCACTGAAGGGGG + Intergenic
1177862324 21:26468907-26468929 TTGATCAAAAGCACTGAAGCGGG + Intronic
1178214565 21:30579592-30579614 TTGGATTAATGCACAGATGAAGG + Intergenic
1179132933 21:38655169-38655191 TTAGACCTCAGCACTGAAGAAGG - Intronic
1179165184 21:38929956-38929978 ATGGACTAAGGCACTGATGAAGG + Intergenic
1180593378 22:16958716-16958738 TTGTACTGAAGCACTGGAGCAGG - Intergenic
1182105966 22:27689592-27689614 AGGGACTAAAGAAATGAAGATGG + Intergenic
1183794100 22:40100815-40100837 TTGAACCTAAGCACTGTAGAGGG + Intronic
950771115 3:15311968-15311990 CTGGACTACAAGACTGAAGATGG - Intronic
952278739 3:31903035-31903057 TTGGACTATAGCAGGGATGAAGG - Intronic
955126716 3:56119458-56119480 TTGGAGTAAACCAGGGAAGAAGG - Intronic
956374560 3:68600565-68600587 CTGGACTAAAGGAATGAACAGGG + Intergenic
957965478 3:87317360-87317382 TTGGATCAAATTACTGAAGATGG + Intergenic
959008014 3:101042571-101042593 TTGTAGTAAAGCCCTGAAGTGGG + Intergenic
960302094 3:116015542-116015564 TTGAACTATATAACTGAAGAGGG + Intronic
962354650 3:134683571-134683593 TTTGACTTAACCACTGTAGATGG - Intronic
964421924 3:156512320-156512342 CTTGACAAAAGCAGTGAAGATGG - Intronic
965002607 3:162974835-162974857 TTGGAATACTGCATTGAAGAAGG + Intergenic
965748776 3:171955177-171955199 TTTGACTAAAGCACCAAATAAGG + Intergenic
966949915 3:184807030-184807052 TTTGAGCAAAGCCCTGAAGAAGG + Intergenic
970109393 4:12620371-12620393 TGGGCCCAAACCACTGAAGATGG - Intergenic
970172764 4:13305804-13305826 TTTGAGTAAAGAACTGAAGGAGG - Intergenic
970322362 4:14887320-14887342 TTGAACTAAACCGATGAAGAGGG - Intergenic
973046608 4:45541619-45541641 TTTTACTACAGCAGTGAAGAGGG + Intergenic
974100893 4:57415076-57415098 TTGGACTAAGGCAATCAAGAGGG - Intergenic
974982329 4:68974081-68974103 TTGAAATAACTCACTGAAGAGGG + Intergenic
974995132 4:69146623-69146645 ATGAAATAACGCACTGAAGAGGG - Intronic
975044643 4:69786345-69786367 TTGGAGTGAGGCACTGAATATGG + Intronic
979162772 4:117484857-117484879 TAGGATTATAGCAGTGAAGATGG + Intergenic
979510108 4:121543659-121543681 TTGAATAAAAGCAGTGAAGATGG - Intergenic
983035305 4:162857599-162857621 TGGGGCTAAAGCAGTGAATAAGG - Intergenic
984554639 4:181199113-181199135 TTGGTATAAAACACTGCAGAGGG - Intergenic
986232752 5:5881704-5881726 TTTGAGTAAAGCTCTGAAGGAGG - Intergenic
987278403 5:16386968-16386990 TTGGAATAAAGGAGTTAAGAAGG + Intergenic
989745905 5:44829497-44829519 CTGGAAAAAAGCACTGAACATGG + Intergenic
990634658 5:57711147-57711169 TAGGACATAAGCACTGAAAAGGG + Intergenic
994337323 5:98582852-98582874 TTGCCTTAAAGCACAGAAGAGGG - Intergenic
995284250 5:110368711-110368733 TTGCACAAACGAACTGAAGATGG + Intronic
995973565 5:118003426-118003448 TTCGAGTAAAGATCTGAAGAAGG - Intergenic
997307622 5:132851059-132851081 TTGGACTATGGCAGTGGAGATGG - Intergenic
997677532 5:135724456-135724478 TTGGTCTAAAGCTCGCAAGATGG + Intergenic
998632685 5:143917670-143917692 TTTGACTCAAGCACACAAGAAGG + Intergenic
1000114293 5:158138811-158138833 TTCGAGTAAAGACCTGAAGAAGG - Intergenic
1000303252 5:159973661-159973683 CTGGAAAAAAGCACTGAGGAAGG + Intergenic
1001767032 5:174257910-174257932 TTGGACAAGAGCAAGGAAGAAGG - Intergenic
1002210158 5:177594000-177594022 TGGGGCTAAGACACTGAAGAGGG + Intronic
1003668745 6:8135707-8135729 TGGGAGTATAGCACTGAAGAAGG + Intergenic
1003891270 6:10565839-10565861 ATGGATTAAAGCACGGAACAGGG - Intronic
1006758204 6:36436369-36436391 TAGGACAGAAGCACTGGAGATGG + Intronic
1006968689 6:38017292-38017314 TTGGAATAAAGCACAGGAGAAGG + Intronic
1007019957 6:38509549-38509571 CTGAAATAAAGCACTGAAGTGGG + Intronic
1007660507 6:43482572-43482594 TCGGACAGAAGCACAGAAGAAGG - Intronic
1008810981 6:55498510-55498532 TTGCACCAAAGCAGTGAAGACGG - Intronic
1010828793 6:80505772-80505794 TTGGACTCAAGCAGTGAAGGAGG - Intergenic
1011781472 6:90794607-90794629 GGGGACTAAAGCCCTGATGAGGG - Intergenic
1011824225 6:91287429-91287451 CTGGACATAAGCAATGAAGAAGG + Intergenic
1013347842 6:109279271-109279293 TTGAACTAAGGCAGTGAGGATGG - Intergenic
1013671618 6:112409234-112409256 TAGGACAAAAGCACTGGATATGG - Intergenic
1016273316 6:142316299-142316321 TTGTACTAGAGCTCAGAAGATGG + Intronic
1018744413 6:166750801-166750823 TTGGTCTAAAGCAATGGAAATGG + Intronic
1021368866 7:19816380-19816402 TTGAACTAAAGTAATGAAAATGG + Intergenic
1021935459 7:25626467-25626489 TTGTAATTAAGCACTGAAAATGG - Intergenic
1023161907 7:37305123-37305145 CTGAAATAAAGAACTGAAGATGG + Intronic
1023256778 7:38320172-38320194 TTGGAGTAAAGCACTGAGAGAGG + Intergenic
1024469256 7:49750216-49750238 TTGGAGTAAAGCTCTACAGAGGG - Intergenic
1024769155 7:52697791-52697813 TGGGCCTAAATCACTGAACAAGG + Intergenic
1026080861 7:67218940-67218962 TTGAACGAAAGTAGTGAAGATGG + Intronic
1030052951 7:105554931-105554953 TTTGACAAAAGCACTGAAGCAGG + Intronic
1030465993 7:109904831-109904853 CAAGACTATAGCACTGAAGATGG - Intergenic
1030984198 7:116221933-116221955 TTAGACTATACCACTAAAGAAGG - Intronic
1031809631 7:126349843-126349865 TTAAATTAAAGCACTGAACATGG + Intergenic
1033081126 7:138298451-138298473 TTGCACTAAAATCCTGAAGAAGG - Intergenic
1036057648 8:5276031-5276053 TTGTACTAAAGCAGTGCAGAGGG - Intergenic
1038067783 8:23981605-23981627 TGGCATTAAATCACTGAAGAAGG + Intergenic
1038073181 8:24040717-24040739 TTGAACTAAAGCATTGATTAAGG - Intergenic
1042104245 8:65307781-65307803 TTGGACTAAGGCAATGACCAGGG + Intergenic
1043596598 8:81894515-81894537 TTGGTCTAAATTCCTGAAGAAGG + Intergenic
1043839269 8:85083113-85083135 TTGGAATAAAGCATTGCAGTGGG - Intergenic
1044958124 8:97503148-97503170 CTGGACTCAAGCACTGGAGGGGG - Intergenic
1046891741 8:119429840-119429862 TGGGAATAAAGCAGTGAACAAGG + Intergenic
1047980751 8:130179086-130179108 TTTGTATAAAACACTGAAGATGG + Intronic
1053381426 9:37652028-37652050 ACGGTCCAAAGCACTGAAGAAGG - Intronic
1057794138 9:98143609-98143631 TCACAGTAAAGCACTGAAGACGG + Intronic
1057978281 9:99630149-99630171 TTGGAAGAAAGCATTGAATAAGG + Intergenic
1058672987 9:107376407-107376429 TTGGAGTAAAGGACAGAAAAAGG + Intergenic
1059214918 9:112552687-112552709 TCTGACTAAGGCACTGGAGAGGG - Intronic
1059998575 9:119937677-119937699 CTGGACTAAAGCAGAAAAGACGG + Intergenic
1060443794 9:123668733-123668755 TTGGAATAATGCATCGAAGAAGG - Intronic
1185507636 X:642337-642359 TTGGAATAAAACGGTGAAGAAGG - Intronic
1186127091 X:6425969-6425991 TTGCACTAACGAACTGAAGATGG + Intergenic
1186825848 X:13339597-13339619 TGGGACTAACTAACTGAAGAGGG + Intergenic
1189048819 X:37621866-37621888 TTGGCCTAAAGCCATGAAGCAGG - Intronic
1190981225 X:55458100-55458122 TTGGAGGAAAGAAATGAAGAAGG + Intergenic
1190987473 X:55515080-55515102 TTGGAGGAAAGAAATGAAGAAGG - Intergenic
1192502398 X:71662676-71662698 AGGGAGAAAAGCACTGAAGAAGG + Intergenic
1193407153 X:81115747-81115769 TTGTAATAAAACACTGAAAATGG - Intronic
1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG + Intergenic
1196102944 X:111866476-111866498 CAGAACTGAAGCACTGAAGAGGG - Intronic
1196812227 X:119637866-119637888 TTGCAATAAAGCTCAGAAGAGGG + Intronic
1197614533 X:128676662-128676684 TTTTACTAATGCACTGAAGGTGG - Intergenic
1198640699 X:138752782-138752804 TTGGACCAAAGCACAGACCATGG + Intronic
1198804742 X:140482946-140482968 TTGGACTAAAGAAATGTAGGTGG - Intergenic
1200497708 Y:3904739-3904761 TTGCAATAAAGCACTAAATATGG + Intergenic